Journal of Applied Engineering & Computer Sciences

ISSN : 2319-5606

Journal of Engineering, Computers & Applied Sciences

Journal of Applied Engineering & Computer Sciences Volume 2, No 4, April 2013

Blue Ocean Research Journals www.borjournals.com ww

SR.No

Title/Author

Page No.

1

Integrated Solar Wall System With Combined Electricity And Windows Radhakrishnan.P, Mahesh Priya.L, Sowmya.S

1-4

2

Optical Studies on Sol-Gel Derived Lead Chloride Crystals I.Rejeena, B.Lillibai, B.Nithyaja, V.P.N.Nampoori, P.Radhakrishnan

5-9

3

Simulation of Plasma Transferred ARC (PTA) Hardfaced on Structural Steel with Titanium Carbide S.Balamurugan, N.Murugan

10-14

4

Elimination of Charge Sharing Problem in Dynamic Circuit Saurabh Sharma, Sanjeev Maheshwari, Sanjeev Kumar, Vrince Vimal

15-19

5

Effect Of Climate Change On Global Surface Temperature Dr. S.C. Dubey, Mr. G.P. Dubey, Dr. L.K. Borkar

20-24

6

Solar Powered Generator Free Electricity Amrit Pal Singh

25-29

7

Data Leakage Detection Sachin A. Bansode, Uday M. Jadhav, Prof. N. K. Patil

30-34

8

9

Biotransformation of a Textile AZO Dye Acid Yellow 25 by Marinobacter Gudaonensis AY-13 Shertate R.S., Thorat P.R. Techno-Economic Analysis of a Mixed Grainage for the Production of Multivoltine and Bivoltine Commercial Seed Production in Karnataka (India) B.S.Angadi

35-45

46-49

10

Comparative Study of EMC Greenplum and Oracle Exadata Ektaa Rajput, Harshita Yadav, Ayushi Singh

50-54

11

Comparative Study of 1G, 2G, 3G and 4G Sapna Shukla, Varsha Khare, Shubhanshi Garg, Paramanand Sharma

55-63

12

A Novel Application for Android Based Handheld Devices Rashmi Sharma, Somya, Deepa Raghava

64-67

13

Dual Watermarking For High Protective Copyright System Sagar R Dhole, Rahul S.Shahane, KrishnaV.Varat, Ganesh N.Falake

68-71

14

To Identify Disease Treatment Relationship in Short Text Using Machine Learning & Natural Language Processing Khan Razik , Dhande Mayur , Patil Aniket,Gaikwad Namrata

15

www.borjournals.com

A Review on Need of BI in an Organization Saloni Bansal , Soumya Awasthi, Charu Gupta

72-75

81-84

Blue Ocean Research Publications

Journal off Engineering,, Computers & & Applied Scieences (JEC&ASS) ISSSN No: 2319‐5 5606 Volume 2,, No.4, April 2 2013 ________________________________________________________________________________________

Inteegrated Solar Wall W Sy ystem W With Com mbined d Electrricity And d Wind dows Radhakrrishnan.P, Asssistant Professsor, Departm ment of EEE, Karpagam K Uniiversity, Coim mbatore Mahesh Priya.L, Assiistant Professoor, Departmen nt of Social Work, W Karpagaam University, Coimbatore Sowmyaa.S, Final Yearr Student, Deppartment of Civil Engineeriing, Karpagam m University, Coimbatore

ABSTR RACT This papper presents a study on thee utilization of o solar energgy, and buildiing solar walll system. A significant s amount of o research and developmeent work has to be carriedd out in develloped nationss. Windows w with power generatioon system iss not develooped. A rangge of theoreetical model have investtigated for aand their appropriiateness validaated by simullation data. Im mprovement of o the solar wall's w perform mances can bee obtained using douuble glazing. The T results deemonstrated thhat solar wall provides enerrgy savings. Keyword ds: Solar wallls, Dynamic Simulation, S Inddoor thermal comfort, c Enerrgy analysis.

1. Introoduction The appllication of Window W Photoovoltaic system ms incorporaating hybrid PV Thermal collectors iss a viable m method of costt saving due to t the combin ned provisionn of electricaal power, heaated air and hot h water forr use within thhe building. Using thiis technology,, air is actively passed behiind the PV modules, theere by coolinng the cells to w can thhen be used to maintain efficiency, which temper vventilation airr or re-circullated throughh a heater baattery for hot water w provisioon. The issuee of PV cost is currently one o of the maain factors limiting l its wide-scale application. a A As Window Photovoltaicc systems inccur even highher mal capital coosts due to thhe plant requiired for therm collectionn and distribbution, this technology may m seem eveen less econom mically viablee to an architeect or develooper. Howeverr, if considerred at an eaarly stage in a building’’s design usiing a holistiic approach to incorporaate passive an nd active solaar systems , thhis technologgy can provid de significantt life cycle coost savings ccompared to standard s PV, and thereforee a reductionn in the pay--back period of the originnal capital ouutlay. To ensure that the appllication of Wiindow Photovolltaic systems is appropriatte for a speciific building and its looad requirem ments, detailled d stage can assist in simulatioon at the design optimizinng the perform mance of the innstalled system m. Building Integrated Phhotovoltaic (B BIPV) is rapiddly o integration of PV devicces developinng concept of into buildding envelopees. BIPV sysstems can be designed in form f of facadees, roofs orr PV glazing g with accennt put on full fu functionaal, structural and aesthetiical integration and coopperation with the t building.

During operatio D on of PV sysstems neither noise nor poollution is prooduced. A Advanced conccept of BIPV V systems is solar s skin w which unifies both b opaque and a semitranspparent PV ellements togetther with dou uble-skin faccades and attractive W Window wall systems s into architecturally a ennergy generatiing building envelope. e

Fig.1 Glazzing with inteegrated semi-tran nsparent PV module m

2.. Descriptioon Phhotovoltaic caan be integrated into the facade f of thhe building as cladding or glazing. g The orrientation off the facade may be verrtical, as in walls, w or sloped, as in rooofs, domes, or vaults. Thhe curtain w wall, consistingg of a frame fitted f with inffill panes, is especially suitable s to PV V integrationn. It is a coommon buillding envelo ope technoloogy that reesembles conv ventional phottovoltaic technnology.

www.bo orjournals.co om Blue O Ocean Resea arch Journalls 1


opptimization of o its structu ural, geometrrical and teechnological parameters, p a complex siimulation m model must be established. It basically coonsists of solved inndividual models m whhich are sim multaneously.

Fig .3.1 Coomplex modeel scheme

Figg .2.1 Basic ex xperimental PV P façade A numbeer of different PV facade appproaches werre investigaated as followss: 1. Warm versus cold façade Insulating glaass versus weaather claddingg 2. 3. Frame designn 4. Cladding verssus stick-wall 5. Encapsulationn 6. Transparencyy of PV Mechaniccally ventilateed PV system m is designed in two partts along a ceentral glassedd-in strip of the t existing facade. PV panels p will bee mounted onn a steel/alum minum supporrting structuree covering walll.

gical and airfflow model 3..1 Meteorolog Thhe overall sim mulation modeel takes meteoorological daata and airrspeed as input variaables for coomputation of o thermal and a electricaal energy ouutput. Calculaations of metteorological inputs i are baased on MET TEONORM data. Furtherrmore the vaalues of ambient temperatuure and wind speed are neeeded. Frrom the natu ure of airflow w in the mecchanically w window air gapp follows that the velocity of o moving aiir can be deetermined inddependently of o the air teemperature. Airspeed A in the window w gap is obbtained by annalytical solu ution of Naviier-Stokes eqquation and co ontinuity equation for 1D stationary tuurbulent flow,, where the air a is consideered to be N Newtonian uncompressible fluid. f m 3..2 Electrical model Calculation of electrical eneergy output is based on A Perfo ormance Model. The Phhotovoltaic Array am mount of ouutput power depends, beeside the inncident solar radiation, on n solar cells operating teemperature – with w increasing cells temperrature, the effficiency of ennergy conversion is decreassing. Byy a maximuum power pooint tracking (MPPT) coontroller are the main energy sourcees of the syystem That is why it is dessirable to keepp the cells teemperature low w, which can be done by mechanical m w window of the air a gap Foor determinattion of a ben nefit of the mechanical m w window an ap ppropriate theermal model must be buuilt.

Fig. 2.2 Ven ntilated PV faacade

ulation 3. Simu For prediction of PV system behavior annd



heeat equation with w mixed boundary condditions for coonduction witthin the PV panels and for f forced coonvection in thhe air gap. Thhe network of heat exchhange with key k nodal teemperatures giiven below.

3.3 Therrmal Model Incident solar radiatiion on the PV P modules is g cover annd either refflected or abssorbed by a glass the rest iss transmitted to t the solar ceells. A portionn of energy absorbed a by thhe solar cells is directly converted into electriccity and th he urned into heatt. remaininng energy is tu Thermal energy geneerated at thee solar cells is conducteed simultaneously towards front and baack surface oof the PV mod dules.

F 3.4 Netwo Fig. ork of heat exxchange with key noodal temperattures mportant is thhat thermal ennergy from thhe air Im gaap can be colleected and utilized for heatinng or coooling of a buiilding. Foor instance during heaating season the prreheated air can c be directeed into ventilaation unnit and duringg summer tim me this hot airr can drrive desiccant cooling systeem.

4.. Results Models discusssed Section IIII; a simulationn has M beeen developedd using MATL LAB/Simulinnk. In orrder to verify y the system performance load deemand data. Thhe power diffference betweeen the generaation soources and the load demannd and micro grid baalance power quality by FA ACTS devices..

5.. Conclusioon

k of solar eneergy Figg .3.3 Network conveersion This eneergy is radiatted and convverted from the t modules’’ surfaces to surroundinngs or to the t window aair gap, respecctively. The therm mal model is then based onn solution of 1D 1

Inn this paper, a Window Phhotovoltaic syystem is proposed. Studied utillization of solar ennergy, and buuilding solar wall w system which w caapable to mainntain load dem mand in peak load .B By using solaar wall ambieent temperaturre of inndoor is minim mum in summ mer and electtrical poower outage is maintained. Model cann be ussed in hot /coool conditionns. The simulaation m model of thee hybrid sy ystem has been deeveloped using MA ATLAB/Simuulink. Siimulation studies have beeen carried ouut to


Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319‐5606 Volume 2, No.4, April 2013 _________________________________________________________________________________

verify the system performance under different scenarios using the practical load.

6. Reference [1] The German Solar Energy Society: Planning and Installing Photovoltaic Systems – A Guide for Installers, Architects and Engineers, James & James, London, 2005 [2] Heinemann, D.: Energy Meteorology – Lecture notes, Carl von Ossietzky Universität, Oldenburg, 2002 [3] King, D. L., Boyson, W. E., Kratochvil, J. A.: Photovoltaic Array Performance Model,

Sandia National Laboratories, Albuquerque, 2004 [4] Incropera, F. P., DeWitt, D. P.: Introduction to Heat Transfer, 3rd ed., John Wiley & Sons, New York, 1996 [5] Mei, L., Infield, D., Eicker, U., Fux, V.: Thermal Modelling of a Building with an Integrated Ventilated PV Façade, Energy and Buildings 35 (2003)pp. 605-617 [6] C. Hua, J. Lin, and C. Shen, “Implementation of a DSP-controlled photovoltaic system with peak power tracking,” IEEE Trans. Ind. Electron., vol. 45, no. 1, pp. 99–107, Feb. 1998

www.borjournals.com Blue Ocean Research Journals 4


Optical Studies on Sol-Gel Derived Lead Chloride Crystals I.Rejeena, International School of Photonics, Cochin University of Science and Technology, Cochin Kerala, India and M.S.M.College, Kayamkulam, Kerala, India B.Lillibai, International School of Photonics, Cochin University of Science and Technology, Cochin Kerala, India, B.Nithyaja, International School of Photonics, Cochin University of Science and Technology, Cochin Kerala, India V.P.N.Nampoori, International School of Photonics, Cochin University of Science and Technology, Cochin Kerala, India P.Radhakrishnan, International School of Photonics, Cochin University of Science and Technology, Cochin Kerala, India

ABSTRACT Optical characterization of lead chloride crystals prepared by sol-gel method is reported. The relevant sol-gel technique is used for the preparation of PbCl2 samples with five different types. In this paper, we report the absorption and fluorescence behaviour of pure, UV& IR irradiated and electric & magnetic field applied lead chloride crystal samples in solution phase at two different concentrations. Optical bandgap and emission studies of these crystals are also done. KEYWORDS: Lead chloride, absorption,fluorescence,gel method,spectroscopy

Introduction Flourescence spectroscopy is of overwhelming importance in the field of photo physics. Lead chloride is a well known photosensitive material possessing ionic crystalline nature belonging to orthorhombic system [1]. PbCl2 is the model material from heavy element halogenide group since it satisfies high birefringence, low attenuation coefficient and wide transparency range [2]. Many of the researchers reported the luminescence property of PbCl2 [3]. Under excitation in the fundamental absorption region, PbCl2 crystals exhibit two types of intrinsic luminescence [4]. W.C.DE Gruijter had done emission studies on PbCl2 [5]. The top of the valence band is composed of Pb2+-6s with considerable admixing of chlorinenp, while the bottom of the conduction band is made up of Pb2+-6p [6]. PbCl2 is classified as a normal class I crystal and its transmission range is wide [7-8]. PbCl2 finds importance in experimental field due to their large band gap and exhibiting interesting features from the stand point of electron-lattice interaction [9-18]. Lead halide based materials can be used as laser hosts with low phonon energies. The Pb2+ in the PbCl2 crystal is known to be emissive in aqueous solution [19-22]. In the present study, we report for the first time the absorption and fluorescence emission properties of PbCl2 crystal samples prepared by sol-gel technique through five different methods. PbCl2 is marked as an insulator with a moderate bandgap. They belong to the space symmetry group D2h16

with layers perpendicular to the [010] direction. The lead chloride crystal is characterized by an excitonic fundamental edge, which are formed by electronic states of lead ion.Our experiments on the growth of lead chloride confirm the utility of this method for growing large needles and single crystals. In the visible region the length of the needle is small compared to the growth of lead chloride crystals under the influence of ultraviolet and infrared radiations.

Experimental Technique In our spectroscopic studies the PbCl2 crystal samples used were prepared by using a stock solution of sodium meta silicate (SMS). A quantity of 25 ml. of SMS solution of specific gravity 1.03, whose pH was adjusted to be 6.5, 7.0, 7.5 , 8.0 and 8.5 by titration with 1M tartaric acid, and was allowed to gel in five various boiling test tubes without any disturbances. Growth experiments were conducted for different densities of the gel ranging from 1.02 to 1.06. It was found that for the same concentration of HCl, tartaric acid and lead nitrate solution, the rate of growth of the needles is conspicuously larger and the needles are larger for lesser densities of the gel. This is due to the increased rate of diffusion of HCl in the gel and increased mobility of the molecules of the crystals at lower densities of the gel. PbCl2 crystals were obtained by the reactions of lead nitrate, tartaric acid and HCl (99.9% Sigma-Aldrich). Two



different PbCl2 crystaal samples weere obtained by irradiatinng pure PbCl2 crystals witth ultra violet ( UV lampp (insect Killler)) and Inffrared radiatioons (HL43111 (PHILIPS)) 230V~50H Hz~150w). The T other twoo samples werre prepared by subjecting the t crystal too an electric field of 20 V using paralllel plate arraangement and d subjecting the t crystal to oa magneticc field using two bar maagnets kept on either sside of thee experimenntal test tu ube perpendiccular to the length l of the test-tube. Thhus five PbC Cl2 samples were w obtained for our studies viz pure, UV and IR irradiated, sam mples subjectted to electric and magnettic fields. Thee sol-gel deriv ved PbCl2 sam mples were suubjected to X-ray X diffractiion studies ( XPERT-PRO O using K-Alppha 1.54060 A0 (XRDML L)). The cryystal structurre of PbCl2 is confirmeed to be orth horhombic diipyramidal with w each Pbb having a coordination under 9. Observattions under peetrological miicroscope reveeal that PbC Cl2 crystals grown undeer all the fiive conditionns show inclinned extinctionn. The preparred crystal saamples were powdered ussing mortar and a pestle, w weighed about 0.15g and disssolved in 15 ml of single distilled water w (SDW W) to obtain a concentraation c1=0.01 gm/m ml. Anothher concentraation c2=0.02 2 gm/ml waas obtained by dissolvinng 0.32gm inn 20 ml of SDW. For the t dissolutioon ,a magnettic stirrer waas used and the t solvent evaporation was preventeed by using a sealed gglass containeer. Linear absorption of the t crystal ssamples in soolution phasee was record ded using Jassco V-570 UV V/VIS/IR Speectrophotometter. Optical bband gap of these t sampless were obtain ned from liinear absorp ption measuurements. The T emissionn and excitatioon studies werre carried out by taking thhe room temp perature flourrescence specctra of thesee PbCl2 samp ples using a Cary Eclip pse fluoresceence spectroph hotometer (Vaarian).

deescribed as elo ongated alongg the c axis w with (100), (0010) as main forms f and (1110), (120) andd (210) as sm maller faces, while at the t top (0111) is the doominant form m. From the exxternal observvations of foour sets of lead chloride dihydrate d crysstals, it is cllear that there is no chhange in thee external m morphology by y naked eye. 1.. Absorpption Studies O Optical absorpttion spectra of o PbCl2 samples at two diifferent concentrations c1 and a c2 are shoown in the figgure 1. (aa)

(bb)

Result And Discussion Observattions under peetrological miicroscope reveeal that PbC Cl2 crystals grown under all the fo our conditionns show inclin ned extinctionn. The dendrittes grown unnder the fourr conditions show s variatioons from onne another. Those T grown under infrarred radiationn are radiating g type while those in visibble d grow wth light are fibrolitic. Larrge massive dendritic was obsserved under ultra violet radiation. The T tendencyy for radiating g along the axxis of the crysstal was founnd when grow wn in all thee conditions. A study off external morphology m s shows that the t crystals grown in the presence of o radiation are a needle sshaped good quality acicular aggregattes with shiinning edgess. Each inddividual in the t aggregatee is highly brittle, b tubulaar needles. The T habit of llead chloride crystals that is least affectted morpholoogically by external faactors can be

Fiigure 1. Room m temperaturee absorption spectra s of pbbCl2 at concenntrations (a) c1 and (b) c2 Thhe absorptio on peak of PbCl2 at the two cooncentrations c1 and c2 are located in i the uv reegion at 266 nm n correspondds to 4.6 eV. The peak att this particulaar wavelength is due to the electronic traansition from the valence band b to the PbC Cl+ cation [223-24]. There is no valuablle change in absorption a peeak for varyiing concentraation.The aboove linear abbsorption specctra can be used for optical band gap stuudies on PbCll2 in solution phase p in singlle distilled w water.. The linear absorptionn coefficient α can be deetermined froom absorptioon spectra, which is reelated to the band gap Eg as (αhν)2=k (hν- Eg), w where hν is the incident lightt energy, k is a constant



and Eg iss the optical band b gap of lead l chloride. A graph of Eg= hν versess (αhν)2 givess the direct baand gap of PbCl2 for fivve different samples at tw wo concentraations c1 andd c2. The optical band gap of PbCl2 forr concentratioon c1 is varyinng from 4.54 eV e (pure) to 4.67 eV (mag gnetic). For uv u irradiated and a electric field f applied PbCl P 2 sampless, Eg is 4.54 eV e and 4.555 eV respectivvely. When cooncentration iss at c2, Eg vaaries between 4.6 and 4.46 eV. The valuues of directt band gap att c1 and c2 are a listed in the t table1. Several types of o chloride ioon vacancies can c exist in tthe lead chlorride lattice whhich are electrron traps in the energy range r 4.2-4.44 eV above the t valence bband [24].

chhloride ions arre surroundedd by five lead ions [25]. It was suggesteed that the 4.6 eV absorption to be an exxciton absorpttion , but on the t other handd it might 6s2-6s6p allso be ascribed to a characteristic c traansition insidee the lead ion..

2 Optical baand gap plot of Pure PbC Cl2 Figure 2. sample att concentratio ons (a) c1 and (b) c2 Figure 2 shows the direct d band gaap behaviour of PbCl2 saamples at twoo different cooncentrations c1 and c2. T The chloride ioons at the larggest distance are a surroundded by four leead ions wherre as the closest



Fiigure 3. Flourrescence emisssion spectra of o PbCl2 at a wavelength 270 nm for (a) pure (b) UV (c) IR (d) ellectricfield andd (e) magneticcfield applied samples. Taable 1. Measu ured values of optical bandd gap and em mission peakss for PbCl2 att concentrationns c1 and c22(gm/ml) PbbCl2 saample

2.Flouresscence Studiess Flouresceence spectra of PbCl2 aree taken at tw wo different concentrattions c1 and c2 for f photolum minescence stuudies. Figure 3 represents the t fluoresceence emission spectra of five PbC Cl2 samples in SDW. PbCl2 samp ple solutionss at concentrattions c1 and c2 c are excitedd at a wavellength of 2770 nm gives three stroong emissionns at around 421 4 nm, 491 nm n and 533 nm n respectivvely.

puure

Optical direcct band gap at concentration ns C1 C2 2 (eV V) (eV) 4.54 4.661

U UV

4.53

4.554

IR R

4.62

4.440

Ellectric

4.57

4.555

M Magnetic

4.67

4.446

Emisssion peak at C1 (nm) 348 431 498 540 422 491 534 339 423 492 533 342 421 493 533 338 424 490 531

C2 (nm) 357 422 490 525 423 487 532 342 423 492 533 342 421 492 533 342 423 493 533

l chloride are partly Thhe excitonic trransitions in lead exxplained by th he 6s-6p transiition in lead ioons which giives the emisssion bands at three of the t above traansitions. Floourescence in PbCl2 is com mposed of brroad guassian band with larrge stokes shifft and it is inndicative of strong excciton-acoustic phonon innteraction [26]]. The electricc dipole transiition from thhe 6p to 6s sttates also prooduces lumineescence in PbbCl2. The exccitons can rellax into pairs of a self traapped electro on (STEL) an nd a self trappped hole (S STH) when both b electronss and holes strongly innteract with acoustic phhonons. A repulsive coorrelation is ascribable a to the origin off electronhoole separationn. The repulsiive correlationn through accoustic phonoons with thee formation of o cooper paairs mediated by these acou ustic phonons cause the sppontaneous breeaking of exccitons [27]. A concentratiion is increased, phonon vibration As w induce mo will ore non radiative de excitattions. Our PbbCl2 solutionss show many peaks p due to the t stokes shhift by the cry ystal field inteeractions resullting from



the strong interaction between phonon and Pb2+ ions. From the fluorescence spectra given in the figure, it is evident that the emission peaks at 491 and 533 nm are assigned to the excitonic emissions. For pure PbCl2 sample, the emission peak at 431 nm at concentration c2 is red shifted. The IR irradiated and electric field applied samples have almost same emission peak at 423, 492 and 533 nm for the two concentrations c1 and c2. The shifting of emission peaks at pure PbCl2 sample is due to the band edge emission which are attributed to the quasi free recombination at the absorption band edge. Thus the spontaneous exciton dissociation has been revealed by the fluorescence emission in sol- gel derived PbCl2 samples in solution phase.

Conclutions High quality lead chloride crystals were prepared by sol-gel technique. The obtained PbCl2 crystal samples of five different types in solution phase were subjected to spectrophotometric studies. The linear absorption spectra give the optical band gap details of these crystals. Photo luminescence studies on these lead chloride samples were done by fluorescence spectroscopy. The fluorescence emission of these crystals shows that PbCl2 crystals have the band gap in connection with the 6s to 6p gap in lead ions and tend to become highly luminescent coming from the odd transition. Thus the high luminescence nature of lead chloride makes them suitable for applications in photography, acoustical-optical devices and radiation detectors.

Acknowledgements The authors acknowledge KSCSTE and Moulana Azad National Fellowship schemes for financial support.

References [1] H.Nakagawa, Y.Doi, T.Nakamura , “Absorption and luminescence in PbCl2 : Tl+ crystals”.J. Lumin. 87-89 (2000) 1130-1132 [2] P.Nishasanthakumari, S.Kalainathan, Cryst. Res.Technol. 43 (2008) 4 [3] M.Kituara, H.Nakagawa, J. Lumin. 72-74 (1997) 883

[4] M.Kituara, H.Nakagawa, J. Electron Spectrosc. Relat. Phenom. 79 (1996) 171 [5] W.C.DE.Gruijter, J. Solid State Chem. 6 (1973) 151 [6] M. Fujita et al, J. Phys. Soc.Japan 60 (1991) 4393 [7] F.E.A.Melo, K.W.Garret, J. Mendes Filho, J.E.Moreira, Solid State Commn., 29-33 (1979) 31 [8] O.Keefe.M, Comm. Sol.State Phys. 7 (1977) 163 [9] Plekhanov.V Phys.StatusSolidi B 57 (1973) K55 [10] Nistor.S.V, Goovaerts.E and Schoemaker.D 1993 Phys.Rev.B 48 9575 [11] Kitaura M, Nakagawa.H 1996 J.Electron Spectrosc.Relat.Phenom. 79 171 [12] Kitaura.M and Nakagawa.H 1997 J.Lumin. 72-74 883 [13] Itoh.M, Nakagawa.H, Kitaura. M, Fujita.M and Alov.D.L 1999 J.Phys.:Condens.Matter 11 3003 [14] Kink.R, Avarmaa.T, Kisand.V. Lohmus.A, Kink.I and Martinson.I 1998 J.Phys.:Condens.Matter 10 693 [15] Kanbe.J, Takezoe.H,and Onaka.R 1976 J.Phys.Soc.Jpn. 41 942 [16] Eijkelenkamp A.J.H.and V A.J os.K J.. 1976 Phys.Status Solidi B 76 769 [17] Beaumont.J.H,.Bourdillon .A.J and Bordas.J 1977 J.Phys.C 10 761 [18] Fujita.M, Nakagawa.H, Fukui.K, Matsumoto.H, Miyanaga.T and Watanabe.M 1991 J.Phys.Soc.Jpn. 60 4393 [19] Hans Niikol, Alexander Becht, Arnd Vogler, Inorg. Chem. 3277-3279 (1992) 31 [20] P. Pringshem, H,Vogels, Physica 225 (1940) 7 [21] C.W.Sill, H.E. Peterson, Anal. Chem. 1266 (1949) 21 [22] R. Narayanaswamy, P.J. Mayne, G.F. Kirkbright, J. Inorg. Nucl. Chem.129 (1978) 40 [23] K.I Best, Z. Physik, 163 (1961) 309 [24] K.J.Devries, Doctoral Dissertation, University of Utrecht (1965) [25] K.J.Devries, J.H.Vansanten, Physica 20512058 (1964) 30 [26] G.Liidja, V.I.Plekhanov, J. Lumin. 6 (1973) 71 [27] Masanobu Iwanga, Tetsusuke Hayashi, J. Lumin. 102-103 (2003) 663-668



Simulation of Plasma Transferred ARC (PTA) Hardfaced on Structural Steel with Titanium Carbide S.Balamurugan, Assistant Professor, Department of Mechanical Engineering, Coimbatore Institute of Technology – Coimbatore, INDIA N.Murugan, Professor, Department of Mechanical Engineering, Coimbatore Institute of Technology – Coimbatore, INDIA

ABSTRACT Plasma Transferred Arc (PTA) hardfacing performed to improve the surface properties of metallic machine parts locally. Hardfacing process was applied when the surface to be damaged by wear due to hard minerals. The analyses of PTA hardfacing on structural steel with titanium carbide (TiC) are employed using by finite element technique. The aim of this work is to compare the simulated measured weld bead geometry values with experimental results at various heat input conditions and showing good agreement. Key Words: PTA hardfacing, FEM, validation

1. Introduction It was reported that wear resistance could be improved when hard particles were embedded in a tough, metallic matrix [1, 2]. Hardfacing is a technique used to improve the surface properties of metallic mechanical parts, such as the resistance against wear and correction. Surface properties and quality depend upon the selected alloys and deposition processes [3, 4]. Depending on the applied technique, common problems encountered in hardfacing are combination of a poor bonding of the applied surface layer to the base material, the occurrence of porosity of the thermal distortion of the workspiece, the mixing of the layer with the base material and the inability of a very local treatment [5]. According to the literature, coatings obtained by PTA present a very good alternative to other hardfacing processes, such as conventional techniques or more recent ones like laser cladding [6, 7]. A significant advantage of PTA surfacing over traditional surface welding processes arises from the fact that the consumable material used is in the powder form. This fact enables a wide range of composition for the coating materials and even mixtures of different material powders. Finite Element (FE) simulation of welding consists of transient thermal analysis to predict the hardfaced structures. The results of simulation of welding can be used to explain the physical essence of the complex phenomena explicitly and can be used for optimizing the process parameters. Therefore, FE simulation of the welding process using ANSYS software has great significance from both theoretical and practical aspects [8]. It is observed that finite element coupled field thermal and structural

carried out on butt and fillet welds, but not on hardfacing deposits [9, 10]. Hence, finite element analysis using ANSYS birth and death technique is used in the present work to identify the correct welding parameters like welding current, welding voltage, welding speed, base metal preheat and inter pass temperature requirements, to facilitate crack-free hardfacing and limiting the welding residual stress. The finite element analysis of hardfacing of titanium carbide on structural steel plate is performed using ANSYS software by applying different heat input conditions. The thermal diffusivity of the base material plays a large role - if the diffusivity is high, the material cooling rate is high and the HAZ is relatively small. Alternatively, a low diffusivity leads to slower cooling and a larger HAZ. The amount of heat inputted by the hardfacing process plays an important role. To calculate the heat input for arc welding procedures, the following formula is used: ∗ ∗ 60 ∗ ∗ 1000 Where Q = heat input (kJ/mm), V = voltage (V), I = current (A), and S = welding speed (mm/min). The efficiency depends on the welding process used. For PTA hardfacing efficiency is taken as 0.6 [11] The objective of this work is to compare the experimentally measured weld bead geometry with simulated results at various heat input conditions.

2. Matrial Properties The chemical composition and mechanical properties are shown in Table 1. The temperature dependent thermal properties of base substrate and TiC are shown in Table 2.

analytical studies for evaluating residual stresses using ANSYS birth and death analysis have been



3. Finite Element Simulation A substrate structural steel plates with dimensions 150 mm x 100 mm x 20 mm thickness and 100 mm X 12 mm X 2 mm hardfaced material placed on the substrate. Hardfaced process is simulated a single pass. The eight-node brick elements are used in meshing the model. To simulate the moving heat source element birth and death technique of ANSYS was used. The element type SOLID70, which has a single degree of freedom, was used for the thermal analysis. For the structural analysis the element type SOLID45, with three translational degrees of freedom at each node, was used. Constraints (all degrees of freedom) are placed at both ends of the plate, as during hardfacing these ends are tack welded to prevent any distortion. Fig.1 shows the meshed model.

4. Experimental Procedure Using PTA hardfacing system, Titanium Carbide (TiC) was deposited onto the structural steel plate of size 150 mm X 100 mm X 25 mm. This was done by changing the welding parameters to achieve different heat input conditions: Low, medium and high. Single hardfacing bead was laid on each plate. Samples were prepared from each hardfaced plate by cutting them at their centre perpendicular to hardfacing direction. Standard metallurgical procedures were employed to prepare the samples from PTA hardfacing deposited at different heat input conditions as shown in Table. 3. Hardfaced plate and typical cross section are shown in Fig.2 and Fig.3 respectively.

Table .1: Chemical Composition and Mechanical Properties of Structural Steel and TiC Elements, Weight % Sl.No Material Used C Si Mn S P Mg Ti Fe 1 2

IS:2062 (Base Metal) Titanium Carbide (TiC) (PTA Powder) Hardness Base Metal

Hardfaced Metal

18 HRC

56HRC

0.18

0.18

0.98

0.016

0.016

-

-

bal

0.04

0.03

0.03

-

-

0.09

99.0

0.12

Tensile Strength

Yield Strength

485 MPa

275 MPa

Table.2 The temperature dependent material properties of substrate and TiC. IS 2062 MILD STEEL TiC Temp(0C) K ( W/m0C) C (J/kg 0C) K(W/m0C) C(Jkg0C) 0 60 100 50 200 45 400 38 566 620 42 600 30 800 25 (average of 1000 26 200C to 15150) 1200 28 1400 1550

37 37



Fig.1 1Meshed moddel of the PTA A hardfaced pllate

Fig 1. Photoograph of hardfaced plate

Fiig 2. Typical cross c sectionn of hardfaceed plate

Table. 3 PTA Hardfacing Experrimental Cond ditions Paraameters Heeat Input, Sl.No kJ/mm I S F H T 1 1660 140 1 16 10 2990 15..14 Low Heat H Input(LH HI) 2 2005 130 1 14 9 2660 18..85 Mediuum Heat Inputt(MHI) 3 1990 120 1 16 10 2990 20..98 High Heat H Input(HH HI) I =Welding Current (ampss); S = Weldinng Speed (mm m/min); F = Po owder feed ratte (gm/min); H = Oscillation Width W (mm); T = Pre heatt temperature (0C).

5. Resu ult And Disscussion The resuults of simulaation obtainedd for three heeat input coondition as shown in the Table. 4. Transverrse section is taken from Q-Slice optiion availablee in ANSYS, used to find the penetratiion and longitudinal temperature plots are used to fiind bead widdth of the weld profile. From the Figuress 2 and 3, itt is understoo od the heat input increases, penetratioon increases. From the sim mulated results, it is concluuded that beaad width and penetration are a

d the strrongly affecteed by appliedd heat input during TiiC hardfacing of plates. The measuured bead geeometry param meters of thee plates are compared w with simulatioon results whhich are presented in Taable 4 and Fiigure 4. Thus to obtain a good g weld beead profile, selection s of process paraameters is im mportant. It iss evident that, Finite Elemeent results arre less deviateed when com mpared to expperimental reesults and th hese deviatioons are duee to the asssumptions made m in fin nite element analysis.

www.bo orjournals.co om Blue Ocea an Research Journals 12


Figg.2 Typical Teemperature Coontour plot of hardfaced plaate.

Fig.3 Typicaal Temperaturre Counter ploot cut the traansverse direcction of hardfaaced plate Table 4 Comparison of measured d and predicteed bead geom metry of hardfaced plate. No Sl.N

Penetrattion(mm)

Heat Inpput, (kJ/mm m)

Beadd width (mm)

1 2

LHI MHI

Exxp 0 0.99 1.60

FE EM 0.90 1.49

% Errror 9.09 6.87

Exp 11.20 10.58

FEM 11.00 10.16

% Error 1.79 3.96

3

HHI

0 0.85

0.80

5.88

11.77

11.43

2.88



Fig.4 Comparison C off effect of heaat input on beaad width and penetration p

6. Con nclusion Three dim mensional theermal models is employed to predict tthe bead geoometry param meters such as penetratioon and beadd width andd the predictted results arre compared with w experimenntal results.

7. Refferences [1] U.Drraugelats, B. Bouaifi and T. T Plegge. Weeld Res. Abrroad, 42,(11), pp. p 39 -41, 19996. [2] A. K. Jha, B.. K. Prasad, R. R Dasgupta, et al.; J.Maater.Eng.Perfoorm, 8, (2), pp. p 190 – 19 96, 1999. [3] J.R.Davis annd Associatees, Hardfacin ng, weld claadding and dissimilar d meetal joining in; ASM Handbook H – Welding, Brazing and a Solderingg, Vol.6, 10th Ed, ASM metals m Park, OH, O 1993, pp – 699 – 823. [4] E.Lugscheideer,U.Morkram mor, A. AitA Makidechhe, Advancces in PT TA surfacin ng, Proceedinng of the Fou urth National Thermal Sprray Conferennce, Pittsburghh, PA, USA, 1991. 1 [5] Wolfgang Whal, W Stuttgart, Trends for f Hardfacinng, www.eengineers.org.il/ uploads/11683/drwhal0206.pdf [6] D’ Oliveira, A.S.C.M., Yaedu, Y A.E and a Silva P..S.C.P, “ Influence oof dilution on microstruucture and meechanical propperties of cobaaltbased allloy deposited d by Plasma Transferred T A Arc Welding””, Internation nal Conferencce on Advancced materialss, their processes andd application ns, materialss week, Mucheen , 2002. [7] Agustin Guallo Hernan G. Svoboda Esteela S.Surian and Luis A. de vedia, Efffect of weldiing procedurre on wear behavior of o a modifiied martenstiic tool steel hardfacing h deeposit, Materials & Designn, Elsevier, 20011. [8] Ivaana Vasovic, Dragi Stam menkovic, Finnite element analysis of reesidual stress in butt weldiing

tw wo similar pllates, Scientiffic Technicall Review, V LIX, No.1, 2009, pp. 577-59 Vol. [99] Xiang gyang Lu, Tasnim T Hassaan, Finite reesidual stressees in butt andd socket weldded joints, Trransactions, SMiRT S 16, Papper No. 1983,, 2001 [110] ASM reaady reference: Thermal prooperties of m metals, ASM FU Yuue-chun, SHI Nan-lin, [11] N Zhanng De-zhi, Y YANG Rui. Prreparation of SiC/Ti compposites by poowder cloth teechnique[J]. The T Chinese Journal J of N Nonferrous Metals, M 2004, 14(3): 465− −470. (in Chhinese)



Elimination of Charge Sharing Problem in Dynamic Circuit Saurabh Sharma, Sr.Lecturer ,Department of Electronics and Communication, MIET Group, Meerut Sanjeev Maheshwari, Director, MIET Group, Meerut Sanjeev Kumar, HOD, Department of Electrical Engineering, IET Group, Meerut Vrince Vimal, Asst. Proffessor, Department of Electronics and Communication, MIET Group, Meerut ABSTRACT A technology is proposed in this literature to simultaneously reduce the charge sharing problem in the dynamiccircuits due to the generation of the parasitic capacitor at each node. Here we used a weak PMOS pullup device(with a small W/L ratio) to the dynamic CMOS stage output to reduce the effect of the parasitic capacitor Keywordss—NMOS, PMOS. CMOS, domino logic, weaker PMOS Tool Used---- Tanner.

Introduction The digital integrated circuit charge sharing problem has become one of the foremost issues in the design of very deep submicron VLSI chips. Charge sharing in digital circuits refers to any phenomenon that causes the voltage at a node to deviate from its nominal value. While these charge sharing always existed, in the past they had little impact on the performance of integrated circuits and were often neglected. It is the unstopped aggressive technology scaling in an effort to continuously improve chip performance and integration level that makes charge sharing plays an increasingly important role in comparison with conventional design metrics like area, speed and power consumption. Together with technology scaling, aggressive design practices like employing dynamic logic styles have also seen wider use in recent years to achieve higher performance of integrated circuits. Circuits design using dynamic logic style can be considerably faster and more compact then their static CMOS counterparts. This is especially the case with wide fan-in dynamic logic gates where a single gate can realize the logic function that otherwise would require multiple levels of static CMOS logic gates. Therefore, wide fan-in dynamic gates are routinely employed in performancecritical blocks of high performance chips, such as in microprocessor, digital signal processor, and so on. In this paper, we propose a novel design method to enhance the charge sharing problem tolerance of dynamic circuits by analyzes their results on

tanner. We will show that dynamic logic gates are not necessarily less charge sharing problem tolerant if proper charge sharing problem tolerant design techniques are employed. In fact, using the proposed method in this paper, charge sharing tolerance of dynamic logic circuits can be improved beyond the level of static CMOS logic gates while still retain their advantage in performance. The proposed charge sharing tolerant design method can be realized using a number of different circuits and therefore having broader impact.

Dynamic Circuit In the dynamic CMOS circuit technique, clock pulse is given between a PMOS and a NMOS and the NMOS logic is connected between them. The circuit operation is based on first precharging the output node capacitance and subsequently evaluating the output level according to the applied inputs. Both of these operations are scheduled by a single clock signal which drives one NMOS and one PMOS transistors in each dynamic stage. When the clock signal is high then precharge transistor p1 turns off and n1 turns on. If the input signal creates a conducting path between the output node and ground then output capacitance will discharge towards 0V.When the clock signal is low the PMOS transistor p1 is conducting and the complementary NMOS transistor n1 is off .The output capacitance of the circuit is charged up through the conducting PMOS transistor to a logic high level of VDD.



Fig.1: CM MOS Dynamiic inverter

caapacitance is already chargge to VDD but b due to thhe charge disstribution at each node oof NMOS loogic, it will be corrupted.

we have impleemented the dynamic d inverrter Above w using tannner and gen nerated its waveform. w Fig g,2 shows thhat there is a problem p in dynnamic circuit, in the evalluation phasee if the inpput is low the t

T-Spice1 v( cloc k)

1 .2

1 .1

1 .0

0 .9

V o lt a g e (V )

0 .8

0 .7

0 .6

0 .5

0 .4

0 .3

0 .2

0 .1

0 .0 0

10

20

30

40

50

60

70

80

Time (ns)

T-Spice1 v( out )

1 .2

1 .1

1 .0

0 .9

V o lt a g e (V )

0 .8

0 .7

0 .6

0 .5

0 .4

0 .3

0 .2

0 .1

0 .0 0

10

20

30

40

50

60

70

80

Time (ns)

T-Spice1 v( In)

1 .2

1 .1

1 .0

0 .9

V o lt a g e (V )

0 .8

0 .7

0 .6

0 .5

0 .4

0 .3

0 .2

0 .1

0 .0 0

10

20

30

40

50

60

70

80

Time (ns)

Figg.2: Waveform m for CMOS dynamic d inverrter

www.bo orjournals.co om Blue Ocea an Research h Journals 16


CM MOS stage is either disscharged to low l level thhrough the NM MOS circuitry (1 to 0 transittion), or it reemains high. Consequentlyy, the invertter output vooltage can alsoo make at most one transitiion during thhe evaluation phase, p from 0 to1.Regardlless of the innput voltage applied a to the dynamic CM MOS stage, it is not possiblle for the CMO OS inverter too make a 1 too 0 transition during d the evaaluation phase.

Dominoo logic In the doomino logic, we w connectedd a static CMO OS inverter aat the output of o the dynamicc circuit. Duriing the prechharge phase (when clock is i 0), the outpput node of tthe dynamic CMOS C stage is i precharged to high loggic level, and d the output of the CMO OS inverter bbecomes low.. When the cllock signal risses at the beeginning of th he evaluation phase, there are a two posssibilities: The output node of the dynam mic

Fig g.3: Domino loogic Above w we have impplemented thee domino loggic using tannner and gen nerated its waveform. w Fig g.4 shows that there are soome limitationns in the domiino logic. Fiirst, only nonn-inverting sttructure can be

mplemented and a second chharge sharingg between im thhe dynamic staage output nodde and the inttermediate noodes of the NMOS loggic block duuring the evvaluation phasse may cause erroneous e outtputs. Cell0 v( out )

1 .0

Voltage (V)

0 .5

0 .0

- 0. 5

- 1. 0

0

10

20

30

40

50

60

70

80

Time (ns)

Cell0 v( In)

1 .2

1 .1

1 .0

0 .9

Voltage (V)

0 .8

0 .7

0 .6

0 .5

0 .4

0 .3

0 .2

0 .1

0 .0 0

10

20

30

40

50

60

70

80

Time (ns)

Cell0 v( Ckl )

1 .2

1 .1

1 .0

0 .9

Voltage (V)

0 .8

0 .7

0 .6

0 .5

0 .4

0 .3

0 .2

0 .1

0 .0 0

10

20

30

40

50

60

70

80

Time (ns)

Fig.4: Wavefform for dominno logic



hiigh output levvel unless therre is a strong ppull-down paath between thhe output andd the ground. It can be obbserved that the weak PM MOS transistoor will be tuurned on only when the preecharge node voltage is keept high. Otheerwise it will be turned offf as output vooltage becomees high.

Removval Of Charrge Sharingg Problem Using W Weak PMOS S Logic One sim mple solution to remove charge shariing problem is just to add a a weak PMOS pull--up with a small W/L ratio) to t the dynam mic device(w CMOS sstage output, which essenntially forcess a

Fig.5: Weaker PMO OS logic

Above w we have implem mented an invverter with weeak PMOS using u tanner and a generatedd its waveforrm. As we caan see the wav veform is sharrp at both risiing

annd falling edgges and theree is no chargge sharing prroblem. efg v( clk)

1 .2

1 .1

1 .0

0 .9

V o lt a g e (V )

0 .8

0 .7

0 .6

0 .5

0 .4

0 .3

0 .2

0 .1

0 .0 0

10

20

30

40

50

60

70

80

Time (ns)

efg 1 .10

v( out )

1 .05

1 .00

V o lt a g e (V )

0 .95

0 .90

0 .85

0 .80

0 .75

0 .70

0 .65 0

10

20

30

40

50

60

70

80

Time (ns)

efg v( ni )

1 .2

1 .1

1 .0

0 .9

V o lt a g e (V )

0 .8

0 .7

0 .6

0 .5

0 .4

0 .3

0 .2

0 .1

0 .0 0

10

20

30

40

50

60

70

80

Time (ns)

F Fig.6: Wavefo orm for weakeer PMOS logic



Results and Conclusions By analyzing the above circuits on the tanner we conclude that the charge sharing problem in the dynamic circuit can be improve by adding a weak PMOS pull-up device to the dynamic CMOS stage output.

References [1] V. G. Oklobdziia and R. K. Montoye, “Designperformance trade-offs in CMOS domino logic,” in Proc. IEEE Custom Integrated Circuits Conf., May 1985, pp. 334-337. [2] J. A. Pretorius, A. S. Shubat, and C. A. T. Salama, “Charge redistribution and noise margins in domino CMOS Logic,” IEEE Trans. Circuits Syst., vol. CAS-33,pp. 786-793, Aug. 1986.

[3] P. Larsson and C. Svensson, “Noise in digital dynamic CMOS circuits,” IEEE J. Solid-State Circuits, vol. 29, pp. 655-662, June 1994. [4] G. P. S’Souzw, “Dynamic logic circuit with reduced charge leakage,” U.S. Patent 5 483 181, Jan. 1996. [5] J. J. Coyino, “Dynamic CMOS circuits with noise immunity,” U.S. Patent 5 650 733, July 1997. [6] K. Roy, S. Mukhopadhyay, H.M. Meimand, “Leakage current mechanisms and leakage reduction techniques in deep-submicrometer CMOS circuits”. In proc., IEEE, vol. 91, no. 2, 2003, pp. 305-327. [7] V. Kursun and E. G. Friedman, “Domino Logic with variable threshold voltage keeper, U.S. patent pending”.



Effect Of Climate Change On Global Surface Temperature Dr. S.C. Dubey, Department of Physics, SGS Govt. PG College Sidhi (M.P), India Mr. G.P. Dubey, Department of Physics, SGS Govt. PG College Sidhi (M.P.), India Dr. L.K. Borkar, Department of Physics, SGS Govt. PG College Sidhi (M.P.), India

ABSTRACT Present work deals the long-term climate change and their effect on continuous increasing in global surface temperature. The climate change is a long-term change in the weather patterns over periods of time that may range from decades to thousands of years. There are two well-known causes that effect the climate change. One of them is variation of solar activities and other is human made activities. The external change may involve a variation in the Sun’s output. Mechanisms proposed to explain the climate response on solar variations can be associated with variations in total solar irradiance (TSI). Internal variations in the climatic system may be caused by changes in the concentrations of atmospheric gases, mountain building, volcanic activity, and changes in surface or atmospheric albedo. In the present work, we have analysed long-term variations of various solar activities and human made activities and their impact on climate changes. Adverse impacts of climate change and challenges in near future have also been discussed. Keywords: Total solar irradiance (TSI), climate change and global surface temperature.

1. Introduction Terrestrial magnetosphere and upper atmosphere can be greatly perturbed by variations in the solar variations caused by disturbances on the Sun. The state of near-Earth space environment is governed by the Sun and is very dynamic on all spatial and temporal scales. Sunspots are huge magnetic storms that are seen as dark (cooler) areas on the Sun’s surface. The number of sunspots peaks every 11 years. During periods of maximum sunspot activity, the Sun’s magnetic field is strong. When sunspot activity is low, the Sun’s magnetic field weakens. The magnetic field of the Sun also reverses every 22 years, and the complete duration is known as 22-year sunspot cycle. There are longer cycles than the 11-year sunspot cycle known as Gleissberg cycle (88-year) with variable amplitudes. The cosmogenic radio nuclides confirm the existence of other longer periodicities (e.g. 208-year DeVries or Suess cycle, 2300-year Hallstatt cycle and others) and also the present relatively high level of solar activity, although there is some controversy [1-3]. The Milankovitch theory suggests that normal cyclical variations in three of the Earth’s orbital characteristics are probably responsible for some past climatic change. The basic idea behind this theory assumes that over time these three cyclic events vary the amount of solar radiation that is received on the Earth’s surface. The first cyclical variation, known as eccentricity, controls the shape of the Earth’s orbit around the Sun. The orbit gradually changes from being elliptical to being nearly circular and then back to elliptical in a period of about 100,000

years. Second cyclical variation results from the fact that, as the Earth rotates on its polar axis, it wobbles like a spinning top changing the orbital timing of the equinoxes and solstices. Finally, the third cyclical variation is related to the changes in the tilt (obliquity) of the Earth’s axis of rotation over a 41,000 year period. Solar ultraviolet (UV) radiation directly influence stratospheric temperatures and the dynamical response to this heating extends the solar influence both poleward and downwards to the lower stratosphere and tropopause region. Ozone is the main gas involved in radiative heating of the stratosphere. Solar-induced variations in ozone can therefore directly affect the radiative balance of the stratosphere with indirect effects on circulation. Evidence that this influence can also penetrate into the underlying troposphere is accruing from a number of different sources. One consequence of these solar perturbations is to complicate the detection of human-induced depletion of the protective ozone layer; another may be to perturb the temperature at the Earth’s surface, through connections that link the upper and lower parts of the atmosphere. The galactic cosmic rays increases the amount of C-14 in the atmospheric Co2. During the increased solar activity close to solar cycle maximum years, Earth is better shielded from the cosmic rays than during the minimum years, and the amount of C-14 decreases. Thus the C-14 content of, for example, annual rings of old trees may reveal something about the Sun’s performance during the last few millennia. Some studies have indicated that there is a connection between long term climate change and Sun’s activity [4,5].



The total solar irradiance (TSI) is integrated solar energy flux over the entire spectrum which arrives at the top of the atmosphere at the mean Sun-Earth distance. The TSI observations show variations ranging from a few days up to the 11-year sunspot cycle and longer timescales [6]. TSI has been monitored from 1978 by several satellites, e.g. Nimbus 7, Solar Maximum Mission (SMM), the NASA, Earth Radiation Budget Satellite (ERBS), NOAA9, NOAA 10, Eureca and the UARS (Upper Atmospheric Research Satellite) etc. The historical reconstruction of more recently accepted TSI SSN

TSI [W/m^2]

Linear (TSI [W/m^2])

1362

200

1361

100

1360

0

1359 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010

Sunspot Number (SSN)

300

absolute value is described by Kopp and Lean [7] based on new calibration and diagnostic measurements by using TIM V.12 data on 19th January 2012, and is updated annually. TSI are known to be linked to Earth climate and temperature. The historical reconstruction of TSI and their association with 11-year sunspot cycle from 1700 onwards are shown in Fig 1. From the plot, it is find that TSI variation trend follows with sunspot number within a limit but centurial variation trends of TSI have not shown clear association. Linear variation of TSI for last 311 years shows continuously increasing trend.

Years Fig. 1 Shows the long-term variation of TSI and yearly mean SSN, during 1700 onwards. [The data of TSI were taken from SOURCE website (http://lasp.colorado.edu/sorce/index.htm)]

3. Greenhouse gases and atmospheric carbon dioxide (Co2) variations Many chemical compounds found in the Earth’s atmosphere act as “greenhouse gases.” These gases allow sunlight to enter the atmosphere freely. When sunlight strikes the Earth’s surface, some of it is reflected back towards space as infrared radiation (heat). Greenhouse gases absorb this infrared radiation and trap the heat in the atmosphere. Over time, the amount of energy sent from the Sun to the Earth’s surface should be about the same as the amount of energy radiated back into space, leaving the temperature of the Earth’s surface roughly constant. The primary greenhouse gases in the Earth’s atmosphere are water vapour, carbon dioxide (Co2), methane, nitrous oxide, ozone and helocarbons. Aside from purely humanproduced synthetic halocarbons, most greenhouse gases have both natural and human-caused sources.

During the pre-industrial Holocene, concentrations of existing gases were roughly constant. In the industrial era, human activities have added greenhouse gases to the atmosphere, mainly through the burning of fossil fuels and clearing of forests. However, since the beginning of the industrial revolution (1750’s), the burning of fossil fuels has contributed to the increase in Co2 in the atmosphere from 280 ppm to 394.29 ppm. Increase of main greenhouse gases from pre-industrial level to current level along with radiative forcing are shown in table 1. Human activity since the industrial revolution has increased the amount of greenhouse gases in the atmosphere, leading to increased radiative forcing from Co2, methane, tropospheric ozone, CFCs and nitrous oxide. The concentrations of Co2 and methane have increased by 36% and 148% respectively since 1750.


Total Solar Irradiance (TSI)

2. Long-term total solar irradiance (TSI) variations


Table 1: Represent increase of main greenhouse gases from pre-industrial level to current level. S.No. 01 02 03 04

Main Greenhouse Gases Co2 Methane Nitrous oxide Clorofluoro-carbons 12)

(CFC-

Pre-industrial level 280 ppm 700 ppb 270 ppb 0 ppt

Atmospheric Co2 is an important kind of greenhouse gas which influences global surface temperature. Its concentration variation could indicate the distribution of human and natural activities in various regions. The amount of Co2 that can be held in oceans is a function of temperature. Co2 is released from the oceans when global temperatures become warmer and diffuses into the ocean when temperatures are cooler. Initial changes in global temperature were triggered by changes in received solar radiation by the Earth through the Milankovitch cycles. The increase in Co2 then amplified the global warming by enhancing the greenhouse effect. The long-term climate change represents a connection between the concentrations of Co2 in the atmosphere and means global temperature. Certain atmospheric gases, like Co2, water vapor and methane, are able to alter the energy balance of the Earth by being able to absorb long wave radiation emitted from the Earth’s

Current level 394.29 ppm 1745 ppb 314 ppb 533 ppt

Increase since 1750 114.29 ppm 1045 ppb 44 ppb 533 ppt

Radiative forcing 1.46 0.48 0.15 0.17

surface. Without the greenhouse effect, the average global temperature of the Earth would be a cold 18° Celsius rather than the present 15° Celsius. The world’s most current data available for the atmospheric Co2 is from measurements at the Mauna Loa Observatory in Hawaii. Monthly mean Co2 concentrations are determined from daily averages for the number of Co2 molecules in every one million molecules of dried air and without considering the water vapor in air. Annual mean Co2 concentrations are the arithmetic mean of the monthly averages for the year. The estimated uncertainty in the Mauna Loa annual mean growth rate is 0.11 ppm/yr. The variation of Atmospheric Co2 (in ppm) during 1958 onwards are plotted in Fig 2. From the plot, it is find that that the rate of concentration of atmospheric Co2 are increasing continuously during above mentioned periods. These increases can reach more than 550 ppmv before the end of the 21st century.

Atmospheric Co2

375

350

325

300 1958 1960 1962 1964 1966 1968 1970 1972 1974 1976 1978 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 2006 2008 2010 2012

Parts per millian (ppm)

400

Years Fig. 2

Shows the variation of Co2 concentration during 1958 onwards.



Global warming is the rise in the average temperature of Earth’s atmosphere and oceans since the late 19th century and its projected continuation. Since the early 20th century, Earth’s mean surface temperature has increased by about 0.8 °C (1.4 °F). The ranges of these estimates arise from the use of models with differing sensitivity to greenhouse gas concentrations. The variation of atmospheric Co2 and global surface temperature (GSTemp) during 1958 onwards are shown in Fig 3. From the plot, it is observed that the Co2 and global surface temperature both are increasing continuously during above mentioned periods. A rise in Earth’s temperatures may boost the occurrence and concentration of severe climate events, such as floods, famines, heat waves, tornados, and twisters. Other consequences may comprise of higher or lower agricultural outputs, glacier melting, lesser summer stream flows, genus extinctions and rise in the ranges of disease vectors. As an effect of increase in global surface temperature species like golden toad, harlequin frog of Costa Rica has already become extinct. There are number of species that have a threat of disappearing soon and various new diseases have Co2

GSTemp

emerged lately. The increase in global surface temperature is extending the distribution of mosquitoes due to the increase in humidity levels and their frequent growth in warmer atmosphere. Various diseases due to ebola, hanta and machupo virus are expected due to warmer climates. The effect of increase in global surface temperature will definitely be seen on some species in the water. A survey was made in which the marine life reacted significantly to the changes in water temperatures. It is expected that many species will die off or become extinct due to the increase in the temperatures of the water, whereas various other species, which prefer warmer waters, will increase tremendously. The increase in global surface temperature is expected to cause irreversible changes in the ecosystem and the behavior of animals. Based on the study on past climate shifts and computer simulations, many climate scientists say that lacking of big curbs in greenhouse gas discharges, the 21st century might see temperatures rise of about 3 to 8º C, climate patterns piercingly shift, ice sheets contract and seas rise several feet. The IPCC [8] suggests that if sea level rise could convert as much as 33% of the world’s coastal wetlands to open water by 2080.

Linear (Co2)

Linear (GSTemp)

75

450

50

Atmospheric Co2

500

25

350

0

300

-25 1958 1960 1962 1964 1966 1968 1970 1972 1974 1976 1978 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 2006 2008 2010 2012

400

Giobal Surface Temperature

4. Long-term variation of global surface temperature

Years Fig. 3 Shows the variation of Atmospheric Co2 (in ppm) and global surface temperature (GSTemp) during 1958 onwards.

References [1] Muscheler, R., F. Joos, J. Beer, S.A. Muller, M. Vonmoos and I. Snowball, Solar activity during the last 1000 yr inferred from radionuclide records, Quat. Sci. Rev., 26 (2007) 82-97. [2] Usoskin, I.G., S.K. Solanki and M. Korte, Astron. Astrophys., 413 (2004) 745-751.

[3] Steinhilber, F., Abreu, J. A., & Beer, J., Solar modulation during the Holocene, Astrophys. Space Sci. Trans., 4 (2008) 1–6. [4] Friis-Christensen, E. and K. Lassen, Science, 254 (1991) 698-700. [5] Lassen, K. and Friis-Christensen, E., J. Atmos. Terr. Phys., 57 (1995) 835-845.



[6] Lockwood, M. and C. Fröhlich, Recent oppositely-directed trends in solar climate forcing and the global mean surface air temperature: II. Different reconstructions of the Total Solar Irradiance variation and dependence on response timescale, Proc. Roy. Soc., Lond. (2008). [7] Kopp, G. and Lean, J.L., A New, Lower Value of Total Solar Irradiance: Evidence and Climate Significance, Geophys. Res. Letters, Vol. 38 (2011) L01706.

[8] IPCC: 2007, Climate Change 2007, The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change eds: Solomon, S., D. Qin, M. Manning, Z. Chen, M. Marquis, K.B. Averyt, M. Tignor and H.L. Miller, Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, (2007) 663-745.



Solar Pow wered Generatoor Free Electricity Amrit Paal Singh, Chaairperson. Jyotti Welfare Fouundation, Patiiala, Punjab, In ndia

ABSTR RACT The givenn paper deals with design of Parabolic dish d heat collector which inccreases the eff fficiency of sollar heating ssystem.The optical efficiency cy of parabolicc dishes is connsiderably hig gher than that of through, LFR L or power tow wer systems because b the miirror is alwayys pointed direectly at the sunn, whereas thee through, LF FR and power tow wer have a reeduction in proojected area due d to a frequeent low angle of incidence of o the solar raadiation. Keywordds: Parabolic dish d heat colleector (PDHC)), solar, Heat losses, Efficieency.

Introducction In todayy's climate off growing eneergy needs and a increasinng environmen ntal concern, alternatives to the use oof non-renewaable and polluuting fossil fuels have to be investigatted. One such alternative is solar eneergy. Enoughh amount off solar heart is availablee, we can use this t energy to heat water orr to generate Electricity. Here H what wee do we colleect solar heaat by parabolicc dish at a singgle point and we w amplify hheat by CO2 lazer then we w have enouugh heat to ruun an Sterling g Engine then we convert heeat energy innto mechaniccal energy w with the help of coupling with dynamo o we can gennerate electriccity from solaar energy.

Methodology M A solar ray from fr sun whiich is time ddependent vaaries from 45degree to 90 degree. This solar ray strrikes the refleector which inn turn reflectss it to the RFPC (as show wn in fig). All A the rays from fr 0900 hoours to1800 hours h will strike the Parabbolic dish. Thhis ray will transfer t throuugh glass into the CO2 laazer. This willl increase heatt and send it to t sterling enngine head or o give start to the sterlinng engine w which is coup pled with dyynamo. Dynam mo starts geenerate Electriicity. W Which can be directly d use orr can store in battries. b

Block Diiagram

Paraboliic Dish The dimeensions of a symmetrical paraboloidal diish are relateed by the equaation: where is the focaal length, is the depthh of the diish (measureed along the axis of symm metry from the t vertex too the plane of the rim), andd is the radiius of the rim m. Of course, they must alll be in the sam me units. If two of thesee three quantiities are know wn, this equaation can be ussed to calculatte the third. A more complex calcculation is neeeded to find the t diameter of the dish measured aloong its surfacce. This is soometimes callled the "linearr diameter", and a equals thhe diameter of a flat, ciircular sheet of material, usually metall, which is thee right size to be cut and bbent to makee the dish. Tw wo intermediaate

reesults are usefful in the calcuulation:

(or the

eqquivalent: and w where and are defined as above. a The diameter of thhe dish, measuured along thee surface, is thhen given byy: wheere meaans thhe natural logaarithm of , i..e. its logarithhm to base "ee". Thhe volume off the dish, th he amount off liquid it coould hold if th he rim were hoorizontal and the t vertex att the botto om (e.g. the t capacityy of a paaraboloidal wook), is given by b w where the syymbols are defined as above. This can be coompared withh the formulaae for the voolumes of

www.bo orjournals.co om Blue Oceean Research h Journals 25


a cylindeer where course,

a hemisphere and a conee Of is the apperture area of o the dish, the t

The parrabolic reflector functionss due to the geometric prroperties of the t paraboloiidal shape: any incom ming ray that is parallel to t the axis of the t dish will be b reflected to oa central point, or "focuus". (For a geoometrical proof, click heree.) Because many m types off energy can be reflected in this way,, parabolic reeflectors can be used to ccollect and concentrate energy entering the t reflector at a particu ular angle. Siimilarly, enerrgy radiating from the focus to thee dish can be transmittted outward in n a beam that is parallel to the t axis of thhe dish. In contraast with spherrical reflectorrs, which sufffer from a sppherical aberrration that beecomes strongger as the rratio of the beam b diameter to the foccal distance bbecomes largeer, parabolic reflectors r can be made too accommod date beams of any wid dth. Howeverr, if the incom ming beam maakes a non-zeero angle witth the axis (or if the emittiing point sourrce is not placed p in the focus), paraabolic reflectoors

arrea enclosed by b the rim, which w is propoortional to thhe amount of o sunlight thhe reflector dish can inntercept.

sufffer from an aberration a called coma. This is prim marily of innterest in teelescopes becaause most oth her applicationns do not reequire sharp reesolution off the t axis of the parabola. CO2 Lazer A the active medium, As m thesse lasers use a suitable m mixture Of CO O2, N2, and He. Oscillattion takes pllace between n two vibraational levelss of the CO2 molecule, while N2 and He greatlyy improve thhe efficiency of laser action. The CO O2 laser is acctually one of the most powerful p laserrs (output poowers of more m than 100 1 kW haave been deemonstrated from f a CO2 gas-dynamic g l laser) and onne of the mostt efficient (15-20% slope effficiency). N Nitrogen helps producing a large populattion in the uppper laser leevel while heelium helps removing poopulation from m the lower laaser level.



Fig:1 Figure (1) shows thee relevant vibbrational enerrgy levels foor the electrronic groundd states of the t CO2 and N2 molecules. The N2 molecule, m beiing diatomic, has only onee vibrational mode; m its lowest two energgy levels (v= 0, v = 1) are indicated in the t figure. Energy levvels for CO C 2 are moore complicaated, since CO2 is a liinear triatom mic moleculee. In this case, there are thrree nondegennerate modess of vibration: Symmettric stretchingg, bending, annd asymmetricc stretching. The rem maining energ gy between thhe intermediaate states annd the groundd state is lost through kineetic energy trransfer, whicch generates heat instead of light. Forr CO2 molecuules, the rate of o energy releaase through heat is muchh lower than energy releaase t energy efficiency for f through light, so the w producinng a laser beeam is high compared with other lasiing materials. In comparisoon, helium has a very higgh thermal diffusivity; theerefore, with its addition to the lasin ng gas mixtuure, the rate of energy reelease througgh heating is extremely hig gh. This com mbination of lasing l interacttions makes the t carbon dioxide laseer suitable for industrrial applicatioons in terms of o both the ennergy efficien ncy (up to 110%) and thee high outpuut beam poweers achievable. The threee main typpes of gas flow f are sealled dischargee tube, axxialflow, andd traverse or crossflow w. The flow method m determ mines how fast f the post--stimulation carbon dioxiide gas can be removed from the optiical cavity so that t new grouund state carrbon dioxide gas can be introduced for f excitationn and stimulattion. 1. The sealed s discha arge laser coontains a fix xed lasing gas g mixture sealed in thhe laser caviity; thereforee, it does not require a gas supply or gas g handling system. How wever, becausee there is no gas g flow, ouutput powers are limited to t about 50 W (since uused CO2 cannot c be discharged d and a replenishhed with new CO2), and thee lifetime of the t

laaser is limited d by the disasssociation of thhe carbon diioxide into oxyygen and carbbon monoxidee. 2.. The second type Of CO O2 laser is the axialflow laaser. This is the t most widdely used typee of CO2 laaser, in whichh the gas flow ws along the axis a of the opptical cavity (Fig.2) Axxial flow alllows the deepleted gas to be replaced by b new gas. Laaser beam poowers of up to t 4 kW of continuous waave output caan be achieveed. Laser beam ms with pure Gaussian inntensity profilees can be gennerated for pow wer levels upp to about one o kW, whiile beams wiith power abbove one kW generally havve a mixed moode output coontaining two or mom diffe ferent intensityy profiles. Siince the used gas is either exhausted im mmediately orr is reused aft fter removing any contaminnants, this syystem requiress a constant supply of gas and a gas haandling system m. Axial flow w lasers can be b further cllassified by th he speed of gas flow, nam mely lowsppeed flow and d high-speed flow f lasers. Low-speed L floow lasers attaain power outtputs of aboutt 50 W to 700 W for each meter m of cavitty length. To produce a coompact packaage, the opticcal cavity is folded so thhat longer disccharge lengthhs can be obtaained in a sm maller assemb bly. The low flow speed causes c the laaser to heat upp considerablyy, and the relattively low coonductivity off the gas mixtture limits the bore size off the lasing tuube. Heating of the resonaator cavity caauses distortioons in the reesonator opticcs due to thhermal expannsion; these distortions affect a the beeam intensitty profile and beam stability. H However, withh external coooling for the resonator annd optics, beaam outputs with w good adjjustability annd stability can c be generated. Mgh-sppeed flow m models typicallly have a gaas velocity off 60 nVs. Thhus, the carbon dioxide molecule m only has time foor one excitattion/stimulatioon cycle before exiting thhe optical cavvity. Typical outputs o are 6000 W per m meter of caviity length, with w total lasser beam ouutputs availaable up to 6 kW. Duee to the coonvective coo oling of the high-speed flow, the



thermal distortions in the resonaator optics are a minimizeed and larger bore b diameterrs can be used d to

nsity profiless which arre nearly prroduce inten G Gaussian in shaape.

Fig:2 Sterling Engine The Alphha Stirling en ngine consistss of two pow wer pistons, each with a separate cylinder and a connectinng rod. One power pistoon and cylindder representts hot worrkspace, thee other coold workspacce. The connnecting rods join j a comm mon journal on a singlee flywheel/crrankshaft. Thhis .

arrrangement iss shown in Figure 1. As the t figure deepicts, the hott and cold worrkspaces are physically p seeparated from m each other. This featuree provides exxcellent therm mal isolation for fo the two woorkspaces. Thhe conduit that joins the t two woorkspaces, hoowever, adds to the dead space associiated with thhis design

The Alphha then, in itss simplest forrm, utilizes fo our reciprocaating parts and a one rottary part. Thhis

coonfiguration reequires a closse tolerance fiit between eaach power pisston and its reespective cylinnder. This



is not ann issue for those t components operatiing within thhe cold work kspace. The hot workspaace piston annd cylinder do d represent a problem with w regard to t maintaininng a reliablle seal in an environm ment with higgh heat couplled with slidiing friction. Seals on this piston p can be subject to earrly

faailure due to these operating conditions. Teechniques thaat alleviate piston p seal faiilure may allso increase engine dead space. The Alpha is knnown for its high h power-to--volume ratio..

D System Design

REFER RENCES [1] John n Dan niel Kraus American physicist p know wn for his h contrributions to electrom magnetics, raddio astroonomy, and anntenna theory.. [2] Robeert Stirling , T. Finkelsteeinl; A.J. Org gan (20001) [3] Finkkelstein, T. Generalized G T Thermodynam mic Anallysis of Stirrling Enginess. Paper 1188B, Sociiety of Automotive Engineeers, 1960.

[44] Patel, C. K. N. (19644). "Continuoous-Wave Laser Action on Vibrational-R Rotational Transitionss of CO2". Physical Review 1366 (5A): A1187– A1193. Bibbcode:1964Ph hRv..136.11877P. doi:10 .1103/PhyssRev.136.A11187 [55] CO2-laser micromachhining and back-end processing for rapid production p off PMMAbased miccrofluidic systems". Retrrieved 21 October 20009.



Data Leakage Detection Sachin A. Bansode, Computer Department, Sinhgad Institute of Technology, Lonavala, India Uday M. Jadhav, Computer Department, Sinhgad Institute of Technology, Lonavala, India Prof. N. K. Patil, Computer Department, Sinhgad Institute of Technology, Lonavala, India

ABSTRACT We study the following problem: A data distributor has given sensitive data to a set of supposedly trusted agents (third parties). Some of the data are leaked and found in an unauthorized place (e.g., on the web or somebody’s laptop). The distributor must assess the likelihood that the leaked data came from one or more agents, as opposed to having been dependently gathered by other means. We propose data allocation strategies (across the agents) that improve the probability of identifying leakages. These methods do not rely on alterations of the released data (e.g., watermarks). In some cases, we can also inject “realistic but fake” data records to further improve our chances of detecting leakage and identifying the guilty party. Keywords:Allocation strategies, data leakage, data privacy, fake records, leakage model.

1. Introduction In the course of doing business, sometimes sensitive data must be handed over to supposedly trusted third parties. For example, a hospital may give patient records to researchers who will devise new treatments. Similarly, a company may have partnerships with other companies that require sharing customer data. Another enterprise may outsource its data processing, so data must be given to various other companies. We call the owner of the data the distributor and the supposedly trusted third parties the agents. Our goal is to detect when the distributor’s sensitive data have been leaked by agents, and if possible to identify the agent that leaked the data. We consider applications where the original sensitive data cannot be perturbed. Perturbation is a very useful technique where the data are modified and made “less sensitive” before being handed to agents. For example, one can add random noise to certain attributes, or one can replace exact values by ranges. However, in some cases, it is important not to alter the original distributor’s data. For example, if an outsourcer is doing our payroll, he must have the exact salary and customer bank account numbers. If medical researchers will be treating patients (as opposed to simply computing statistics), they may need accurate data for the patients. Traditionally, leakage detection is handled by Watermarking, e.g., a unique code is embedded in each distributed copy. If that copy is later discovered in the hands of an unauthorized party, the leaker can be identified. Watermarks can be very useful in some cases, but again, involve some modification of the original data. Furthermore, watermarks can sometimes be destroyed if the data recipient is malicious. In this paper, we study unobtrusive techniques for detecting leakage of a

set of objects or records. Specifically, we study the following scenario: After giving a set of objects to agents, the distributor discovers some of those same objects in an unauthorized place. (For example, the data may be found on a website, or may be obtained through a legal discovery process.) At this point, the distributor can assess the likelihood that the leaked data came from one or more agents, as opposed to having been independently gathered by other means. Using an analogy with cookies stolen from a cookie jar, if we catch Freddie with a single cookie, he can argue that a friend gave him the cookie. But if we catch Freddie with five cookies, it will be much harder for him to argue that his hands were not in the cookie jar. If the distributor sees “enough evidence” that an agent leaked data, he may stop doing business with him, or may initiate legal proceedings. In this paper, we develop a model for assessing the “guilt” of agents.We also present algorithms for distributing objects to agents, in a way that improves our chances of identifying a leaker. Finally, we also consider the option of adding “fake” objects to the distributed set. Such objects do not correspond to real entities but appear realistic to the agents. In a sense, the fake objects act as a type of watermark for the entire set, without modifying any individual members. If it turns out that an agent was given one or more fake objects that were leaked, then the distributor can be more confident that agent was guilty. We start by introducing our problem setup and the notation we use. We present a model for calculating “guilt” probabilities in cases of data leakage. Then, we present strategies for data allocation to agents. Finally, we evaluate the strategies in different data leakage scenarios, and check whether they indeed help us to identify a leaker.



2.

Existing System Traditionally, leakage detection is handled by watermarking, e.g., a unique code is embedded in each distributed copy. If that copy is later discovered in the hands of an unauthorized party, the leaker can be identified. Watermarks can be very useful in some cases, but again, involve some modification of the original data. Furthermore, watermarks can sometimes be destroyed if the data recipient is malicious. E.g. A hospital may give patient records to researchers who will devise new treatments. Similarly, a company may have partnerships with other companies that require sharing customer data. Another enterprise may outsource its data processing, so data must be given to various other companies. We call the owner of the data the distributor and the supposedly trusted third parties the agents. 2.1. Digital Watermark Digital watermarking is a technology for embedding various types of information in digital content. In general, information for protecting copyrights and proving the validity of data is embedded as a watermark. A digital watermark is a digital signal or pattern inserted into digital content. The digital content could be a still image, an audio clip, a video clip, a text document, or some form of digital data that the creator or owner would like to protect. The main purpose of the watermark is to identify who the owner of the digital data is, but it can also identify the intended recipient. Why do we need to embed such information in digital content using digital watermark technology? The Internet boom is one of the reasons. It has become easy to connect to the Internet from home computers and obtain or provide various information using the World Wide Web (WWW). All the information handled on the Internet is provided as digital content. Such digital content can be easily copied in a way that makes the new file indistinguishable from the original. Then the content can be reproduced in large quantities. For example, if paper bank notes or stock certificates could be easily copied and used, trust in their authenticity would greatly be reduced, resulting in a big loss. To prevent this, currencies and stock certificates contain watermarks. These watermarks are one of the methods for preventing counterfeit and illegal use. Digital watermarks apply a similar method to digital content. Watermarked content can prove its origin, thereby protecting copyright. A watermark also discourages piracy by silently and psychologically deterring criminals from making illegal copies.

3. Proposed System This paper we are going to implement by using fake object addition technique and our goal is to detect when the distributor’s sensitive data has been leaked by agents, and if possible to identify the agent that leaked the data. Perturbation is a very useful technique where the data is modified and made less sensitive before being handed to agents. In this section we develop a model for assessing the guilt of agents. We also present algorithms for distributing objects to agents, in a way that improves our chances of identifying a leaker. Finally, we also consider the option of adding fake objects to the distributed set. Such objects do not correspond to real entities but appear realistic to the agents. In a sense, the fake objects acts as a type of watermark for the entire set, without modifying any individual members. If it turns out an agent was given one or more fake objects that were leaked, then the distributor can be more confident that agent was guilty.

3.1 Allocation Strategies In this section, we describe allocation strategies that solve exactly or approximately the scalar versions for the different instances presented in different forms. We resort to approximate solutions in cases where it is inefficient to solve accurately the optimization problem. In the first place, the goal of these experiments was to see whether fake objects in the distributed data sets yield significant improvement in our chances of detecting a guilty agent. In the second place, we wanted to evaluate our e-optimal algorithm relative to a random allocation. Algorithm 1: Allocation for Explicit Data Requests (EF) Step 1: Calculate total fake records as sum of fake records allowed. Step 2: While total fake objects > 0 Step 3: Select agent that will yield the greatest improvement in the sum objective i.e. i =argmax (1⁄)……………………….. Step 4: Create fake record Step 5: Add this fake record to the agent and also to fake record set. Step 6: Decrement fake record from total fake record set. Algorithm makes a greedy choice by selecting the agent that will yield the greatest improvement in the sum-objective. With sample data requests agents are not interested in particular objects. Hence, object sharing is not explicitly defined by their requests. The distributor is “forced” to allocate certain objects to multiple agents only if the number of requested objects exceeds the number of objects in set T. The more



data objeects the agents request in total, the moore recipients on average an object hass; and the moore objects arre shared amo ong different agents, a the moore difficult iit is to detect a guilty agentt. Algorith hm 2. Alloccation for Sample Da ata Requestss (SF) Step 1: IInitialize Min__overlap ← 11, the minimuum out of tthe maximum m relative ovverlaps that the t allocationns of differentt objects to Step 2: foor k {k | } do Initialize max_rel_ov ← 0, the maxiimum relative ooverlap between and any set that the allocationn of to Step 3: foor all j = 1,..., n : j = i and do Calculatee absolute oveerlap as abs_ov ← | ∩ | + 1 Calculatee relative overrlap as rel_ov ← abs_ov / minn ( , ) Step 4: F Find maximum m relative as max_rel__ov ← MAX (max_rel_ov, ( rel_ov) If max_reel_ov ≤ min_o overlap then min_overrlap ← max_rrel_ov ret_k ← k Return reet_k

3. Ageent Guilt Model M Before we present the generaal formula for f bility Pr{Gi|S} that an ageent computinng the probab Ui is guillty, we providde a simple example with seet. // distributor set T T ={t1,t22,t3} // agent set R1={t1,t22} s R1 R2={t1,t3} // agent set s R2 S={t1,t2,,t3} // Target leaked set S t and t3 leaked by S. Here all tthree objects t1,t2 Distributtor gives objeccts t1 to both U1 U nd U2.

It can be shown n that algorithhm s-max is opptimal for thhe sum-objecctive and the t max-objeective in prroblems w where M ≤ |T| and n < |T|. Itt is also optim mal for the m maxobjective iff |T| ≤ M ≤ 2 |T| or all ageents request data d of the saame size. W With sample data d requestss, each agentt Ui may reeceive any T from a subsett out of differrent ones. H Hence, there are a different allocations. In every alllocation, the distributor can c permute T objects annd keep thee same channces of guillty agent deetection. The reason is thaat the guilt probability p deepends only on o which ageents have recceived the leeaked objects and not on the identity of the t leaked obbjects. Therrefore, from m the disstributor’s peerspective th here are diffferent allocattions. An obbject allocatioon that satisfiees requests annd ignores thhe distributor’s objective iss to give each agent a unnique subset of o T of size m. m The s-max algorithm alllocates to an agent the data record that yields the m minimum incrrease of th he maximum m relative ovverlap amongg any pair of o agents. Thhe s-max allgorithm is as follows.

Means probabbility of leakking object t1 M t is get diivided in U1 and a U2. Here we have following H f casees : 1.. The target guuessed t1 withh probability p, p 2.. Agent U1 leaaked t1 to S with w probabilityy (1-p)/2, 3.. Agent U2 leaaked t1 to S with w probabilityy (1-p)/2, 4.. similaraly, agent U1 leaked l t2 too S with prrobability (11-p), 5.. and agent U22 leaked t3 too S with probaability (1p)).

www.bo orjournals.co om Blue Ocean n Research Jo ournals 32


Given this values, the probability that agent U1 is not guilty, namely that U1 and U2 did not leak either object is: Pr{~G1|S} = (1-(1-p)/2) * (1-(1-p)) //for agent U1 Pr{~G2|S} = (1-(1-p)/2) * (1-(1-p)) //for agent U2 And , the probability that agent U1 and U2 is guilty is : Pr{G1|S} = 1-Pr{~G1} //for agent U1 Pr{G2|S} = 1-Pr{~G2} //for agent U2 In general case, first we compute probability that he leaks a single object t to S. To compute this, we define set of agents Vt = {Ui|t in Ri} that have t in their data sets so that we have following : 1. Probability that some agents leaked object t to S is : Pr{Ui leaked t to S} = 1-p 2.Probability that all agents leaked objects t to S is : Pr{Ui leaked t to S} = (1-p)/|Vt|, if Ui is in Vt

4. Experimental Results We implemented the presented allocation algorithms in Python and we conducted experiments with simulated data leakage problems to evaluate their performance.

4.1 Explicit Requests We focus on scenarios with a few objects that are shared among multiple agents. These are the most interesting scenarios, since object sharing makes it difficult to distinguish a guilty from no guilty agents. Scenarios with more objects to distribute or scenarios with objects shared among fewer agents are obviously easier to handle. As far as scenarios with many objects to distribute and many overlapping agent requests are concerned, they are similar to the scenarios we study, since we can map them to the distribution of many small subsets. Incidentally, the two jumps in the e-optimal curve are due to the symmetry of our scenario. Algorithm e-optimal allocates almost one fake object per agent before allocating a second fake object to one of them. The presented experiments confirmed that fake objects can have a significant impact on our chances of detecting a guilty agent. Note also that the algorithm evaluation was on the original objective. Hence, the superior performance of eoptimal (which is optimal for the approximate objective) indicates that our approximation is effective.

With sample data requests, agents are not interested in particular objects. Hence, object sharing is not explicitly defined by their requests. The distributor is “forced” to allocate certain objects to multiple agents only if the number of requested objects mi exceeds the number of objects in set T. The more data objects the agents request in total, the more recipients, on average, an object has; and the more objects are shared among different agents, the more difficult it is to detect a guilty agent.

5. Conclusion In a perfect world, there would be no need to hand over sensitive data to agents that may unknowingly or maliciously leak it. And even if we had to hand over sensitive data, in a perfect world, we could watermark each object so that we could trace its origins with absolute certainty. However, in many cases, we must indeed work with agents that may not be 100 percent trusted, and we may not be certain if a leaked object came from an agent or from some other source, since certain data cannot admit watermarks. In spite of these difficulties, we have shown that it is possible to assess the likelihood that an agent is responsible for a leak, based on the overlap of his data with the leaked data and the data of other agents, and based on the probability that objects can be “guessed” by other means. Our model is relatively simple, but we believe that it captures the essential trade-offs. The algorithms we have presented implement a variety of data distribution strategies that can improve the distributor’s chances of identifying a leaker. We have shown that distributing objects judiciously can make a significant difference in identifying guilty agents, especially in cases where there is large overlap in the data that agents must receive. Our future work includes the investigation of agent guilt models that capture leakage scenarios that are not studied in this paper. For example, what is the appropriate model for cases where agents can collude and identify fake tuples? Another open problem is the extension of our allocation strategies so that they can handle agent requests in an online fashion (the presented strategies assume that there is a fixed set of agents with requests known in advance). 6. References [1] R. Agrawal and J. Kiernan, “Watermarking Relational Databases,” Proc. 28th Int’l Conf. Very Large Data Bases (VLDB ’02), VLDB Endowment, pp. 155-166, 2002. [2] P. Bonatti, S.D.C. di Vimercati, and P. Samarati, “An Algebra for Composing Access Control Policies,” ACM Trans. Information and System Security, vol. 5, no. 1, pp. 1-35, 2002.

4.1 Sample Requests www.borjournals.com Blue Ocean Research Journals 33


[3] P. Buneman, S. Khanna, and W.C. Tan, “Why and Where: A Characterization of Data Provenance,” Proc. Eighth Int’l Conf. Database Theory (ICDT ’01), J.V. den Bussche and V. Vianu, eds., pp. 316-330, Jan. 2001. [4] P. Buneman and W.-C. Tan, “Provenance in Databases,” Proc. ACM SIGMOD, pp. 1171-1173, 2007. [5] Y. Cui and J. Widom, “Lineage Tracing for General Data Warehouse Transformations,” The VLDB J., vol. 12, pp. 41-58, 2003. [6] S. Czerwinski, R. Fromm, and T. Hodes, “Digital Music Distribution and Audio Watermarking,” http://www.scientificcommons. org/43025658, 2007. [7] F. Guo, J. Wang, Z. Zhang, X. Ye, and D. Li, “An Improved Algorithm to Watermark Numeric Relational Data,” Information Security Applications, pp. 138-149, Springer, 2006. [8] F. Hartung and B. Girod, “Watermarking of Uncompressed and Compressed Video,” Signal Processing, vol. 66, no. 3, pp. 283-301, 1998. [9] S. Jajodia, P. Samarati, M.L. Sapino, and V.S. Subrahmanian, “Flexible Support for Multiple Access Control Policies,” ACM Trans. Database Systems, vol. 26, no. 2, pp. 214-260, 2001. [10] Y. Li, V. Swarup, and S. Jajodia, “Fingerprinting Relational Databases: Schemes and Specialties,” IEEE Trans. Dependable and Secure Computing, vol. 2, no. 1, pp. 34-45, Jan.-Mar. 2005. [11] B. Mungamuru and H. Garcia-Molina, “Privacy, Preservation and Performance: The 3 P’s of Distributed Data Management,” technical report, Stanford Univ., 2008. [12] V.N. Murty, “Counting the Integer Solutions of a Linear Equation with Unit Coefficients,” Math. Magazine, vol. 54, no. 2, pp. 79-81, 1981. [13] S.U. Nabar, B. Marthi, K. Kenthapadi, N. Mishra, and R. Motwani, “Towards Robustness in Query Auditing,” Proc. 32nd Int’l Conf. Very Large Data Bases (VLDB ’06), VLDB Endowment, pp. 151-162, 2006.

SIGMOD, pp. 98-109, 2003. [18] L. Sweeney, “Achieving K-Anonymity Privacy Protection Using Generalization and Suppression,” http://en.scientificcommons. org/43196131, 2002

[14] P. Papadimitriou and H. Garcia-Molina, “Data Leakage Detection,” technical report, Stanford Univ., 2008. [15] P.M. Pardalos and S.A. Vavasis, “Quadratic Programming with One Negative Eigenvalue Is NP-Hard,” J. Global Optimization, vol. 1, no. 1, pp. 15-22, 1991. [16] J.J.K.O. Ruanaidh, W.J. Dowling, and F.M. Boland, “Watermarking Digital Images for Copyright Protection,” IEE Proc. Vision, Signal and Image Processing, vol. 143, no. 4, pp. 250-256, 1996. [17] R. Sion, M. Atallah, and S. Prabhakar, “Rights Protection for Relational Data,” Proc. ACM



Biotransformation of a Textile AZO Dye Acid Yellow 25 by Marinobacter Gudaonensis AY-13 Shertate R.S., Research Scholar, P.G. Department of Microbiology and Research Center, Shri Shivaji Mahavidyalaya, Barshi – 413411, Dist. - Solapur, MS, India. Thorat P.R., Associate Professor, P.G. Department of Microbiology and Research Center, Shri Shivaji Mahavidyalaya, Barshi – 413411, Dist. - Solapur, MS, India.

ABSTRACT Biotransformation of Acid Yellow 25 was carried out using Marinobacter gudaonensis AY-13(Accession No. HE970768) isolated from natural marine environment. The decolorization of the azo dye Acid Yellow 25 in nutrient broth and half strength nutrient broth having 8.0% salt concentration was up to 92.00% and 90.03% respectively in 24 hours. The decolorization of the dye by cell-free extract was found to be upto 80.13 % in 24 hours. The decolorization of the dye was also studied in presence of different co-substrates viz. 1% glucose, 1% yeast extract and 1% starch and found that percent decolorization was up to 92.77%, 94.00% and 92.05% respectively. From these results it can be concluded that, the isolate could decolorize the dye very effectively. The percent COD reduction of the dye by the isolate was 70.00%. The degradation products formed were analyzed by GC-MS technique and it was found that culture degraded Acid Yellow 25 to the products having molecular weights 98, 70, 112, 125, 140, 168, 186, 128, 141, 83, 111, 154, 72 and 155. The microbial toxicity study revealed that degradation products of Acid Yellow 25 were non-toxic to ecologically important microorganisms like Pseudomonas sp., Rhizobium sp. and Azotobacter sp. Keywords – Acid Yellow 25, Biodegradation, COD Reduction, GC-MS analysis, Marine Bacteria

I.

Introduction

The Ocean, which is called the ‘Mother of origin of life’, is also the source of structurally unique natural products that are mainly accumulated in living organisms. Water is a huge resource on earth. Of all the water resources on earth, only 3% of it is not salty and two- third of fresh water exists in the form of glaciers and ice caps. Color present in the industrial effluent gives a direct indication that the water is polluted. Hence color is the first contaminant recognised in the textile effluent and it has to be removed before discharging into large bodies (Khadijah et al., 2009). Textile industries are usually located in places near to the sea, mainly for easy overseas transportation. However, the toxic effluents released by the industries causes a great challenge to the marine life. In a year, about 280,000 tonnes of textile dyes are let out into the environment worldwide most of which end up into the marine environment. The textile dyes profoundly disturbs the marine ecosystem, as they undergo chemical and biological changes. Their breakdown products might also be toxic to some aquatic organisms. Biodegradation causes mineralization of dyes to simpler inorganic compounds which are not lethal to life forms (Tripathi and Shrivastava, 2011). The basic step in the decolorization and degradation of azo dyes is breakdown of azo bonds,

leading to removal of color and toxicity of the dye. The dye wastewaters can be treated by physicochemical methods, biological and microbiological methods. The major disadvantage of physicochemical methods has been largely due to the high cost, low efficiency, limited versatility, interference by other wastewater constituents (Van der Zee and Villaverde, 2005; Kaushik and Malik, 2009). Traditional wastewater treatment technologies have proven to be markedly ineffective for handling wastewater of synthetic textile dyes because of the chemical stability of these pollutants (Forgacs et al., 2004). Also these techniques generate a huge volume of sludge and cause secondary pollution due to the formation of sludge and hazardous by-products (Mohandass et al., 2007). The use of microorganisms for the removal of synthetic dyes from industrial effluents offers considerable advantages; the process is relatively inexpensive, the running costs are low, and the end products of complete mineralization are not (Forgacs et al., 2004) Thus, biodegradation is a promising approach for the remediation of synthetic dyes wastewater because of its cost effectiveness, efficiency, and environmentally friendly nature (Jirasripongpun et al., 2007; Shedbalkar et al., 2008; Gopinath et al., 2009). As a best alternative, much interest is now focused on biodegradation of dyes (Mcmullan et al., 2001; An et al., 2002). This study deals with biological decolorization and biodegradation of a



textile azo dye Acid Yellow 25 by Marinobacter gudaonensis AY-13.

marine water and compost were collected as the source of microorganisms; these soil samples were kept in a container and refrigerated till use. Textile Dye – Acid Yellow-25 (λmax-392nm). Analytical Grade dye purchased from SigmaAldrich (USA).

II. Materials and Methods – Materials

Soil samples from salterns (Saltpan), areas nearby waste disposal sites of the textile industry, sewage, sludge from effluent treatment plants (ETP), Table 1: Properties of the dye Dye Name - Acid Yellow 25. (CI No. 18835) λmax 392nm Structure O

NH

S

OH N

O

N N H3C

N

SO3Na Properties Molecular Formula Formula Weight Composition

= C22H24N5NaO6S2 = 541.575629 = C(48.79%) H(4.47%) N(12.93%) Na(4.24%) O(17.73%) S(11.84%)

a. Acclimatization and isolation of microorganisms For the isolation of microorganisms capable of decolorizing the dye soil was used as a source of microorganisms. The soil samples were subjected to enrichment using nutrient broth amended with increasing concentrations of NaCl (0.5%-20.0%) and of dye (10µg ml-1 to 1500µg ml-1) with incubation time of 24 h at 37°C. Repeated transfers were carried out to isolate stable dye decolorizing strain and the isolated strain was stored at 5°C for further use. The high decolorizing bacteria were screened by performing a decolorization assay with the dye using UV- VIS spectrophotometer (Systronics-106 model) at its respective λ max 392nm and designated isolate AY-13 and used for further studies. b. Determination of biodegradation activity The isolate AY-13 was inoculated in nutrient medium containing dye Acid Yellow 25 (Table 1) at a concentration 1500µg ml-1 and incubated at 37oC. An aliquot of 5 ml was removed after different time intervals and centrifuged at 10,000 rpm for 20 min to remove the cell mass. The supernatant was then used to investigate the decolorization of the dye by observing the change in the absorbance at maximum absorption wavelength (λmax) 392 nm on spectrophotometer.

i. Percent Decolorization in Nutrient Broth, Half (½) Strength Nutrient Broth Isolate AY-13 was used to inoculate in 20 ml nutrient broth (peptone – 1.0g, NaCl – 0.5g, Beef Extract – 0.3g, Distilled Water – 100.0ml) containing 8.0% NaCl and 1500µg/ml concentration of dye. These tubes were then incubated at ambient temperature for 24 hrs and observed for decolorization of the dye. In addition, half strength nutrient broth (peptone – 0.5g, NaCl – 0.25g, Beef Extract – 0.15g, Distilled Water – 100.0ml) was also used to test for the ability of isolate AY-13 to decolorize the dye Acid Yellow 25 with same NaCl and dye concentration. ii. Percent Decolorization in presence of different Co-substrates The isolate was supplemented with different carbon source and nitrogen sources viz. 1% Glucose, 1%Yeast Extract and 1%Starch. The effects of these sources on the decolorization were then observed. iii. Percent Decolorization in Cell Free Extract The biomass of isolate AY-13, grown in nutrient broth containing 8.0% NaCl were separated by centrifugation using cooling centrifuge (BIOLABS 165-R) at 8000 rpm for 20 min at 40C. The pellet was then suspended in 50mM phosphate buffer pH – 7.2. The cell suspension in the buffer was properly cooled and lysed by using



Ultrasonicator (Sonic-Vibra Cell System – 130) the output was kept 50amp with 6 strokes of 25 s each, time interval kept was 2min at 40C. This homogenate was centrifuged at 10,000 rpm for 10 min so as to separate the cell debris from the intracellular enzymes. The supernatant was used as a crude intracellular enzyme source. The

supernatant containing the crude enzyme was then added with 1500µg/ml concentration of dye solution and observed for dye decolorization. The percent decolorization studies were monitored by using spectrophotometer. The percent decolorization of the dye by the isolate was determined by following formula,

A0 - At Decolorization (%) = -------------------------A0

X 100

Where, A0 = Absorbance of the blank (dye solution). At = Absorbance of the treated dyes solution. c. Percent COD reduction Studies Percent COD reduction value of the dye decolorized in nutrient broth by isolate AY-13 was calculated by COD analysis using K2Cr2O7 as a strong oxidizing agent under reflux conditions. d. GCMS Analysis Degradation of the dye Acid Yellow 25 by the isolate AY-13 was confirmed by GC-MS analysis. The samples for GCMS were prepared by extracting the degraded products in Di-Chloro Methane (DCM). The decolorized broth was centrifuged at 10,000 rpm for 20 min. The supernatant was taken in a separating funnel and equal amount of DCM was added to and allowed to separate solvent and aqueous phase. The funnel was shaken vigorously for 20 min to extract the products in DCM. The products that are extracted in the solvent phase were concentrated in the vial by evaporation of the solvent at room temperature. This was then analyzed by Gas chromatography and Mass spectroscopy (GC-MS). The GC-MS analysis of metabolites was carried out using a Shimadzu 2010 MS Engine, equipped with integrated gas chromatograph with HP1 column (60 m long, 0.25 mm id, non-polar). Helium was used as carrier gas at a flow rate of 1 ml min−1. The injector temperature was maintained at 2800C with oven conditions as: 800C kept constant for 2 min and increased up to 2000C with 100C min-1 raised up to 2800C with 200C min−1 rate. e. Identification of the isolate PCR Amplification and sequencing of 16S rRNA gene – The 16S rRNA was determined in National Center for Cell Sciences, University of Pune Campus, Pune. Genomic DNA isolation of isolate was carried using Qiagen DNA isolation kit as per manufacturer’s instruction. Its presence was checked by running in agarose gel (0.8%) stained with ethidium bromide.

PCR amplification of 16S rDNA from all the strains was performed using 16S rDNA specific universal oligonucleotide primers 16F27N (5’AGA GTT TGA TCM TGG CTC AG-3’) and 16R1488 (5’-CGG TTA CCT TGT TAC GAC TTC ACC-3’) hybridizing respectively at positions 8–27 and 1488–1511 relative to E. coli 16S rDNA numbering (Grifoni et al., 1995). The PCR reactions were carried out in PE 9700 thermal cycler (Perkin Elmer, USA). The amplification conditions were: an initial denaturation at 94°C for two minutes, followed by 35 cycles of denaturation at 94°C for one minute, annealing at 55°C for one minute and extension at 72°C for one minute and final extension at 72°C for 10 minutes13. PCR was carried out in 25 µl reaction mixture consisted of 10 x Taq polymerase buffer Bangalore Genei, Bangalore, India), 2mM dNTPs, 10pM primers, 1 unit Taq polymerase (Bangalore Genei, Bangalore, India), and 10ng DNA. The PCR amplification products were checked on 1% (wt/vol) agarose gels. The PCR product was purified by PEG-NaCl precipitation14. Briefly, the PCR product was mixed with 0.6 volumes of PEG-NaCl solution (20% PEG 6000, 2.5 M NaCl) and incubated for 10 min at 370C. The precipitate was collected by centrifugation at 12,000 rpm for 10 min. The pellet was washed twice with 70% ethanol and dried under vacuum, which was then resuspended in glass distilled water at a concentration of >0.1 pmol/ ml. Purified products were sequenced on both strands on an AB 3730 DNA analyzer using the Big Dye terminator kit (Applied Biosystems, Inc. Foster City, CA). Internal primers used were 16S-704F- 5’GTAGCGGTGAAATGCGTAGA3’; 16S-907R-5’ CCGTCAATTCMTTTGAGTTT3’; 16S-355F-5’ GGCGGACGGGTGAGTAAT3. The sequence was deposited to European Bioinformatics Institute (EBI). Sequence was analyzed at the Ribosomal Database Project (RDP-II) (http://rdp.cme.msu.edu/) for



lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al., 2004) and were in the units of the number of base substitutions per site. Phylogenetic analyses were conducted in MEGA4 (Tamura et al., 2004).

closed homology. The sequences downloaded from the RDP II database were aligned by using CLUSTAL X2 multiple sequence alignment tools. The Phylogenetic tree was constructed by the neighbor joining method using Kimura-2parameter distances in MEGA 4.0 (Tamura et al., 2007). f. Phylogenetic analysis and sequence alignment Initially the 16S rRNA gene sequence was analyzed at NCBI server (http://www.ncbi.nlm.nih.gov) using BLAST (blastn) tool and corresponding sequences of homologous species were downloaded and used for phylogenetic analysis. The evolutionary history was inferred using neighbor joining method (Saitou and Nei, 1987). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) was shown next to the branches (Felsenstein, 1985).The phylogenetic tree was linearized assuming equal evolutionary rates in all lineages. The clock calibration to convert distance to time was 0.01 (time/node height). The tree was drawn to scale, with branch 99 50

III.

EU496088 Marinobacter santorin DQ325514 Marinobacter koreensi

56

EU047505 Marinobacter lacisals

59 67

Results

a. Screening and Identification of the isolate – One isolate was selected and designated as AY-13 showing the zone of decolorization on nutrient agar containing 8.0% NaCl and 1500µg/ml dye. The isolate was gram negative, highly motile rod. Colonies on nutrient agar containing 8.0% NaCl and dye were transparent and circular in shape. On the basis of biochemical tests and 16S rRNA analysis, the isolate was identified as Marinobacter gudaonensis AY-13. The sequence was deposited in EBI with accession no. HE970768. Phylogenetic tree was constructed using MEGA 4.0. (Figure I).

DQ458821 Marinobacter pelagius EF157832 Marinobacter segnicre AY-13

12

97

DQ414419 Marinobacter gudaonen AY517632 Marinobacter flavimar EF486354 Marinobacter salicamp

44

AJ609271 Marinobacter bryozoor

51

AJ609270 Marinobacter sediminu

93

EF028328 Marinobacter salsugin EU293413 Marinobacter zhejiang

47

EU293412 Marinobacter mobilis

97

EF660754 Marinobacter goseonge AM503093 Marinobacter guineae

43

AY147906 Marinobacter lipolyti

37

DQ235263 Marinobacter vinifirm

52 84

AF479689 Marinobacter litorali

0.005

Figure 1 Phylogenic tree of Marinobacter gudaonensis AY-13. Phylogenetic analysis of 16s rRNA gene sequence of Marinobacter gudaonensis AY-13. The percent numbers at the nodes indicate the levels of bootstrap support based on neighbor-

joining analyses of 1,000 replicates. The scale bar (0.005) indicates the genetic distance. b. Decolorization studies –



The decolorization capacity of a microorganism can be tested by examining its potential to degrade various dyes20. i. Decolorization studies in Nutrient Broth, Half (½) Strength Nutrient Broth The decolorization was conducted with the Acid Yellow 25, supplemented with nutrient broth having 8.0% NaCl and dye at 37oC. So as depicted in Table 2, Marinobacter gudaonensis AY-13 showed the decolorization of the dye Acid Yellow 25 to a greater extent. Also the decolorization of

the dye in half (½) strength nutrient broth was slightly less. ii. Percent Decolorization in Cell Free Extract Microbes can acclimatize themselves to toxic wastes and new resistant strains develop naturally, which can transform various toxic chemicals to less harmful forms. The action of cell free extract of the Marinobacter gudaonensis AY-13 to decolorize the dye Acid Yellow 25 was observed in nutrient medium containing 8.0% NaCl (Table 2).

Table 2 – Percent Decolorization in Nutrient Broth, Half (½) Strength Nutrient Broth, Cell Free Extract by Marinobacter gudaonensis AY-13 in 24 hrs at 392nm λ max. Culture Code

AY-13

% Decolorization in Nutrient Broth

% Decolorization in Half Strength Nutrient Broth

92.00

Percent Decolorization in presence of different Co-substratesThe isolate was inoculated in 20ml nutrient broth (Peptone – 1.0g, NaCl – 0.5g, Beef Extract – 0.3g, Distilled Water – 100ml,) containing 8.0% NaCl concentration, 1500μg/ml concentration of dye and 1% Glucose. Tube was then incubated at 37oC for

90.03

% Decolorization in cell-free extract

80.13

COD Reduction

70

24 hours and observed for decolorization of the dye. Additionally, nutrient medium containing 1% Starch and 1% Yeast extract with the same dye and NaCl concentration were also used to test the ability of the isolate AY-13 to decolorize the dye Acid Yellow-25.

Table 3 – Percent Decolorization in presence of Co-substrates viz. 1%Glucose, 1%Yeast Extract and 1% Starch by Marinobacter gudaonensis AY-13 in 24 hrs at 392nm λ max. Culture Code % Decolorization in 1% Glucose 1% Yeast Extract 1% strach AY-13 92.77 94.00 92.05 Percent COD reduction To evaluate the level of biodegradation of Acid Yellow 25 by Marinobacter gudaonensis AY-13, we have determined the percentage of mineralization (represented by COD removal) by measuring the initial and final organic content. 70% of COD was removed which is significant removal of COD was observed after a period of 24 hours. Confirmation of Biodegradation of dye

The GCMS analysis report showed that the dye Acid Yellow 25 was degraded by Marinobacter gudaonensis AY-13 and not decolorized (Figure II). The molecular weights of the degraded products are 98, 70, 112, 125, 140, 168, 186, 128, 141, 83, 111, 154, 72 and 155 respectively. The probable degradation pathway is depicted in Figure III which helps for the confirmation of the degradation of the dye Acid Yellow 25.

Figure II : GC-MS analysis report of the dye Acid Yellow 25 by Marinobacter gudaonensis AY-13





Figure IIII Degradation n Pathway off Acid Yellow w 25 by the Prromising Isollate AY-13



O NH

OH

S

N

O

N

H 3C

N N

SO 3 Na

Acid Yellow 25 Molecular Formula = C22H24N5NaO6S2 Formula Weight = 541.575629

OH

O NH

H 2N

S

NH 2 H 3C

O 4-am ino-N-phenylcyclohexanesulfonam ide Mol. wt.- 254

N N

SO 3 Na sodium 4-(4-am ino-5-hydroxy-3-m ethyl-1H-pyrazol1-yl)benzenesulfonate Mol. wt.- 291

O NH 2 aniline Mol. wt.- 93

S

+

NH 2

OH H 2N

O Mol. wt.- 162

NH H 3C N 4-am ino-3-m ethyl-1 H-pyrazol-5-ol Mol. wt.- 113

SO 3 Na sodium benzenesulfonate Mol. wt.- 167

NH 2 benzene Mol. wt.- 78

cyclohexanam ine Mol. wt.- 99

H 2N

SO 3 Na Mol. wt.- 103

NH

H 3C N 3-m ethyl-1H-pyrazol-4 -am ine Mol. wt.- 97

CH 2 CH 3 (3Z)-penta-1,3-diene Mol. wt.- 68

CH 2 CH 2 buta-1,3-diene Mol. wt.- 54

benzene Mol. wt.- 78

SO 3 Mol. wt.- 80

cyclohexane Mol. wt.- 84 H 2N CH 3 CH 3

CH 2

H 3C NH 3-im inobut-1-en-2-am ine Mol. wt.- 84

pentane Mol. wt.- 72 H 2N CH 3 CH 3 butane Mol. wt.- 58

CH 2

H 3C but-1-en-2-am ine Mol. wt.- 71

H 2N

CH 2

H 3C prop-1-en-2-am ine Mol. wt.- 57



Discussion The Halomonas elongate decolorized and degraded all the 3 azo dyes (Reactive blue 81, Reactive Red 111 and Reactive yellow 44) efficiently (Pandu and Compala, 2013). Guo et al., (2008) isolated Halomonas strains from coastal sediments contaminated by chemical wastewater. They showed that under high salt concentration the isolated Halomonas sp. decolorized five azo dyes in 24 hours with a decolorization above 90%. This results were very much similar with our results in which Marinobacter gudaonensis AY-13 decolorized the textile azo dye Acid Yellow 25 upto 92% in nutrient medium in 24 hours. Previous studies have shown that the strains of Halomonas sp. isolated from textile industries effluents were able to decolorize seven azo dyes- Remazol Black B, Remazol Black N, Sulfonyl Scarlet BNLE, Sulfonyl Blue TLE, Maxilon Blue and Entrazol Blue IBC. The strains were identified as Halomonas aquamarina, Halomonas meridian, Halomonas salina (Asad et al., 2007). Halotolerant bacteria has been reported to decolorize textile azo dyes (Khalid et al., 2008). The azo dyes are degraded by bacteria using their extracellular hydrolytic and oxidative enzymes (Axelsson et al., 2006; Wang et al., 2009). Due to acclimatization, this isolate was resistant to 10,000ppm of dye concentration. Such similar findings were reported by Khehra et al., (2005). Since the dyes are deficient in carbon source, it seems necessary to supplement additional carbon or nitrogen source to assist biodegradation of dyes by the bacterial consortium (Senan and Abraham, 2004). Marinobacter gudaonensis AY-13 showed slight increase in decolorization when it was supplemented with different carbon and nitrogen sources (co-substrates). Jadhav et al., (2010) pointed out that the presence of various carbon and nitrogen sources in medium might have stimulatory or inhibitory effect on enzyme systems involved in the decolorization. The role of oxidoreductive enzymes in the decolorization of sulfonated reactive azo dyes have been characterized in Rhizobium radiobacter MTCC 8161 (on Reactive Red 141), and Pseudomonas sp. SUK1 on Reactive Red 2 (Kalyani et al., 2009; Telke et al., 2008). 70% of COD was removed by Marinobacter gudaonensis AY-13 which is significant removal of COD was observed after a period of 24 hours. Moreover, the COD removal efficiency is better than that reported earlier (Kalyani et al., 2009), as a COD reduction of 55.55 and 52% was observed for Reactive Blue 172 by Exiguobacterium sp. RD3 and Reactive Red 2 by Pseudomonas sp. SUK1, respectively. Mixed cultures of Pseudomonas aeruginosa 3MT and Pseudomonas sp. CP4 uses ortho and meta ring

cleavage pathway to degrade mixtures of 3chlorobenzoate and phenols (Babu et al., 1995). Pseudomonas sp. CPE1 can completely mineralize 4-Chlorobiphenyl via 4-chlorobenzoate. Some compounds such as chlorobenzenes, chloroanilines and polyaromatic hydrocarbons prevent microbial degradation of dyes, as they get adsorbed to clay and organic matter (Puvaneswari et al., 2006). Similarly, Marinobacter gudaonensis AY-13 uses ring cleavage pathway to degrade the dye Acid Yellow 25.

Conclusion The present work focuses on the use of marine microorganism to remediate the environment contaminated by azo dyes, which are extensively used in the textile industries. The presence of high salt content in the textile dye effluents hinders the development of efficient bio-treatment system to bioremediate the textile azo dyes. This imposes a great need in developing bacterial strains that could thrive under high salt conditions. Salterns or Solar salt crystallizer ponds contain hyper-saline waters and the soil present there serves as a rich source of marine microorganisms. The bacteria isolated from such saline soil will definitely yield a good collection of halophilic and halotolerant bacterial strains. Bioremediation has proved to be very effective method in countering the textile dye pollution in an eco-friendly way. This approach creates a promising hope to remediate the environments polluted by textile azo dyes. The results presented here indicated that, the dye Acid Yellow 25 was biodegraded in 24 hours by the isolate AY-13 which was identified as Marinobacter gudaonensis AY-13. The degradation of the dye was enhanced when 1% co-substrates were used as carbon and nitrogen source. Also the intracellular enzymes showed the considerable amount of degradation of the dye. The isolate reduced the COD of the dye to a much greater extent proving it a good agent for bioremediation. So the isolate might play a possible role in bioremediation of the dye contaminated soil.

Acknowledgment We would like to offer our sincere thanks to Staff of Indian Institute of Technology Powai, Mumbai for GCMS analysis and National Center for Cell Sciences, University of Pune Campus for the 16s rRNA sequencing of the isolate. Our sincere thanks to Principal, Shri Shivaji Mahavidyalaya, Barshi for providing the Laboratory facilities.

References [1] O. Khadijah, L.K.K. Mohd Faiz, and F. Abdullah, “Isolation, screening and



development of local bacterial consortia with azo dyes decolourising capability,” Malaysian Journal of Microbiology, Vol. 5, pp. 25-32, 2009. [2] A. Tripathi, S.K. Shrivastava, “Ecofriendly treatment of azo dyes – Biodecolorization using bacterial strains,” International Journal of Bioscience, Biochemistry and Bioinformatics., Vol.1, no.1, pp. 37 – 40, 2011. [3] F. P. Van der Zee, S. Villaverde, “Combined anaerobic-aerobic treatment of azo dyes—A short review of bioreactor studies,” Water Research, Vol. 39, pp. 1425–1440, 2005. [4] P. Kaushik, A. Malik, “Fungal dye decolourization: Recent advances and future potential,” Environment International, Vol. 35, pp. 127–141, 2009. [5] E. Forgacs, T. Cserhati, G. Oros, “Removal Of Synthetic Dyes From Wastewaters: A Review,” Environ Int, Vol. 30, pp. 953-71, 2004. [6] Mohandass Ramya, Bhaskar Anusha, S. Kalavathy, S. Devilaksmi, “Biodecolorization and biodegradation of Reactive Blue by Aspergillus sp.,” African Journal of Biotechnology, Vol. 6, pp. 1441-1445, 2007. [7] E. Forgacs, T. Cserhati, G. Oros, “Removal Of Synthetic Dyes From Wastewaters: A Review,” Environ Int, Vol. 30, pp. 953-71, 2004. [8] K. Jirasripongpun, R. Nasanit, J. Niruntasook, B. Chotikasatian, “Decolourization and degradation of C. I. Reactive Red 195 by Enterobacter sp. Thammasat,” International Journal of Science and Technology, Vol.12, pp. 6–11, 2007. [9] U. Shedbalkar, R. Dhanve, J. Jadhav, “Biodegradation of Triphenylmethane Dye Cotton Blue By Penicillium Ochrochloron MTCC 517,”Journal Of Hazardous Materials, Vol. 157, pp. 472–479, 2008. [10] K.P. Gopinath, H. A. M. Sahib, K. Muthukumar, M. Velan, “Improved biodegradation of Congo red by Bacillus sp.,” Bioresource Technology, Vol. 100, pp. 670– 675, 2009. [11] G. Mcmullan, C. Meehan, A. Conneely, N. Kirby, T. Robinson, P. Nigam, I.M. Banat, R. Marchant, W.F. Smyth, 2001 “Microbial Decolourization And Degradation Of Textile Dyes,” Appl Microbiol Biotechnol, Vol. 56, pp. 81–87, 2001. [12] S. Y. An, S. K. Min, I. H. Cha, Y. L. Choi, Y. S. Cho, C. H. Kim, “Decolourization of triphenylmethane and azo dyes by Citrobacter sp.,” Biotechnology Letters, Vol. 24, pp. 1037– 1040, 2002.

[13] I.M. Banat, P. Nigam, D. Singh, R. Marchant, “Microbial decolorization of textile dyecontaining effluents: a review,” Bioresour Technol., Vol. 58, pp. 217-227, 1996. [14] J. Sambrook, E.F. Fritsch, T. Maniatis, “Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory,” Cold Spring Harbor, NY. 1989. [15] K. Tamura, J. Dudley, M. Nei, S. Kumar, “MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0,” Mol Biol Evol, Vol. 24, pp. 1596–1599, 2007. [16] N. Saitou, M. Nei, “The neighbor-joining method: a new method for reconstructing phylogenetic trees,” Mol Biol Evol, Vol. 4, pp. 406–425, 1987. [17] J. Felsenstein, “Confidence limits on phylogenies: an approach using the bootstrap,” Evolution, Vol. 39, pp. 783–791, 1985. [18] K. Tamura, M. Nei, S. Kumar, “Prospects for inferring very large phylogenies by using the neighbor-joining method,” Proc Natl Acad Sci USA, Vol. 101, pp. 11030–11035, 2004. [19] K. Tamura, J. Dudley, M. Nei, S. Kumar, “MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0,” Mol Biol Evol, Vol. 24, pp.1596–1599, 2007. [20] R.C. Senan, T.E. Abraham, “Bioremediation of textile azo dyes by aerobic bacterial consortium,” Biodegradation, Vol. 15, pp. 275–280, 2004. [21] Pandu krishna and Compala Prabhakar., “Bioremediation of textile dyes and improvement of plant growth by marine bacteria,” Thesis submitted to University of Boras. 2013 [22] J. Guo, J. Zhou, D. Wang, J. Yang, “The new incorporation bio-treatment technology of bromoamine acid and azo dyes wastewaters under high-salt conditions,” Biodegradation, Vol. 19 no.1, pp. 93–98, 2008. [23] S. Asad, M.A. Amoozegar, A.A. Pourbabaee, M.N. Sarbolouki, S.M.M. Dastgheib, “Decolorization of textile azo dyes by newly isolated halophilic and halotolerant bacteria,” Bioresource Technology, Vol. 98, pp. 20822088, 2007. [24] A. Khalid, M. Arshad, D.E. Crowley, “Accelerated decolorization of structurally different azo dyes by newly isolated bacterial strains,” Applied Microbiology and Biotechnology, Vol. 78, pp. 361-369, 2008. [25] J. Axelsson, U. Nilsson, E. Terrazas, T. Alvarez Aliaga, U. Welander, “Decolorization of the textile dyes Reactive Red 2 and Reactive Blue 4 using Bjerkandera sp. Strain BOL 13 in a continuous rotating biological contactor



reactor,” Enzyme and Microbial Technology, Vol. 39, pp. 32-37, 2006. [26] H. Wang, J.Q. Su, X.W. Zheng, Y. Tian, X.J. Xiong, T.L. Zheng, “Bacterial decolorization and degradation of the reactive dye Reactive Red 180 by Citrobacter sp. CK3,” International Biodeterioration and Biodegradation, Vol. 63, pp. 395-399, 2009. [27] M. Khehra, H. Saini, D. Sharma, B. Chadha, S. Chimni, “Decolorization of various azo dyes by bacterial consortium,” Dyes Pigments., Vol. 67 no. 1, pp. 55–61, 2005. [28] J.P. Jadhav, D.C. Kalyani, A.A. Telke, S.S. Phugare, S.P. Govindwar, “Evaluation of the efficiency of a bacterial consortium for the removal of color, reduction of heavy metals, and toxicity from textile dye effluent,” Bioresour. Technol, Vol. 101, pp. 165–173, 2010. [29] D.C. Kalyani, A.A. Telke, R. Dhanve, J.P. Jadhav, “Ecofriendly biodegradation and detoxification of Reactive Red 2 textile dye by newly isolated Pseudomonas sp. SUK1,”J. Hazard. Mater, Vol. 163, pp. 735–742, 2009. [30] A. Telke, D. Kalyani, J. Jadhav, S. Govindwar, “Kinetics and mechanism of Reactive Red 141 degradation by a bacterial isolate Rhizobium radiobacter MTCC 8161,” Acta Chim Slov, Vol. 55, pp. 320–329, 2008. [31] K.S. Babu, P.V. Ajith-Kumar, A.A. Kunhi, “Simultaneous degradation of 3chlorobenzoate and phenolic compounds by a defined mixed culture of Pseudomonas spp.,” World Journal of Microbiology and Biotechnology, Vol. 11, pp. 148-152, 1995. [32] N. Puvaneswari, J. Muthukrishnan, P. Gunasekaran, “Toxicity assessment and microbial degradation of azo dyes,” Indian J Exp Biol, Vol. 44, pp. 618-626, 2006


Journal of Engineering, Computers & Applied Sciences (JEC&AS) ISSN No: 2319-5606 Volume 2, No.4, April 2013 _________________________________________________________________________________

Techno-Economic Analysis of a Mixed Grainage for the Production of Multivoltine and Bivoltine Commercial Seed Production in Karnataka (India) B.S.Angadi, Central Silk Board, Bangalore, India

ABSTRACT Consequent to the disappearance of Japan, USSR and Korea from the silk production scenario, the onus of international grade raw silk production in massive scale and absorption of global demand lies on China and India, which have emerged as leaders in the recent past. Indian sericulture is mostly is multivoltine oriented and concentrated in the southern part, with conspicuous contribution from Karnataka state. Karnataka that enjoys salubrious climatic conditions, is all set for accepting the challenge, but requires the active intervention of all the stake holders for gearing up the production of international grade bivoltine raw silk in appreciable quantities. This should begin from encouraging the existing grainages and enable them to produce the proportionate quantities of both multivoltine and bivoltine disease free layings required y the industry. This paper discusses the techno-economic feasibility of such facility for Karnatka state. (Key words: Mixed Grainage, Techno-Economics, Multivoltine, Bivoltine, Commercial Seed)

Introduction Significant changes have taken place in the global silk industry. Considering the fact that the mighty silk producers like Japan, USSR and Korea have virtually disappeared from the silk production scenario, the onus of producing a large quantity of silk of international grade and meeting the demand lies on India and China which have emerged as leading silk producing countries of the world in the recent past. Any change that is intended to be made in the Indian silk industry needs initiation from Karnataka state since its transformations will have greater impact on the progress, owing to the fact that it is currently contributing over 47% to the country’s production. In this direction efforts are required at every level to set up facilities that improve efficiency, quality and productivity. Sericulture is an agro-industrial activity practiced in over 10,795 villages of Karnataka and is spread over 62,697 hectares. Apart from the traditional sericulture districts of Karnataka like Kolar, Bangalore, Ramanagaram, Mysore, Mandya, Chamarajanagar and Tumkur, it is being actively encouraged in other districts through interventions of various projects and programs envisaged by the governmental and non-governmental agencies from time to time. A grainage is such one facility where disease free and quality silkworm seeds are produced based on scientific methods, to cater to the timely requirements of the farmers. Normally, grainages

are established for production of either Cross Breed or Bivoltine industrial seeds. Industrial seeds are

www.borjournals.com

hybrids and produced by using two or more specific authorized pure races of silkworm and are reared by the farmers for producing the reeling cocoons. A mixed grainage is considered primarily to serve the demands of certain pockets where rearing of both the combinations are practiced, alternatively in the favourable and unfavourable seasons of the year. The ruling hybrids of Karnataka are, Pure Mysore x CSR2, Pure Mysore x FC2 (Cross breeds: Reared throughout the year) and CSR2 x CSR4, FC1 x FC2 (Bivoltine hybrids: Reared from July to February)

Present Status Grainages existing in Karnataka State can be classified as: a. Grainages established by Department of Sericulture, Govt. of Karnataka. b. Grainages established by Central Silk Board, functioning under National Silkworm Seed Organisation. c. Grainages established by Registered Seed Producers (RSP’s) in the private sector. The number of such grainages in operation and their overall production for 2010-11 is presented in Table 1A.

Very meagre quantity of 9.52% dfls of bvioltine hybrid disease free layings were produced by all the above agencies together, while LSP’s have not contributed naything. Contribution of the LSP’s production for the overall production of the state is to the extent of 64.55%, followed by the DOS grainages (17.77%) and NSSO (17.67%).

Blue Ocean Research Journals

46


Technical Feasibility It is evident from the estimates of past consumption and the increased mulberry productivity per unit area coupled with the anticipated increase in the acreage under mulberry, the requirement of silkworm seed will shoot up considerably. Especially the demand for bivoltine hybrids shall be more to commensurate with the projected production plan by the end of 12th plan. To fulfill the projected target of 5000 M.T of gradable bivoltine raw silk, we need to produce 595.00 lakh bivoltine hybrids. The share of this shall be 190 lakhs by CSB, 273 lakhs by DOS and 133 lakhs by LSP grainages. Thus there exists a quite good demand for bivoltine commercial seeds in addition to the cross breeds. There is an abundant scope for establishment of a commercial grainage to produce 6.00 lakh cross breed and 4.00 lakh bivoltine hybrids per year. The production of bivoltine hybrids can be restricted for favorable months for ensuring the quality of dfls produced.

Project cost The total cost of the project based on the above considerations, is worked in three options; i. Purchase of land, construction of grainage building and equipping it newly costs around Rs 113.75 lakhs and a recurring expenditure of Rs 36.00 lakhs per year. ii. Establishing grainage in a rented building by equipping it newly costs around Rs 18.25 lakhs and a recurring expenditure of Rs 42.00 lakhs per year Taking on lease a government building along with the equipments on a nominal lease amount of Rs 10,000 per month will incur a recurring expenditure of Rs 37.19 lakhs per year

Working Capital Considering the holding period of dfls and the cost of seed cocoons an amount of Rs 3.00 lakh working capital is required to run the mixed grainage and this amount taken from any bank in the form of loan attracts an interest rate of 12% per annum which is also considered while calculating the profitability.

Profitability and economic feasibility The profitability has been estimated at 100% capacity utilization from the very first year onwards. The total cost of the project and

www.borjournals.com

production is estimated at Rs 113.75 lakhs and after considering the depreciation of the equipment’s and the building, option ‘i’ leaves an operating profit of Rs 4.15 lakhs on a sale of Rs 44.84 lakhs. Under option ii, wherein it is proposed to hire a building for grainage operation and equip it newly the non-recurring and recurring expenditures shall be Rs 41.19 lakhs and leaves an operating profit of Rs 3.65 lakhs on a sale of Rs. 44.84 lakhs. Under option iii, wherein it is proposed to take on lease a government building along with the equipment’s the non-recurring and recurring expenditures shall be Rs 37.55 lakh and leaves an operating profit of Rs 4.49 lakhs on a sale of Rs. 44.84 lakhs. In view of the high initial investments under option i, cost of project in an alternate scenario of rented building and equipping it with the required equipments or taking grainage building on lease basis along with the required equipments is economically feasible.

Breakeven production At 80% capacity utilization, breakeven point is achieved indicating a very low risk. A production of 4.80 lakh cross breed and 3.20 lakh bivoltine hybrids will ensure no- profit, no-loss situation.

References [1] Angadi.B.S and Dandin.S.B (2007). Establishment of a mixed grainage for the production of multivoltine and bivoltine commercial seed production in Karnataka. A Project Profile submitted to Central Silk Board, Bangalore. [2] Angadi. B.S. (2002). Commercial bivoltine seed production. Workshop on promotion of bivoltine sericulture technology under PPBST project 7-8 March 2002 Japan International Cooperation Agency Central Sericultural Research & Training Institute. Mysore. [3] Dandin, S.B., Basavaraja, H.K., and Sureshkumar, N. (2003). Factors for success of Indian sericulture Indian Silk, 41(9); 5-8. [4] Jacob Thomas, M.N.S,Iyengar, B.S.Suligavi, Y.S.Ramesha, G.Srinivasa, H.Jayaram, V,.S.Kulakarni and R.M.Mattigatti (1992). Role of credit in sericulture development. Proceedings of the National Workshop on Credit to Sericulture, held on 22,23 May 1992 at Central Silk Board, Bangalore. [5] Table 1A. Sector-wise grainages in Karnataka and their productions


47


Category

Number of Grainages

Bivoltine F1 production (lakh nos)

Cross breed F1 production (lakh nos)

Govt. of Karnataka N.S.S.O (C.S.B) Private

58 6 231

13.38 62.63 -

128.49 78.46 515.26

Total production (lakh nos) 141.87 141.09 515.26

Table 2 : PROFITABILITY OF THE PROJECT (Option i) Item Unit Rate Amount (lakh Rs) A.Expenditure 1. 2. 3. 4.

Depreciation on building Depreciation on equipments Interest on working capital Recurring expenditure Total

50.00 lakh 18.25 lakh 3 36.00 lakh

5% 10% 12% 100%

2.5 1.83 0.36 36 40.69

1. Cost of CB dfls

6.00 lakh

350/100 dfls

21.00

2. Cost of Biv dfls

4.00 lakh

450/100 dfls

18.00

3. Cost MSC P.C

480 kgs

527/kg

2.53

4. Cost of BSC P.C

800 kgs

414/kg

3.31

B.Returns

Total C. Profit/loss

www.borjournals.com

44.84 4.15


48


Table 3 :PROFITABILITY OF THE PROJECT (Option ii) Item Unit Rate Amount (lakh Rs) A.Expenditure 1. 2. 3. 4.

Building rent Depreciation on equipments Interest on working capital Recurring expenditure

5000 sq.ft 18.25 3 36

25000/month 10% 12% 100%

Total

3.00 1.83 0.36 36 41.19

B.Returns 1. 2. 3. 4.

Cost Cost Cost Cost

of CB dfls of Biv dfls MSC P.C of BSC P.C

6.00 4.00 480 800

lakh lakh kgs kgs

350/100 dfls 450/100 dfls 527/kg 414/kg

Total

21.00 18.00 2.53 3.31 44.84

C. Profit/loss

3.65

Table 4 : PROFITABILITY OF THE PROJECT (Option iii) Item Unit Rate Amount (lakh Rs) A.Expenditure 1. Lease amount

3. Interest on working capital 4. Recurring expenditure

-

10000/month

1.20

-

-

-

3

12%

0.36

35.99

100%

35.99

Total

37.55

B.Returns 1. Cost of CB dfls

6.00 lakh

350/100 dfls

21.00

2. Cost of Biv dfls

4.00 lakh

450/100 dfls

18.00

3. Cost MSC P.C

480 kgs

527/kg

2.53

4. Cost of BSC P.C

800 kgs

414/kg

3.31

Total C. Profit/loss

www.borjournals.com

44.84 4.49


49


C Comparrative Sttudy off EMC Greenp G plum an nd Oracle E Exadata a Ektaa Rajput, Studennt ,Computer SScience , RKG GITW, Ghaziabbad Harshitaa Yadav, Stud dent ,Computeer Science , RK KGITW, Ghazziabad Ayushi S Singh, Student ,Computer Science S , RKG GITW, Ghaziabbad

ABSTR RACT Our papeer deals with the t comparatiive study of tw wo databases namely n EMC Greenplum G annd Oracle Dattabase .Greenpllum is a massiively parallel processing p daatabase serverr that is designned to supportt the next geneeration of data warrehousing andd large-scale analytics a proceessing. Oraclee is the first database d desiggned for enterpprise grid computinng, the most flexible and cosst effective waay to manage information and a applications.Our paper focuses on the eff fficiency, compplexity and cappacity of both h the databasees. It is believeed that this pap aper is giving the insight off pros and conns in both dataabases . Keywordds: EMC; MPP P; database

1.Introduction As we knnow humans can c process daata, store it in their minds annd use it when never they neeed it, but whenn the data incrreases it becoomes difficult for a perso on to memorize everything and be accuurate about it.. So, databasess were developed to mainntain big reco ords. The dataabases makess organizing and maintaiining long term m data easier. With thee help of dataabase we can find the requ uired data andd use it acccordingly We W use diffe ferent databasess for differentt types of dataa according too our prioritiess. The first daatabase was developed byy Dr. Edgar Frrank Codd inn the year 1996. Few off the largest ddatabases in the world are a of Libraryy of Congresss, CIA, Amazoon, Youtube, Google. There aare various types of databases d nam mely Relationaal Databases, Distributed Database, D Parrallel Databasee, Active Dataabase, Mobilee Database, BackB End Dataabase, Docum ment-Oriented Database. Inn this paper we will take up comparision between two major daatabases undeer Relational Database thatt are Oracle Exxadata and EM MC Greenplum m.

capacity can be easily add ded or realloccated from thee resource pooll as needed.[1] 2.1 Oracle Exxadata Databaase Machine Architecture A In the figuree below is a simplified scchematic of a typical Databbase Machine Half Rackk deployment. Two Oracle Databases, D one Real Appliccation Clusterss (RAC) databbase deployeed across thhree databasee servers and one o single- in nstance databbase deployed d on the remaiining databasee server in thhe Half Rack, are shown. (O Of course all four f database servers could d be used for a single fourr node RAC cluster.) Thee RAC databasse might be a production database and d the single-innstance databaase might bee for test and d development. Both databaases are shariing the seven. Exadata cellss in the Half Rack but theyy would havee separate Orracle homess to maintaain softwaree independencee. All the componentts for thiss configurationn – databasee servers, Exadata E cells, InfiniBand sw witches and other o support hardware aree housed in thee Database Maachine rack[2]].

2.Oraclle Exadata An oraclle database is a collection of data treateed as units. It is the first daatabase designned for enterpprise grid com mputing, the most m flexible and cost effective way to manage innformation and a applicattions. Enterprisse grid compputing creates large poolls of industry--standard, moddular storage and servers. With W this archhitecture, eachh new system m can be rap pidly provisionned from the pool p of compoonents. There is no need for ppeak workloaads because

Fig. 1. Oraclee Exadata dataabase Architeccture


Journa al of Engineerring, Computeers & Applied d Sciences (JEC C&AS) ISSN No: 23 319‐5606 Volum me 2, No.4, Ap pril 2013 _________________ ________________________ ___________________________________ _____________

2.1 Oraacle exadatta databasee features

3.1. MPP (M Massively Paraallel Processin ng)

Exadata smart scan Improve query perforrmance by off ffloading intennsive s to scallable query proocessing and data mining scoring intelligennt stogare serv vers Exadata smart flash cache c Transparrent cache ‘hoot’ read and write data to o fast solid-statte storage,impproves query response r timee and throughpput. InfiniBand network Connect multiple Exaadata Database Machines using u the InfiniBand fabric to form a larrger single syystem image coonfiguration. Each InfiniBand link provvides 40 Gigabbits of bandw width–many times t higher than traditionaal storage or server s networkks Petabytee scalability Easily sccale data warehhouse to suppport enterprise data growth Exadata hybrid colum mnar compreession Reduce the t size of daata warehousiing tables by 10x, and archhive tables by y 50x, to impprove perform mance and loweer storage co osts for primaary, standby, and backup ddatabases.

3. EMC C Greenplu um The Greeenplum Databbase builds onn the foundatioon of open souurse databasee foundationss of open so ourse databaseP PostgreSQL It I primarily fuunctions as a data warehousse and utilizees a shared-nnothing, massiively parallel processing (MPP) architecture. In this architectuure, data is partitioned across mulltiple segment servers, annd each seggment owns and manages a distinct porrtion of the ovverall data; theere is no disk--level sharingg nor data contention c am mong segmentss[3].

Fig. 2. Massively Parrallel Proceessing The figure abbove summarizes the core shared s nothing g MPP architeecture enablees massive data storage, loading, andd processing g with unliimited linearr scalability. The core principle off the EMC C Greenplum Database D is to move thhe processing g dramatically closer to thee data and itts users. Thiss effectively enables e the computational resources to o process everyy query in a fuully parallel manner, m use alll storage conn nections simuultaneously, and a flow dataa efficiently between b resou urces as thee query plan n dictates.[4]

3.2 EMC Greenplum G m Architectu ure. vely Parallel Processing P Arrchitecture Core Massiv The Greenpplum Databaase architectuure providess automatic parallelization of o data andQuueries.All dataa is automaticaally partitioneed across all nodes of thee system, and queries are planned and exxecuted using g all nodes wo orking togetheer in a highlyy coordinated d fashion. Petabyte-Scaale Loading High-perform mance loadingg uses MPP Scatter/Gather S r Streaming teechnology. Loading speedds scale with h each additionnal node to grreater than 100 terabytes perr hour, per rack k. Polymorphicc Data Storagge and Execu ution Using Greeenplum’s Poolymorphic Data D storagee technology, the DBA can selecctthe storagee y ,execution, annd compressioon settings thaat suit the way that table will be accessed..

Anywhere Data D Access



Anywhere data access enables queries to be executed from the database against external data sources, returning data in parallel regardless of location, format, or storage medium. In-Database Compression In-database compression uses industry-leading compression technology to increase performance and dramatically reduce the space required to store data. Multi-level Partitioning Flexible partitioning of tables is based on date, range, or value. Partitioning is specified using DDL and enables an arbitrary number of levels. The query optimizer will automatically prune unneeded partitions from the query plan. Dynamic Partioning Elimination and Query Memory Optimization Greenplum Database supports dynamic partition elimination and query memory optimization. Dynamic Partition Elimination desregards irrelevant partions in a table and allows for significant reduction in the amount of data scanned and results in faster query execution times. The query memory optimization feature intelligently frees and reallocates memory to different operators during query processing, allowing for better memory utilzation, higher throughput, and higher concurrency.

3.2 EMC Greenplum Features High Availability,Backup Recovery

and

deduplication process to Greenplum Database servers, and enables them to send only unique data to the Data Domain system. This dramatically increases aggregate throughput, reduces the amount of data transferred over the network, and eliminates the need for NFS mount management[5].

Interoperatibility Indexes – B-Tree, Bitmap, and More Greenplum Database supports a range of index types, including B-Tree and Bitmap. Client Access and Third-Party Tools Greenplum supports standard database interfaces(PostgreSQL,SQL,ODBC,JDBC,OLEDB, etc.) and is fully supported and certified by a wide range of business intelligence (BI) and extract/transform/load (ETL) tools Comprehensive SQL Greenplum Database offers comprehensive SQL-92 and SQL-99 support with SQL 2003 OLAP extensions and full support, including window functions, rollup, cube, and a wide range of other expressive functionality. All queries are parallelized and executed across the entire system. XML Support Greenplum Database provides support for XML, it enables high-performance, support for XML data type, parallel load of XMLdocuments into the database and the XML Path language (xpath)

Disaster

Self-Healing Fault tolerance: Traditional MPP fault tolerance techniques were suitable for environment havin less than 100 servers. Greenplum’s fault-tolerance capabilities provide intelligent fault detection and fast online differential recovery, it lowers TCO and enabling cloud-scale systems with the highest levels of availability. Post-Recovery Online Segment Rebalancing After segment recovery, the EMC Greenplum Database segments can be rebalanced while the system is online. There is no downtime and all client sessions remain connected . The database remain functional while the system is recovered back into an optimal state.

Simpler, Scalable Backup with Data Domain Boost Greenplum Databse includes integration with EMC Data Domain deduplication storage systems via EMCDataDomain Boost for faster, more efficient backup. This integration distributes parts of the



4. Comparison Table 1. Comparison Table

Characterstics

EMC Greenplum

Oracle Exadata

Pipelines

Smaller

Bigger

Data Loading

Fastest data loading, virtual private cloud infrastructer for datawarehouse & analytics.

Comparatively slower

Total Servers

18

22

Downtime

No downtime

Takes days for new exadata database machine to be installed.

Data Sharing

Parallel Storage, if one storage fails then only the defected part suffers.

Shared Storage, if one storage fails entire system suffers.

Total Cores

192

264

Cost

Low Cost

High Cost

Performance

High Performance

Low Performance

Capacity (TB)

36 TB

45TB

External Database

No ability to connect to external database.

It can connect to external database.

Normalization

No Replication

Replication

Total Scan rate

24 GB/Sec

100 GB/Sec

Modularity

Dependency on physical infrastructure when performing backup.

No dependency

Load (TB/hr)

-10 TB/hr

-12 TB/hr

Largest Multi-Rack Configuration

24 racks

8 racks

5. Conclusion The paper has widely covered various characteristics of both the databases. EMC’s Greenplum can load data faster as compared to oracle but oracle has better scan rate. Where capacity of EMC Greenplum is 36TB that of Oracle exadata is 45TB. Oracle was the first database whereas Greenplum has been designed for nextgen data. Both the databases are efficient. Oracle is old and has been developed whereas Greenplum being new still needs to explore a lot of

areas. This paper is not to draw any conclusion regarding which one is superior.

6.References [1]http://docs.oracle.com/cd/B19306_01/server.102/b 14220/intro.htm [2]http://www.oracle.com/technetwork/database/exad ata/exadata-technical-whitepaper-134575.pdf



[3]http://www.greenplum.com/sites/default/files/201 2_0614_GPDB_DS.pdf [4]www.google.co.in/url?sa=t&rct=j&q=greenplum+ database+architecture&source=web&cd=4&cad=rja &ved=0CEEQFjAD&url=http://www.greenplum.co

m/sites/default/files/2012_0614_GPDB_DS.pdf&ei= ocxbUam0AsnTrQegk4H4BQ&usg=AFQjCNElmpuyHtlz6VKAIpyNQBfD_90Iw&bvm=bv.44697112,d .bmk [5]http://www.greenplum.com/sites/default/files/201 2_0614_GPDB_DS.pdf



Comparative Study of 1G, 2G, 3G and 4G Sapna Shukla, Student, Electronics and Communication, RKGITW, Ghaziabad Varsha Khare, Student, Electronics and Communication, RKGITW, Ghaziabad Shubhanshi Garg, Student, Electronics and Communication, RKGITW, Ghaziabad Paramanand Sharma, Assistant Professor, Electronics and Communication, RKGITW, Ghaziabad

ABSTRACT Mobile communication is continuously one of the hottest areas that are developing at a booming speed, with advanced techniques emerging in all the fields of mobile and wireless communications. This paper deals with the comparative study of wireless cellular technologies namely First Generation, Second Generation, Third Generation, and Fourth Generation. A cellular network or mobile network is a radio network distributed over land areas called cells, each served by at least one fixed-location transceiver, known as a cell site or base station. In a cellular network, each cell uses a different set of frequencies from neighbouring cells, to avoid interference and provide guaranteed bandwidth within each cell. The First Generation were referred to as cellular, which was later shortened to "cell", Cell phone signals were based on analog system transmissions, and First Generation devices were comparatively less heavy and expensive. Second Generation phones deploy GSM technology. Global System for Mobile communications or GSM uses digital modulation to improve voice quality but the network offers limited data service. The Third Generation revolution allowed mobile telephone customers to use audio, graphics and video applications. Fourth Generation is short for fourth-generation cell phones or/and hand held devices. Keywords— Cellular network, First Generation, Second Generation, Third Generation, and Fourth Generation

1.

INTRODUCTION

The past few years have witnessed a phenomenal growth in the wireless industry, both in terms of mobile technology and subscribers. The firstgeneration mobile systems were the analogue (or semi-analogue) systems, which came in the early 1980s - they were also called NMT (Nordic Mobile Telephone). They offered mainly speech and related services and were highly incompatible with each other. 1G refers to analog cellular technologies; it became available in the 1980s. 2G denotes initial digital systems, introducing services such as short messaging and lower speed data. CDMA2000 1xRTT and GSM are the primary 2G technologies, although CDMA2000 1xRTT is sometimes called a 3G technology because it meets the 144 kbps mobile throughput requirement. EDGE, however, also meets this requirement. 2G technologies became available in the 1990s. 3G requirements were specified by the ITU as part of the International Mobile Telephone 2000 (IMT2000) project, for which digital networks had to provide 144 kbps of throughput at mobile speeds, 384 kbps at pedestrian speeds, and 2 Mbps in indoor environments [5]. UMTS-HSPA and CDMA2000 EV-DO are the primary 3G technologies, although recently WiMAX was also designated as an official 3G technology [5]. The present time is just right to start the research of 4G mobile communications because of:





Possibility, according to the historical indication of a generation revolution once a decade, and now we are near the end of 3G standardization phase and the beginning of 3G deployment. Necessity: according to 3G goals, 3G is necessary but not sufficient to the mobile communication strategy, in which many problems are only partly solved and there are still many problems left to be solved in the next generation, i.e. 4G [1-3]. This paper is organized as follows. Section II provides a brief review of the development history and status of mobile communications. From first generation of cellular networks how mobile industry has grown till fourth generation. Description of First, Second, Third and Fourth generation. Section III portrays a comparison between all the four generation. Section IV gives the conclusion of the paper and also about the future prospects of the paper.

2. EVOLUTION OF MOBILE CELLULAR NETWORKS A cellular network or mobile network is a radio network distributed over land areas called cells, each served by at least one fixed-location transceiver, known as a cell site or base station. In a cellular network, each cell uses a different set of frequencies from neighbouring cells, to avoid interference and provide guaranteed bandwidth within each cell. When joined together these cells



provide radio coverage over a wide w geographhic area. This T enables a large number of portablettransceivers (ee.g., mobile phones, pageers, etc.) to communicatee with each other and with w

fixxed transceivers and teleph hones anywhere in the neetwork, via base b stations, even if som me of the traansceivers aree moving thro ough more thaan one cell duuring transmisssion.

FIGU URE I: EVOL LUTION OF MOBLIE M CEL LLULAR

FIRST GEN NERATION 2.1 The firrst generatiion of wiireless mobbile communiications was based on annalog signallin ng. Analog ssystems, impllemented in North N Americca, were known as Anaalog Mobile Phone System ms (AMPS),, while systeems implemennted in Euro ope and the rrest of the worrld was typicaally identified as a variattion of Tottal Access Communicatiion Systems (TACS). Analog systems were primarrily based onn circuit-switchhed technologgy and design ned for voicee, not data. Rooaming was not n possible and a the efficient use of frequency f speectrum was not n possible. 1G referss to the first-generatiion of wireleess telephone technology, t m mobile telecom mm unicationns. These a are the analoog telecommunnications stanndards that weere introduceed in the 1980s and continnued until beiing replaced by 2G digital telecommuniications. The main m differennce between two succeediing mobile teelephone systtems, 1G andd 2G, is that the t radio siggnals that 1G G networks use u are analo og, while 2G G networks are digital. 1G1 technoloogy replaced 0G technoloogy, which featured f mobbile radio teleephones and such technoloogies as Mobbile Telephonne System (MTS), Advvanced Mobbile Telephonne System (AMTS), ( Im mproved Mobbile Telephonne Service (IMTS), ( and Push to Taalk (PTT). . Through 1G,, a voice call gets modulatted to a higheer frequency of o about 150M MHz and up ass it is transm mitted betweenn radio towerrs. This is do one using a technique called Freqquency-Divisiion Multiple Access (FDM MA). But its i fail in som me field suchh as in terms of overall connnection qualiity, 1G comppares unfavourrably to its successorrs. It has low capacity, unrreliable handooff, poor voicce links, and no security att all since voiice calls werre played baack in radio towers, makiing

N NETWORKS[ [7]

thhese calls suscceptible to unw wanted eaves dropping byy third parties. With the in ntroduction off 1G phones, thhe mobile m market showedd annual grow wth rate of 30 to 50 per ceent, rising to nearly 20 million m subsccribers by 19990.

E PHONE FIGURE II: NOKIA 650 1G MOBILE

2..2 Second Generation G n Thhe second geeneration, 2G system, fieldded in the laate 1980s and d finished in n the late 19990s, was pllanned mainlyy for voice tra ansmission wiith digital siggnal and the speeds up too 64kbps. 2G G wireless ceellular mobilee services waas a step aheead of 1G seervices by prooviding the fa acility of shortt message seervice(SMS) unlike u 1G thatt had its primee focus on veerbal communnication. The bandwidth b off 2G is 302000 KHz. Durinng the secondd generation, the t mobile teelecommunications inddustry exp xperienced exxponential grrowth in term ms of both suubscribers annd value-addeed services. In I the early 1990s, 1 2G phhones deplooying GSM M technologgy were inntroduced. Global Syystem for Mobile coommunicationns or GSM usees digital moddulation to im mprove voice quality q but thee network offeers limited



data serrvice. As dem mand drove uptake of cell c phones, 2G carrierrs continuedd to improove transmisssion quality an nd coverage. The 2G carrieers also beggan to offer additional a seervices, such as paging, ffaxes, text messages m and voicemail. The T limited data d servicess under 2G included WA AP, HSCSD and a MLS.An intermediary i p phase, 2.5G was w introduceed in the latte 1990s. It uses the GPR RS standardd, which dellivers packett-switched daata capabilitties to existin ng GSM netw works. It allows users to send graphiccs-rich data as a packets. The T importannce for packett-switching inccreased with the t rise of the Internet andd the Internet Protocol, P or IP. I E com mmission startted In the miid-1980s the European a seriees of actiivities to liberalise the t communiications seector, incluuding mobbile communiications. Thiss resulted in the creation of ETSI, which w inheritted all the standardisatiion activitiess in Europe. This T saw the birth b of the fiirst specificaations, and thhe network bbased on digiital technologgy; it was caalled the Gloobal System for f Mobile C Communicatioon or GSM. Since the fiirst networkss appeared at the beginningg of 1991, GS SM has graduually evolved d to meet the requirements of data trafffic and manny more serrvices than the t original nnetworks.  GSM System for Mob bile (Global Commun nication): The maiin elements of o this system m are the BSS (Base Sttation Subsysttem), in whicch there are the t BTS (Baase Tran receiiver Station) and BSC (Baase Station Controllers); and the NSS N (Netwo ork SC Switchinng Subsystem)), in which thhere is the MS (Mobile Switching Ceentre); VLR (V Visitor Locatiion Register)); HLR (Hom me Location Register); AC A (Authenttication Centtre), and EIIR (Equipmeent Identity Register) Thhis network is capable of providingg all the basicc services such as speech and a data servvices up to 9.6 kbps, fax, etc. This GS SM network also has an a extension to the fix xed telephonyy networks.  GSM an nd VAS (Valu ue Added Servvices): The nextt advancementt in the GSM system was the t addition of two plaatforms, calleed Voice Mail M M Serviice System (VMS) and the Short Message he SMSC proved to be Centre (SMSC). Th incredibly commerciaally successfuul, so much so that in soome networks the SMS trafffic constitutes a major paart of the total traffic. Alongg with the VA AS, IN (Intellligent servicees) also made its mark in the t GSM syystem, with its i advantagee of giving the t operatorss the chance too create a whoole range of neew services. Fraud manag gement and 'prre-paid' servicces are the reesult of the IN N service.  GSM aand GPRS (General Packet Raddio Services)):

As the requireement for sen A nding data onn the airinnterface increaased, new eleements such as SGSN (S Serving GPRS S) and GGSN (Gateway GP PRS) were addded to the exxisting GSM system. s Thesee elements m made it possibble to send packet p data onn the airinnterface. This part of the network hanndling the paacket data is also a called thee 'packet core network'. Inn addition too the SGSN and GGSN N, it also coontains the IP P routers, fireewall servers and DNS (ddomain namee servers). This T enables wireless acccess to the Internet I and thhe bit rate reeaching to 1550 kbps in opttimum conditiions.  G GSM and ED DGE (Enhaanced Data rates for gllobal evolution): W With both voice and data traffic movinng on the syystem, the neeed was felt too increase the data rate. Thhis was done by using morre sophisticateed coding m methods over the t Internet and a thus increeasing the daata rate up to 384 kbpps. EDGE/EGPRS is im mplemented as a bolt-on b enhhancement foor 2.5G GSM//GPRS netwoorks, making it easier foor existing GS SM carriers to upgrade to it.. EDGE is a superset to GPRS and can functionn on any neetwork with GPRS G deployyed on it, proovided the caarrier implem ments the neceessary upgradde. EDGE caan carry a banndwidth up to o 236 kbit/s (with ( endtoo-end latency of o less than 1550 ms) for 4 timeslot in paacket mode. This T means it can handle ffour times ass much traffic as standard GPRS. G

F FIGURE III: 2G 2 TECHNOL LOGY GSM technolog G gy is a combbination of Frequency F D Division Multtiple Access (FDMA) and a Time D Division Multip iple Access (T TDMA). The first f GSM syystems used a 25MHz freqquency spectruum in the 9000MHz band d. FDMA is used to divide d the avvailable 25M MHz of bandw width into 1224 carrier frrequencies off 200 kHz each. Each freqquency is thhen divided using u a TDM MA scheme into i eight tim meslots. Thee use of seeparate timeeslots for trransmission and recep ption simplif ifies the ellectronics in the mobile units. Todaay, GSM



systems ooperate in thee 900MHz andd 1.8 GHz bannds throughoout the worldd with the exxception of the t Americass where they operate o in the 1.9 GHz band d

2.3 Gen neration orr 2G+ Wireeless Networrk The virtuual explosion of Internet usage u has had d a tremendoous Impact on the demannd for advancced wireless data communnication servicces. The mobbile technologgy using geeneral packett radio serviice (GPRS) standard has been termedd as 2.5G. 2.5 5G systems enhance the data capacityy of GSM and a mitigate some of its limitations l thhe effective daata rate of 2G circuit-sw witched wirelless systems is relativelyy slow -- too slow s for todayy's Internet. As a result, GSM, PDC andd other TDMA-based mobbile system pproviders and carriers have developed 2G G+ technologgy that is paccket-based annd increases the t data com mmunication speeds to as high h as 384kbp ps. These 2G G+ systems are based onn the followiing technologgies: High Sp peed Circuit--Switched Da ata (HSCSD D), General Packet Radio R Serviice (GPRS) and Enhancced Data Raates for Glob bal Evolutioon (EDGE) technologies. HSCSD is one step toowards 3G wideband w mobbile data netw works. This circuit-switchhed technoloogy improvess the data rates up too 57.6kbps by introduciing 14.4 kbbps data cooding and by aggregatiing 4 radio channels tim meslots of 14 4.4 kbps.GPR RS adds paccket-switched capabilities to

exxisting GSM and TDMA networks. Woorking on thhe basis of em mails, it sendss text and grapphics-rich daata as pack kets at very fast speedd. EDGE teechnology is a standard thaat has been sppecified to ennhance the throughput t p per timeslot for both H HSCSD and GPRS. Althhough GPR RS is an exxtension to thhe radio access network, iit requires w whole new paccket based IP data links, serrvers, and gaateways in thhe core netwoork. Thus GP PRS adds seeveral new components c besides channging the exxisting GSM or o TDMA netw work

FIIGURE IV: SIIEMENS S577 2.5G PRS PHONE

G NETW WORK [9] FIGURE V: GPRS S The MS M includes radio r equipmeent Mobile Station: and the Man Machiine Interface (MMI) thatt a o to acceess the servicces subscribee needs in order providedd by the GSM.. The MS is a combination of terminal equipmentt (called ME (Mobbile Equipmeent)) and sub bscriber dataa (stored in a

seeparate module called SIM M (Subscribeer Identity M Module)). Base Transceiiver System (BTS): Thee physical mission interfface between ssubscriber annd radio transm station and the BSC are prov vided by the BTS. The raadio equipmennt’s that are reequired to serrvice each



cell in the network are components of the BTS. Cells are the logical divisions in the Radio transmission coverage. BTS controls each cell in a network, and in turn, one BSC controls a group of BTSs. It takes care of Air interface signalling, Air interface ciphering and speech processing. Base Station Controller (BSC): The management of several Base Transceiver Stations (BTS) is done by the BSC. It also provides all the control functions and physical links among the different BTS and between the switching center (SC) and the BTS’s. Being a high-capacity switch, it provides functions such as cell configuration data, and control of radio frequency power levels in BTS. One SC serves a number of BSCs Base Station Subsystem (BSS): BSS is the point where all radio transmission related functions are performed. The BSS is composed of the BSC and the BTS. Home Location Register (HLR): All the administrative information related to each subscriber registered in the respective communication network, including the current location of the subscriber, is contained in the HLR Visitor Location Register (VLR): The VLR is a database containing all the temporary information about the subscribers. This information is needed by the MSC to service the visiting subscribers. Equipment Identity Register (EIR): The EIR is a database containing a list of all the valid mobile subscriber stations on the network. 2.3 Third Generation The third generation mobile technology based on wide band wireless network fulfilling the International Mobile Telecommunications-2000 (IMT-2000) specifications by the International Telecommunication Union. As per the IMT-2000 standards, a system is required to provide peak data rates of at least 200 Kbit/s. 3G functions in the range of 2100 Hz and bandwidth 15-20 MHz The communication provides enhanced clarity and perfection like the real conversation. Recent 3G releases provide mobile broadband access of several M bit/s to smart phones and mobile modems in laptop computers. The first release of (Third Generation Partnership Project) 3GPP Long Term Evolution (LTE) standard completely fulfil the (International Telecommunications Union) ITU 4G requirements called the IMT-Advanced. 4G or 3.9G technology is the first release LTE. Its evolution LTE Advanced is a 4G technology. 3G offers a vertically- integrated, top-down, service-provider approach to delivering wireless Internet access. 3G is a technology for mobile service providers. Mobile services are provided by service providers that own and operate their own

wireless networks and sell mobile services to endusers, usually on a monthly subscription basis. Mobile service providers use licensed spectrum to provide wireless telephone coverage over some relatively large contiguous geographic serving area. Historically, this might have included a metropolitan area. Today it may include the entire country. From a user’s perspective, the key feature of mobile service is that it offers (near) ubiquitous and continuous coverage that is, a consumer can carry on a telephone conversation while driving along a highway at 100Km/hour. To support this service, mobile operators maintain a network of interconnected and overlapping mobile base stations that hand-off customers as those customers move among adjacent cells. Each mobile base station may support users up to several kilometres away. The cell towers are connected to each other by a backhaul network that also provides interconnection to the wire line Public Switched Telecommunications Network (PSTN) and other services. The mobile system operator owns the end-to-end network from the base stations to the backhaul network to the point of interconnection to the PSTN (and, perhaps, parts thereof). These can support data rates of from 384Kbps up to 2Mbps, although most commercial deployments are expected to offer data rates closer to 100Kbps in practice. While this is substantially below the rates supported by the current generation of wire line broadband access services such as DSL or cable modems, it is expected that future upgrades to the3G or the transition to 4G mobile services will offer substantially higher bandwidths. Although wire line systems are likely to always exceed the capacity of wireless ones, it remains unclear precisely how much bandwidth will be demanded by the typical consumer and whether 3G services will offer enough to meet the needs of most consumers. Auctions for 3G spectrum licenses occurred in a number of countries in 2000 and the first commercial offerings of 3G services began in Japan in October 2001. More recently, Verizon Wireless has announced "3G" service in portions of its serving territory (though this is not true-3G service). 3G offers much narrower bandwidth but over a wider calling area and with more support for rapid movement between base stations. The IMT-2000 framework sets the following goals for the so called 3G wireless systems:  Global standards to allow for low cost and worldwide roaming.  High Quality of Service (QoS) especially for voice.  Support for advanced services: Multimedia, Bandwidth on Demand, High speed data.



 Flexibiility for evoluution allowinng for backwaard compaatibility and too cope with anny future markket disconttinuity.  Multi-eenvironment capabilities. c  Compaatibility of serrvices with fixxed networks.  In building/Private Systems S Integration.

FIGURE E VII: 3G TEC CHNOLOGY The folllowing is a brief description of eaach protocool layer in a 3G wirreless netwo ork infrastrructure:  Globall Mobility Managem ment (GMM M): protocool that includdes attach, detach, d securiity, and rouuting area upddate functionaality.  Node B Application Part (NB BAP): providdes proceddures for pagging distribuution, broadcast of system m informatioon and management m dedicatted and logicaal resources  Radio Link Controol (RLC): proovides a logiccal link coontrol over thee radio interfacce.  Mediu um Access Control C (MAC C): controls the t access signaling (reequest and grrant) procedurres for the radio channel.  Radio resource Coontrol (RRC C): manages the t allocattion and maintenancee of raddio commuunication path hs.  Radio Access Netw work Appliccation Protoccol (RANA AP): encapsuulates higher layer signalin ng. Managges the signaaling and GT TP connectioons betweeen RNC and 3G-SGSN, 3 annd signaling and a circuit--switched connnections betw ween RNC and a 3G MS SC.  Radioo Network Service Application Paart (RNSA AP): providess the communnication betweeen RNCs.  GPRS Tunnel Prootocol (GTP)): protocol thhat tunnelss the protoco ol data units through the IP backboone by addin ng routing infformation. GT TP operatees on top of TCP/UDP overr IP.  Mobilee Applicatio on Part (M MAP): suppoorts signaling between SGSN N/GGSN and a AuC/EIR. HLR/A  AAL2 Signaling (Q Q.2630.1, Q.21150.1, Q.21500.2, AAL2 SSSAR, and AAL2 CPS):: protocols suuite used too transfer voicce over ATM backbone usiing ATM aadaptation layyer 2.

 Sigtran (SCT TP, M3UA): protocols suitte used to transfer SCN N signaling prootocols over IP P network

FIIGURE VIII: 3G NETWOR RKS [8]

2.4 F Fourth Generation: 4G G (or 4-G) is short for fourth-generaation cell phhones or/and hand held deevices. It is a wireless acccess technoloogy. It will be the successsor of 3G. Cuurrently we are a undergoin ng a transitionn between 2G G and 3G which w is also o known as 2.5G. 2 4G m mobile commu unications will w have trannsmission raates up to 200 Mbps higher than of 3G G. When It is still to esstimate as to how many number n of peoople have m moved on from m 2G to 3G , teechnology hass come up w the latest of its type namely with n 4G.A successor off 2G and 3G, 4G promisess a downloadding speed off 100Mbps. Then with the case oof Fourth G Generation thaat is 4G in addition a to thhat of the seervices of 3G G some additional featuress such as M Multi-Media N Newspapers, also to waatch T.V prrograms with the clarity ass to that of ann ordinary T.V. In additio on, we can send s Data muuch faster thhan that of the previous generations. 2 provides WAP and allso access Currently 2.5G too the internet from a mobiile phone, butt the data raate is a big ressistance to thee developmentt of better feeatures. We will w definitely see s very high data rates inn 4G phones. 802.15, commonly c k known as Bluetooth is veery popular thhese days. Currrently the coonnectivity beetween wired and wireless devices is biit painful as thhe vendors aree reluctant in providing a bridge betweeen both the teechnologies. B But I think uld definitely y see a changge in this inn 4G we wou atttitude as it wiill be very eassy to transfer huge files orr other data frrom a PC to wireless w devicces. Email m messages, coontacts, rem mainders, etc e will syynchronize in no time and thus t giving moore power too the users. It is easy to t say, basedd on the deeveloping trennds of mobile communicaation, that 4G G will have broader b bandw width, higher data rate,



smootherr and quickerr handoff, widder mobile areea, more varrious service, lower l cost, etcc.

FIGURE E IX: 4G FRAM MEWORK NETWORK[3] N ] User Divversity: The ex xternal diverssity of users, i.e. i people inn different situuations, includes e.g. cultuure, educationnal backgrouund, econom mic capabiliity, physical property, peersonal preferrence, etc. The T internal ddiversity of ussers, i.e. peoplle with differeent

innterfaces, incllude e.g. vission, hearingg, speech, toouch sense, haands and fingeers, body, etc. Terminal Diversity an nd Adaptabillity: The teerminals’ exterrnal diversitiees are the diffeerences of teerminals in botth static and mobile m attribuutes. Static atttributes incluude e.g. functtionality, weiight, size, baattery life, hu uman interfacce, antenna, processing p caapability, seccurity, style, and cost.. Mobile atttributes incllude dynamic attributes of both teemporal and sp patial featuress. Network Diversity D an nd Adaptabillity: The exxternal diversity of networrks is obviouss. Internet is assorted by nature, n while wireless w netw works keep thhe same propeerty. For instaance air interrfaces can inntegrate all kinds k of staandards and work on diifferent frequeencies. Moreo over, multiple operators deeploy networrks with muultiple standdards and prrotocols. The internal diverrsity of networrks means thhat one netw work can intterconnect with w other diifferent netwoorks and trannsfer various kinds of looads, e.g. celluular systems with w various cooverage.

3. C Comparison n Between 1G, 2G, 3G AND 4G G Here Table I. summarises H s thhe comparisonn between 1G G, 2G, 3G andd 4G.



TABLE II: COMPARISON OF 1G, 2G, 3G AND D 4G[3]

Conclu usion The last few years hav ve witnessed the phenomennal growth of wireless generations. There is evver increasinng demands off the cellular networks whiich motivatedd the research hers and indusstrialists to com me up witth fourth generation (4G) mobbile communiication and further more m with 5G 5 technologgy.. As the t historyy of mobbile communiications show ws, many attem mpts have beeen made to reduce a nuumber of Tecchnologies too a d. The first generation g (1G) single gllobal standard has fulfillled the basicc mobile voicce using anallog techniquees, while the second geneeration (2G) has h introduceed capacity and coveragee using digiital techniquees. This is followed by the third generatiion (3G), whhich has questt for data at higher h speeds to open thee gates for truly “mobbile broadban nd” experiencce, which will be further realized by the t fourth generation (4G G). 4G will provide betterT than-TV quality imaages and viideo-links. The communiications modeel has new devveloped

TML, Java, GIF, G HTTP, and a many veersions of HT more. New stan m ndards will neeed to be deveeloped for usse in 4G. 5G technology has channged the meaans to use ceell phones witthin very high bandwidth. User U never exxperienced ever e before such a higgh value teechnology. No owadays mobbile users haave much aw wareness of the t cell phonee (mobile) technology. Thhe 5G techno ologies includ de all type of advanced feeatures whicch makes 5G 5 technology most poowerful and in huge dem mand in near future.5G A Although updatted standards that define caapabilities beeyond those defined d in thee current 4G standards arre under consiideration, those new capabbilities are still being grou uped under thee current 4G standards. s N mobile geenerations are typically assiigned new New frequency band ds and wider spectral banddwidth per frequency chan nnel (1G up too 30 kHz, 2G up to 200 kH Hz, 3G up to 5 MHz, and 4G 4 up to 40 MHz), M but



the main issue that there is little room for new frequency bands or larger channel bandwidths.

References [1] F. Williams, Ericsson, “Fourth generation mobile,” in ACTS Mobile Summit99, Sorrento, Italy, June 1999. [2] H. Huomo, Nokia, “Fourth generation mobile,” in ACTS Mobile Summit99, Sorrento, Italy, June 1999. [3] Jun-Zhao Sun, Jaakko Sauvola, and Douglas Howie, “Features in Future: 4G Visions From a Technical Perspective,”in IEEE, 2001. [4] Mishra, Ajay K. “Fundamentals of Cellular Network Planning and Optimization, 2G/2.5G/3G…Evolution of 4G”, John Wiley and Sons, 2004. [5] Pereira, Vasco & Sousa, Tiago. “Evolution of Mobile Communications: from 1G to 4G”,

Department of Informatics Engineering of the University of Coimbra, Portugal 2004. [6] Kamarularifin Abd Jalil, Mohd Hanafi Abd. Latif, Mohamad Noorman Masrek, “Looking Into The 4G Features”, MASAUM Journal of Basic and Applied Sciences Vol.1, No. 2 September 2009. [7] Amit Kumar, Dr. Yunfei Liu ,Dr. Jyotsna Sengupta, Divya, “Evolution of Mobile Wireless Communication Networks 1G to 4G”, International Journal of Electronics & Communication Technology, IJECT Vol. 1, Issue 1, Dece- mber 2010. [8] Mobile Technology: Evolution from 1G to 4G, Electronics for You, June 2003. [9] Third Generation (3G) Wireless White Paper, Trillium Digital Systems, Inc. March 2000. [10] Nabeel ur Rehman, Asad Asif,Junaid Iqbal, “3G Mobile Communication Networks”,in Explore Summer 2006.



A Novel Application for Android Based Handheld Devices Somya, Student, Information Technology, RKGITW, Ghaziabad, India Reetika Joshi, Student, Information Technology, RKGITW, Ghaziabad, India Shaffali Aggarwal, Student, Information Technology, RKGITW, Ghaziabad, India

ABSTRACT In modern era when populations increasing exponentially, chances of colliding to uneven situations are also increasing. In such situation we have to take some decision and human intelligence is the key of finding out the solutions and creating a socio technical environment to find out the solutions in easy steps. The motive of the solution methods should observe, analyze and prevent such hazardous and critical occurrences. The proposed work provides an android mobile application which provides help to a victim to recover from such critical situation by getting frequent help on time. Keywords: Voice Recognition, Patterns, Artificial Intelligence, Criticpal, Machine Learning, NLP.

1.Introduction As we all know that crime rate is increasing day by day. Every minute something wrong is happening in the world such as accidents, sudden attacks, theft, rape etc. but these all crimes have one thing in common that it takes so much time to get cured, as police comes 1 hour after when incident took place.Then after 30 to 40 minutes ambulance used to come. While all these happening, victim or injured person or people sometimes died. In any conventional way of providing the help on time to people in their hard times, we provide that help by utilizing resources available around us as soon as possible, it is needed for them to have helping hand around them in such critical situations. But in such cases the most important issue arises is help reaches to a victim very late. It may be either useful or just all in vain. Suppose someone face snatching in a lone area of the city. He wants help as soon as possible. Either he calls police to complain for the accident happened to him or he calls his kith n kins for help. But all of them need to know the exact location of the victim to rescue him. A lot of problem still remains as prior situations. So dealing with such cases for a victim is a very crucial matter. Human intelligence is the key of solutions, in a way of finding the solution we act rationally with those situations we face. Then make decisions to get maximum output. Our experiences become knowledge, knowledge gives intelligence. A good solution shows how intelligent you are. Human being have certain limitations like tiredness, will power, laziness, low calculation powers, uneven commonsense and many more. So there is always a need of robust systems.

2. Need Of Artificial Intelligence Some time ago there was the evolution in microchips and integrated circuits, the evolution process really followed the moor’s law and

contracted to fast. The resultants are too small size of chips. Then the evolution done with the storages, storages become very small in size with high capacity of storing data. In the next generation the communication system become faster the data rate become faster, we can connect anywhere and anytime to anyone in the world through internet with its speed. The previous evolutions have their significant role to make things possible in this way. Processors become faster. The forthcoming generation will be all about machine and its intelligence. To making a system such a powerful that it can imitate the human being. Artificial Intelligence is an answer. Artificial Intelligence is a branch of Science which deals with helping machines find solutions to complex problems in a more human-like fashion [2]. This generally involves borrowing characteristics from human intelligence, and applying them as algorithms in a computer friendly way. A more or less flexible or efficient approach can be taken depending on the requirements established, which influences how artificial the intelligent behavior appears. Unlike humans, computers have trouble understanding specific situations, and adapting to new situations. Artificial Intelligence aims to improve machine behavior in tackling such complex tasks. Humans have an interesting approach to problem-solving, based on abstract thought, high-level deliberative reasoning and pattern recognition. Artificial Intelligence can help us understand this process by recreating it, then potentially enabling us to enhance it beyond our current capabilities. There are many subfields of Artificial Intelligence but we can focus here some of them closely related to our work.  Pattern recognition  Natural Language Processing  Machine learning  Knowledge and Representation etc.



As we know that AI is a very vast field to be dealt. It consists of various other verticals and further those verticals are also not limited to a specific area. Given basic elements of Artificial Intelligence has used here to create a gross view of the application development. As Voice Recognition system is the key factor, which we are using in our proposed work, is an application of Pattern Recognition.

2.1

Voice Recognition

Voice recognition is the process of taking the spoken word as an input to a computer program. This process is important to virtual reality because it provides a fairly natural and intuitive way of controlling the simulation while allowing the user's hands to remain free. Voice recognition is "the technology by which sounds, words or phrases spoken by humans are converted into electrical signals, and these signals are transformed into coding patterns to which meaning has been assigned". While the concept could more generally be called "sound recognition", we focus here on the human voice because we most often and most naturally use our voices to communicate our ideas to others in our immediate surroundings. The difficulty in using voice as an input to a computer simulation lies in the fundamental differences between human speech and the more traditional forms of computer input. While computer programs are commonly designed to produce a precise and well-defined response upon receiving the proper (and equally precise) input, the human voice and spoken words are anything but precise [3]. Each human voice is different, and identical words can have different meanings if spoken with different inflections or in different contexts. Several approaches have been tried, with varying degrees of success, to overcome these difficulties.

2.1.1 Approaches to Voice Recognition The most common approaches to voice recognition can be divided into two classes: "template matching" and "feature analysis". Template matching is the simplest technique and has the highest accuracy when used properly, but it also suffers from the most limitations. A more general form of voice recognition is available through feature analysis and this technique usually leads to "speaker-independent" voice recognition. Instead of trying to find an exact or near-exact match between the actual voice input and a previously stored voice template, this method first processes the voice input using "Fourier transforms" or "linear predictive coding (LPC)", then attempts to find characteristic similarities between the expected inputs and the actual

digitized voice input. These similarities will be present for a wide range of speakers, and so the system need not be trained by each new user. The types of speech differences that the speakerindependent method can deal with, but which pattern matching would fail to handle, include accents, and varying speed of delivery, pitch, volume, and inflection. Speaker-independent speech recognition has proven to be very difficult, with some of the greatest hurdles being the variety of accents and inflections used by speakers of different nationalities. Recognition accuracy for speaker-independent systems is somewhat less than for speaker-dependent systems, usually between 90 and 95 percent. Voice Recognition alternatively called Speech recognition. It implies various algorithms for its various applications. It is the basic need of our proposed work.

3.Proposed Work The project aims at providing the help or immediate service to the people who unfortunately falls into the critical situations such as fatal accidents, sudden attack or theft. This application helps the people through their mobile phones by remaining in the running state in their phones. Whenever this application hears the cry of the user, it rushly sends text messages of user’s current GPS location to the already registered numbers and not only message, it also make calls on those numbers one by one. So that the happening fatal situation can be cured or we can stop the things becoming worst. It is an application based on android and voice recognition system which treats you in your bad times. This bad time could be anything such as accident, any attack while going on the road, theft, robbery etc. One has to just register it his mobile phone. And it starts working from the minute user installs it. Currently there is no such system which can provide immediate help like this. Or we can say that the manual way is the existing system. Manual way means calling police and relatives of the victim, hours after the incident happened.



Fig.1. Ovverview of Working W

Fig. 2 Work Flow of o The System m

3.1 Advvantages off the system m This appllication providdes better scoope to reduce the t crime ratte upto some extent. e It incluudes: [1] First-Aid: Thhis application serve user by providingg immediate help h wheneverr required. [2] Quick n Easyy: Not so mucch to do for thhis help, onlly to PRESS A BUTTON N and your GP PS location will be sent to your friendds and relativ ves mobile phhone. Reliable: on [3] ne can rely on this applicatiion as no inteernet connectiion is requiredd. [4] User Friend dly Interfacce: User can c update hiis informationn, which is reegistered on thhis applicatioon, whenever he wants.

inn the world such as accidents, suddenn attacks, thheft, rape etc. but these all crimes have one thing inn common thaat it takes so much m time to get g cured, ass police comees 1 hour afteer when inciident took pllace. Then aftter 30 to 40 min m ambulancce used to coome. While alll these happeening, victim or injured peerson or peop ple sometimees died. Criticc-pal is a soolution to this problem up to t some extennts. Criticpaal is an appllication whichh would be your real friend in your critical situattions. We jusst have to prress a button and we get immediate i hellp. Criticpaal immediatelly send the usser’s current loocation to thhe registered phone p numbeers and also make m calls onn those numbeers one after another. a

5..References As it iss an androidd application so it will be applicablle in android phones p only. User shouuld have his phone p in hands, as he needss to press buttton to make use u of this appplication.

4.Futurre Works And A Conclu usion As we all know that crrime rate is inncreasing day by day. Eveery minute something wronng is happeniing

[11] Cheng O, O Abdulla W, and Salcic S Z. “H Hardware–Sofftware Codeesign of Automatic A Sppeech Recognnition System m for Embeddded RealTiime Applicaations”, IEE EE Transacttions on Inndustrial Electtronics, Volum me: 58. (2002) [22] Stuart R, Peter N, Arttificial Intelliigence: A M Modern Approa ach (2nd Editiion) (2011) [33] Liu X, Zh hao Y, Liangg L. and Neffian A.V. "A Audio-visual continuous c sppeech recognittion using

www.bo orjournals.co om Blue Ocean Research JJournals 66


a coupled hidden Markov model", in Proc. INTERSPEECH. (2002) [4] Marschark M, LePoutre, D, and Bement L.; “Mouth movement and signed communication,” In Campbell R., Dodd B, and Burnham D. (Eds.), Hearing by Eye II. Hove, United Kingdom: Psychology Press Ltd. Publishers, pp. 245–266. (1998) [5] Lynn W, Francine C, Kimber D, and Balasubmnianzan V. “Segmentation of speech using speaker identification”, ICASSP-94,11611164. (2003) [6] Zhou P, An exploration of Voice-over-IP using Ruby. In Proceedings of the Workshop on Optimal Epistemologies. (1964) [7] Cawsey A, The Essence of Artificial Intelligence Prentice Hall ISBN: 0135717795 (1998)

[8] Lewis, T. W. and D. M. W. Powers., “AudioVisual Speech Recognition using Red Exclusion and Neural Networks,” Journal of Research and Practice In Information Technology, Vol. 35(1). (2003) [9] The NIST Speaker Recognition Evaluation Plan: http://www.nist.gov/speech/tests/spk/2006/sre06_e valplan-v9.pdf (2006) [10] Poli G, Levada A, Mari J. And Saito J. H. “Voice Command Recognition with Dynamic Time Warping (DTW) using Graphics Processing Units (GPU) with Compute Unified Device Architecture (CUDA)”, 19th International Symposium on Computer Architecture and High Performance Computing, 19-25. (2007)



Dual Watermarking For High Protective Copyright System Sagar R Dhole, Student,Computer Department,Sinhgad Institute of Technology,Lonavala Rahul S.Shahane, Student,Computer Department,Sinhgad Institute of Technology,Lonavala KrishnaV.Varat, Student,Computer Department,Sinhgad Institute of Technology,Lonavala Ganesh N.Falake, Student,Computer Department,Sinhgad Institute of Technology,Lonavala

ABSTRACT Dual Watermarking is used forcopyright protection and authentication. In theproposed system, a Dual Watermarking Schemebased on BPCS and Alpha Channel maskingalgorithm, will be developed to improve therobustness and protection along with security.Our project implemented the BPCS (Bit Plane Complexity Segmentation) technique to embed data into bitmap files. The ultimate goal is to embed as much data as possible into a cover image without detection by human perception or statistical analysis. Our first attempt to implement this hiding technique was on 8-bit grayscale images as our cover object. After accomplishing that version, we manipulated it into a second version that was also capable of using 24-bit color images.First outline the BPCS embedding and extraction technique for grayscale images and explain the subtle differences in the color version. It will also compare and contrast the results of embedding data at different thresholds and capacities for both grayscale and color images. KeyWords: Dwt,watermarking,bpcs,alpha channel masking

Introduction “A digital watermark is a digital signal or pattern inserted into a digital document such as text, graphics or multimedia, and carries information unique to the copyright owner, the creator of the document or the authorized consumer[1].” Digital Watermarking is used for copyright protection and authentication. In the proposed system, a Dual Watermarking Scheme based on BPCS Algorithm and Alpha Channel /Transparency Channel Masking Algorithm will be developed to improve the robustness and protection along with security[2]. Two watermarks will be embedded in the host image. The secondary is embedded into primary watermark and the resultant watermarked image can then be transmitted over a non secure channel. This provides an efficient and secure way for image security and transmission. The watermarked image is decrypted and a reliable watermark extraction scheme can be developed for the extraction of the primary as well as secondary watermark from the image.

Existing System Digital watermarking is a technique which allows an individual to add hidden copyright notices or other verification messages to digital audio, video, or image signals and documents. Such hidden message is a group of bits describing information pertaining to the signal or to the author of the signal (name, place, etc.). The technique takes its name from watermarking of paper or money as a

security measure. Digital watermarking is not a form of steganography, in which data is hidden in the message without the end user's knowledge, although somewatermarking techniques have the steganographic feature of not being perceivable by the human eye[1][6]. The enormous popularity of the World Wide Web in the early 1990's demonstrated the commercial potential of offering multimedia resources through the digital networks. Since commercial interests seek to use the digital networks to offer digital media for profit, they have a strong interest in protecting their ownership rights. Digital watermarking has been proposed as one way to accomplish this.

Proposed system A digital watermark is a digital signature or pattern inserted into digital image. Since the signal or pattern is present in each unaltered copy of original image, the digital watermark may also serve as a digital signature for the copies. A given watermark may be unique to each copy (e.g, to identify the intended recipients), or be common to multiple copies. In either case, the watermarking of the document involves the transformation of the original into another form. This distinguishes digital watermarking from digital fingerprinting where the original file remains intact, but another file is created that "describes" the original file's content. where the original file remains intact, but another file is created that "describes" the original file's content.



C. Primary Enccryption Usingg BPCS D Alpha Channnel Masking D. E. Watermark Verification V A Image Bit Plane A. P Decomp position 1)) The carrier image i is dividded into 8 diffferent BitPllanes. All thee bit-planes are a divided into small piieces of the same s size, wh hich is called bit-plane bllocks, such as 8 × 8[2]. 2)) Calculate thhe complexityy of every bllock. The coomplexity is defined as the t amount of o all the addjacent pixels that get diffe ferent values ( onepixel is 0, and the other o is 1. The T maximum m possible mplexity is deenoted as maxx C . vaalue of the com 3)) Setting the complexity c thrreshold of thee bit-plane bllock is max C, here α is a parameter. Thee bit-plane bllock whose complexity c is larger than max m C is ussed to embed secret inform mation. The sm maller the vaalue of the more secrett informationn can be em mbedded[2].

Fig.1 Systeem Flow Diaggram 1) Primaary Waterma ark Primary watermark shall contain the author and a on of the image. Thhis copyrighht informatio mbedded on orriginal image so informatiion will be em that an image shall always carryy its copyrigght W shall achhieve this usiing informatiion with it. We BPCS Steganography[[4].

ndary Waterm mark 2) Secon

4)) Secret info ormation is formed into bit-plane bllocks. The bit-plane block can c replace thhe original onne straightly if i its complexxity is greater than max C. Yet, it need d to take conjjugate processsing with thhe checkerbooard pattern block(as sshown in Fiigure1) if the complexity is i less than orr equal to m C, than tak max ke the new blo ock replace thhe original onne. 5)) Make a recorrd of the block ks that have taaken coonjugate proceessing and this information also neeed to be embedded into thee carrier. The em mbedding of thhis extra inforrmation cannoot prroduce effect on o the embedd ded secrets, annd it must bee correctly piccked up.The process p of secrret innformation exttraction is sim mple. Firstly, pick p up all thhe pieces of th he carrier data whose compllexity is grreater than maax C, and thenn pick up the extra e em mbedded inforrmation mentiioned in step (5) ( to coonfirm the bloocks that have taken conjugaate prrocessing. Theese blocks neeed take XOR operation o w tessellated with d chock to get the recovery of secret.

We will use intermeediate image data (grayscaale componeent of the inteermediate imaage) itself as the t data to be watermaarked on thhe intermediaate w help us deetermine if theere image[1]. This data will is any modification orr damage donee to the originnal image annd also reconnstruct the orriginal image to some exttent. We shall do this usingg Alpha Channnel / Transpaarency Channeel masking.

Modulees A. Imagee Bit Plane Deecomposition B. TGA IImage Generaation (BMP, P PNG to TGA)

www.bo orjournals.co om Blue Occean Researcch Journals 69


baackground-collor only pixeels, and the group of fooreground-bacckground blen nded color piixels. The bllending factorrs for the pixeels in the last group are m modified to em mbed each bit b of a wateermarking paattern. Becausse the modifieed pixels beloong to the arrea around an n image edge, change to thhe original im mage due to o watermarkk embeddingg is less peerceptible. E.VERIFICAT TION We can verify the watermarkk using this module. W m In thhis module we w can veriffy the attackk of any annonymous useer if he/she dam mage the origginal data We can see thee modification W n also and wee claim on thhe unauthorizeed user for dam maging the daata.

Experimentaal Results An nd Analysis

We are cconverting thee image into TGA T format for f the betteer security because b TGA A image cannnot modify eeasily and th he image is of o 32 bit so it contains alpha channeel also so we are convert the t image intto TGA formaat.

Thhe length off the black-aand-white borrder in a biinary image is a good measure foor image coomplexity. Iff the border is long, the image is coomplex, otherw wise it is sim mple. The totall length of thhe black-andd-white border equals to the suummation of the number of o color-changes along thhe rows and co olumns in an image. For example, a sinngle black pixxel surrounded by white baackground piixels has the boarder b length h of 4. W will define the image com We mplexity αby the foollowing.

C. Primaary Encryptioon Using Bpccs

α= =

Fiig.2 Image Bitt Plane Decom mposition B. TGA A Image Generation (BM MP, PNG TO T TGA)

The BPC CS steganograaphy providess a high hidiing capacity because the more m significaant bit planes are a p a low wer used to hhide the messsage. It also provides perceptibbility of thee hidden message m in the t stegoimaage, because only sufficiently compllex blocks aare replacedd by secret message, and a generallyy, these bloocks have a lower visuual sensibilitty for Human Visual System S (HVS). Howeverr, although thee BPCS stegannography show ws excellentt properties, reegarding hidinng capacity and a impercepptibility, it can c be vulnnerable to the t extractionn of the hiddeen message, due d to its spattial domain ddata hiding reaalization. D. Alphaa Channel Masking A method for embedd ding a digital watermark onnto a host im mage’s alpha chhannel is desccribed. Blendiing factors w which form an a alpha channnel define the t proportioon of foregroound and bacckground coloors which inn turn are com mbined to ressult in an actu ual color forr each pixel. Here, the blending b facto ors corresponnding to areaas along edgges in the hoost image is of interest. The host imagee is first divid ded mages[7]. A dominant ed dge into bloccks of subim found in any subimage is used to divide d the pixels on that block into three groups:the group of o pixels, the group of foregrounnd- color only

k The max. possible B W chaanges in the imaage… (1)

Where, k is the total length of W o black-and-w white boorder in the im mage. So, the value v ranges over o 0 ≤α≤1. … (2) g i.e., αis α calculated over the (11) is defined globally, whole image arrea. It gives uss the global coomplexity w off a binary imaage. H However, we caan also use αffor a local imaage coomplexity (e.g g., an 8 ×8 pix xel-size area).. We will usse such αas ouur local coomplexity meaasure in this paper[2]. p Overall, the results wentt fairly as expected. O Inncreasing the threshold att which bit planesare deetermined to be b complex deecreased the em mbedding caapacity, butt also deccreased theddistortion. Em mbedding att full capacity (based upon u the thhreshold) of the t image inccludingevery bit plane prroved to add distortion d (althhough typicallly worse at lowerr thresholds)b w because the hhigher bit pllanes are visuaally much lesss tolerant to chhange.

www.bo orjournals.co om Blue Occean Researcch Journals 70


An interesting observation is that grayscale images had a slight advantage over the colorimages in the sense that only grayscale values could be changed as opposed to acombination of values for each color plane. When pushed to higher limits, the grayscaleimages could look altered compared to the original, but still appear unaltered without comparison to the original. In color images, when pushing the limits of threshold andcapacity, noticeable color distortions occurred that clearly indicated some kind of changeto the original image.

Conclusion This paper deals with dual watermarking scheme, which includes encryption, to improve rightful ownership, protection and robustness. First generation of copyright marking schemes is not strong enough. Existing schemes provide only limited measures of marking.Can only meet few requirements at a time. For the extraction of watermark, a reliable watermark decryption scheme and an extraction scheme is constructed for both primary and secondary watermark. Robustness of this method is carried out by variety of attacks.

References [1] Dual Watermarking Scheme with Encryption Proceedings of the Int. Conf. on Information Science and Applications ICISA 2010 Chennai, India. 6 February 2010. [2] Wu J, Zhang R eta. Reliable Detection of BPCS Steganography[J].Journal of Beijing University of Posts and Telecommunications, 2009, 32(4): 113121 [3] Mussarat Abdullah,and Fazal Wahab “Key Based Text Watermarking of E-Text Documents in an object based Environment using Z-axis for Watermark Embedding”,world academy of engg and technology 46,2008 [4] Cl.Song, S.Sudirman and M.Merabti, “A Spatial and Frequency Domain Analysis of the Effect of Removal Attacks on Digital Image Watermarks”, Proc 11th of PostGraduate Network Symposium, 119-124, June, 2010. [5] Mohamed Saehab,ElisaBertino,ArifGhafoor “Watermarking Relational Databases Using Optimization-Based Techniques” 2011 [6] Copyright Protection of Online Application using Watermarking,march 2011 [7] “Alpha Channel Digital Image Watermarking Method.”NataponPantuwong and NoppornChotikakamthornICSP2008 Proceedings.



To Identify Disease Treatment Relationship in Short Text Using Machine Learning & Natural Language Processing Khan Razik, Student, Computer Department, Sinhgad Institute of Technology, Lonavala Dhande Mayur, Student, Computer Department, Sinhgad Institute of Technology, Lonavala Patil Aniket, Student, Computer Department, Sinhgad Institute of Technology, Lonavala Gaikwad Namrata, Student, Computer Department, Sinhgad Institute of Technology, Lonavala

ABSTRACT Due to advancements in medical domain automatic learning has gained popularity in the fields of medical decision support, extraction of medical knowledge and complete health management. Using Machine Learning(hereafter, ML) and Natural language Processing(hereafter, NLP) we can make the healthcare field more efficient and reliable. This paper describes how ML and NLP can be used for extracting knowledge from published medical papers. It extracts the sentences that mention diseases and treatments and identifies the relationship between them Kewwords: Automatic Learning, Medical Decision Support, Machine Learning, Natural Language processing, Healthcare.

Introduction People are more concerned about their health than ever before. In spite of their busy schedules they want each and everything to go in a good flow. People want Fast access to reliable information and in a manner that is suitable to their habits and workflow. Medical field has grown to such an extent that the people practicing medicine should not only have experience but also information about latest discoveries. Electronic Health Record(hereafter, EHR) is becoming a standard in healthcare domain. Websites such as Google Health[9] and Microsoft Health Vault[10] make people to care deeply about their health. Having an EHR has the following benefits[11]: 1. Rapid access to information that is focused on certain topics such as immunizations, drugs etc. 2. To have quality medical data for taking proper medical decisions. For this purpose we need a better, more efficient and reliable access to information. According to researches people are searching the web in order to be informed regularly about their health. In medical domain the most used source of information is MEDLINE[12]. MEDLINE is database where all the research discoveries come and enter at a high rate. Due to the busy schedules the experts don't get time to read millions of articles therefore there is a need to build a tool that will suffice the purpose. Our objective is to work with ML and NLP is that the task of identifying and disseminating reliable healthcare information becomes easy and beneficial for the people. A hierarchical approach is used for performing the two tasks: The first is to

identify and eliminate uninformative sentences and then second is to classify the rest of the sentences by the relation of interest. By this a substantial improvement is shown getting the information

2 Related Work Entity recognition for Diseases and Treatments-The most relevant work is done by Rosario and Hearst[2].It uses Hidden Markov Models and maximum entropy models to perform both the task of entity recognition and the relation discrimination. Their representation techniques are based on words in context, part of speech information, phrases, and a medical lexical ontology—Mesh terms[13].The task of relation extraction or relation identification is previously done by (Craven, [3])with a focus on biomedical taks, gene disorder association(Ray and Craven, [4]) and diseases and drugs(Shrinivasan and Rindflesch, [5]). Rule-based approaches It has been widely used for solving relation extraction tasks. The main sources of information used by this technique are either syntactic: part-ofspeech (POS) and syntactic structures; or semantic information in the form of fixed patterns that contain words that trigger a certain relation. The best rule-based systems are the ones that use rules constructed manually or semi automatically— extracted automatically and refined manually. A positive aspect of rule-based systems is the fact that they obtain good precision results, while the recall levels tend to be low. They tend to require more human-expert effort than data-driven methods (though human effort is needed in data-driven methods too, to label the data).



Syntacttic rule-basedd relation exttraction system ms are compplex systems based b on addittional tools ussed to assignn POS tags or o to extract syntactic parrse trees. It iis known thatt in the biom medical literatuure such toolls are not yet at the state-off-the-art level as they are for general English textss, and therefoore their perrformance on sentences is not always the t best(Bunnescu et al. [6]).

annd Side Efffect, becausee these are of most im mportance. Ap pplying task1 first followedd by task2 giives far bettter results th han applying machine leearning directtly to the conntent.This appproach is beetter becau use uninform mative data can be coonsidered as potential p data if i not filtered((task1).

3 Prop posed Apprroach 3.1 Tassk The workk that we preesent in this paper p is focussed on two ttasks: automaatically identiifying sentencces publishedd in medical abstracts (Medline) as containinng or not info formation aboout diseases and a treatmentts, and autom matically identtifying semanntic relations that existt between diseases and a treatmentts, as expressed in these teexts. The secoond task is foocused on thrree semantic R Relations: Cuure, Prevent, and Side Effeect. The prroblems addressed in this paper form the t building blocks of a frramework thatt can be used by healthcarre providers (ee.g., private cllinics, hospitaals, medical ddoctors, etc.), or laypeople who want to be in chargee of their heaalth by readinng the latest life l science published p articcles related too their interessts. The finall product cann be envisioneed as a browsser plug-in or a desk ktop applicattion that will w automaticcally find annd extract thee latest mediccal discoveriies related too disease-treaatment relatioons and preseent them to the t user. The product can be developeed and sold by y companies that t do researrch in Heallthcare Inforrmatics, Nattural Languaage Processinng, and Mach hine Learning,, and companies that develop tools liike Microsoftt Health Vauult. u products thhat Consumeers are looking to buy or use satisfy ttheir needs and gain their t trust and a confidencce. Healthcarre products arre probably the t most sennsitive to th he trust and confidence of consumers. Compannies that want w to sell s informatiion technolo ogy healthcaare frameworrks need to bbuild tools th hat allow them m to extract and a mine auutomatically the wealth of publish hed research. The first task (task 1 or sentennce selectionn) identifies sentences from Medliine a publishedd abstracts thhat talk abouut diseases and treatmentts. The taskk is similar to a scan of sentencess contained inn the abstract of an article in order to present to thee user-only seentences that are a identifiedd as contaiining relevannt informatiion (disease treatment infformation). The T second taask i ) has a deepper (task 2 or relation identification) nd it is focuseed on identifyiing semantic dimension an disease-trreatment relattions in the seentences alreaady selected as a being inforrmative (e.g., task t 1 is appliied first). We focus on thhree relations:: Cure, Preveent,

Fig 1.Architecture Of th he Proposed System S 3..2 Algorithms A U UsedAs classsification allgorithms, wee use a set of six repreesentative m models: decisiion-based mo odels (Decisioon trees), prrobabilistic models m (Naı¨¨ve Bayes (NB) ( and Complement Naı¨ve N Bayees (CNB), which w is addapted for text withh imbalanceed class diistribution), adaptive a learnning (Ada- B Boost), a linnear classifieer (support vector machinne (SVM) w with polynomial kernel), and a classsifier that allways predictss the majorityy class in thee training daata (used as a baseline). We W decided to use these cllassifiers becaause they are representativve for the leearning algorithms in thee literature and a were shhown to work k well on bothh short and loong texts. D Decision trees are a decision-b based models similar to thhe rule-based models that are a used in haandcrafted syystems, and are suitabble for shoort texts. Prrobabilistic models, m especially the ones based on thhe Naı¨ve Bayyes theory, aree the state of the art in teext classificatiion and in alm most any autom matic text cllassification task. t Adaptivve learning algorithms a arre the ones th hat focus on hard-to-learn h concepts, ussually undeerrepresented in the data, a chharacteristic that t appears in i our short texts and im mbalanced daata sets. SV VM-based moodels are accknowledged state-of-th he-art classsification teechniques on text. t All classsifiers are partt of a tool caalled Weka[14 4].(Oana Frunnza et al. [1]). 3..2.1 Bag-of-w words Repressentation Thhe bag-of-w words (BOW W) representtation is coommonly usedd foor text classifiication tasks. It I is a represeentation in w which features are chosen am mong the wordds that are prresent in the training t data. Because we deal with shhort texts wiith an averaage of 20 w words per seentence, the difference d beetween a binary value reepresentation and a a frequency value repreesentation is not large. Inn our case, we w chose a ffrequency vaalue representtation. This haas the advantaage that if

www.bo orjournals.co om Blue Ocean Research JJournals 73


a feature appears more than once in a sentence, this means that it is important and the frequency value representation will capture this—the feature’s value will be greater than that of other features. We keep only the words that appeared at least three times in the training collection, contain at least one alphanumeric character, are not part of an English list of stop words[15] and are longer than three characters. Words that have length of two or one character are not considered as features because of two other reasons: possible incorrect tokenization and problems with very short acronyms in the medical domain that could be highly ambiguous (could be an acronym or an abbreviation of a common word).

macromeasure is not influenced by the majority class, as the micromeasure is. The macromeasure better focuses on the performance the classifier has on the minority classes. The formulas for the evaluation measures are: Accuracy ¼ the total number of correctly classified instances; Recall ¼ the ratio of correctly classified positive instances to the total number of positives. This evaluation measure is known to the medical research community as sensitivity. Precision ¼ the ratio of correctly classified positive instances to the total number of classified as positive. F-measure ¼ the harmonic mean between precision and recall(Oana Frunza et al. [1]).

3.2.2 NLP Representation The second type of representation is based on syntactic information. In order to extract this type of information we used the Stanford pos-tagger[8] tool. The tagger analyzes English sentences and outputs the base forms, part-of-speech tags, chunk tags, and named entity tags. The following preprocessing steps are applied in order to identify the final set of features to be used for classification: removing features that contain only punctuation, removing stop words (using the same list of words as for our BOW representation), and considering valid features only the lemma-based forms. We chose to use lemmas because there are a lot of inflected forms (e.g., plural forms) for the same word and the lemmatized form (the base form of a word) will give us the same base form for all of them.

5 Conclusion

4 Evaluation Measures The most common used evaluation measures in the ML settings are: accuracy, precision, recall, and Fmeasure. All these measures are computed form a confusion matrix (Kohavi and Provost [7]) that contains information about the actual classes, the true classes and the classes predicted by the classifier. The test set on which the models are evaluated contain the true classes and the evaluation tries to identify how many of the true classes were predicted by the model classifier. In the ML settings, special attention needs to be directed to the evaluation measures that are used. For data sets that are highly imbalanced (one class is overrepresented in comparison with another), standard evaluation measures like accuracy are not suitable. Because our data sets are imbalanced, we chose to report in addition to accuracy, the macroaveraged F-measure. We decided to report macro and not microaveraged F-measure because the

This approach is very useful for everyone as it gives information only of the area of interest. The task is divided into two tasks The first task that we tackle in this paper is a task that has applications in information retrieval, information extraction, and text summarization. We identify potential improvements in results when more information is brought in the representation technique for the task of classifying short medical texts. The second task that we address can be viewed as a task that could benefit from solving the first task first. In this study, we have focused on three semantic relations between diseases and treatments. Our work shows that the best results are obtained when the classifier is not overwhelmed by sentences that are not related to the task. This study is related to a particular field but the future scope of the paper lies in the fact that this can be extended to the information on the web. Identifying and classifying medical-related information on the web is a challenge that can bring valuable information to the research community and also to the end user. We also consider as potential future work ways in which the framework’s capabilities can be used in a commercial recommender system and in integration in a new EHR system.

6 Acknowledgement We express our sincere gratitude towards cooperative department who has provided us with valuable assistance and requirements for the development. We hereby take this opportunity to record our sincere thanks and heartily gratitude to our guide Prof. M. Galphade for her useful guidance and making us available her intimate knowledge and experience.



7 References [1] Oana Frunza, Diana Inkpen, and Thomas Tran " A Machine Learning Approach for Identifying Disease-Treatment Relations in Short Texts" vol. 23, 2011. [2] B. Rosario and M.A. Hearst, “Semantic Relations in Bioscience Text,” Proc. 42nd Ann. Meeting on Assoc. for Computational Linguistics, vol. 430, 2004. [3] M. Craven, “Learning to Extract Relations from Medline,” Proc. Assoc. for the Advancement of Artificial Intelligence, 1999. [4] S. Ray and M. Craven, “Representing Sentence Structure in Hidden Markov Models for Information Extraction,” Proc. Int’l Joint Conf. Artificial Intelligence (IJCAI ’01), 2001. [5] P. Srinivasan and T. Rindflesch, “Exploring Text Mining from Medline,” Proc. Am. Medical Informatics Assoc. (AMIA) Symp., 2002. [6] R. Bunescu, R. Mooney, Y. Weiss, B. Scho¨ lkopf, and J. Platt,“Subsequence Kernels for Relation Extraction,” Advances in Neural Information Processing Systems, vol.18, pp. 171-178, 20 [7] R. Kohavi and F. Provost, “Glossary of Terms,” Machine Learning, Editorial for the Special Issue on Applications of

Machine Learning and the Knowledge Discovery Process, vol. 30, pp. 271-274, 1998. [8] http://nlp.stanford.edu/software/tagger.sht ml. [9] Google health report, https://www.google.com/health [10] Microsoft Health Vault, http://healthvault.com [11] Health care tracker, http://healthcaretracker.wordpress.com/ [12] Medline Database, http://www.proquest.com/en US/catalogs/databases/detail/medline_ft.s html [13] Medical Subject Headings, http://www.nlm.nih.gov/mesh/meshhome. html. [14] Weka tool, http://www.cs.waikato.ac.nz/ml/weka/. List of Stop words, http://www.site.uottawa.ca/~diana/csi5180/StopWo rds.



A Review R o Need on d of BI in i an Organizaation Saloni B Bansal, Studen nt, Informationn Technology, RKGITW, Ghaziabad G W, Ghaziabad Soumya Awasthi, Stuudent, Informaation Technoloogy, RKGITW Gupta, Lectureer, Informatioon Technology y, RKGITW, Ghaziabad G Charu G

ABSTR RACT Business intelligence is a broad part of techhnologies whiich includes collecting, sttoring, accesssing, and g better decisions and analyyzing business performancce through analyzingg data to helpp business useers in making data-drivven insight. Th he ability to extract e and prresent informaation in a meaaningful mannner is vital forr business success. B Business intellligence helpss an organisattion to transfo form data into actionable in nsight regardlless of the location. This technoloogy understannds the past annd predicts thhe future. This paper providdes an overvieew of need of busineess intelligencee in an organiisation. Keyword ds: business intelligence, i d decision makinng, data mininng, future insiight, businesss performancee, decision support ssystem

Introdu uction Why bussiness intelliggence? It is essential for an organisattion to knoow its bussiness, markket, customerrs, and com mpetition. Exxecutives neeed summarizzed data whiich gives an overall view of the comppany and its functionalityy if they are to measure performance and respondd proactively to changes happening in the maarketplace and a organisattion. Manageers, teams, and a individuals need thhe ability to o search, shhare, and use u informatiion from acrooss all aspectss of the busineess to perforrm various taasks efficienttly and monittor business operations.[1] Increasinng complex xity

deemands that business b conttinue to imprrove their abbility to makke decisions and a anticipatee changes .B Business intellligence tools help h the organnisation in deelivering righ ht information n to the right people at thhe right time in i order to maake smart andd effective deecisions. Com mpanies are moost likely to reach r their buusiness outcom mes when maany different users can acccess compllete, consisteent and truustworthy innformation. As A can be seenn by vendor offerings, thhe aspiration is i to move an organisation down the paath of analytical maturity, from past innformation too future insigh ht.(Fig1)

Fig1. Anallytical maturity journey

nd BI Businesss Users an Former generations of BI soluutions normaally s high-level roles in an organisatio on, targeted specific so only a less number of people hadd opportunityy to use them m. As an alternative, they analyzzed informatiion using usuual office prooductivity toools such as spreadsheets and desktop databases. The T

efffect on an orgganisation was considerablee. Though most of the employees m e in the organisaation had grrown expert in i using the basic b tools avvailable, it w was not sufficient in meeting their iincreasing innformation maanagement neeeds. They needed n the abbility to quickkly analyze their t data to turn their innsight into acttions for imprrovement. Wee are now

www.bo orjournals.co om Bllue Ocean Reesearch Jourrnals 76 6


in the deecade of smaart. The worlld is now moore instrumennted, organissed and inteellectual. Moore Data is available thann ever beforee- that to froom multiple sources. In this fast, interrelated i and a complex world, it is no n longer adeqquate to makee a decision and perform m on the bassis of restrictted informatiion, fixed tiime horizons, and strateggic planning cycles. Busin ness users neeed BI solutioons that are intended to offer agility-- the ability to assess, reeinvent and addjust.[2]

orrganisation froom the execuutive group alll the way too the front linnes of the bussiness. More explicitly, e thhey need:  Analyttics they cann use to answer key buusiness question present at a single placee with the m meaningfu most ful informationn.  Collecctive intelliggence gatherred from otther business users u to agree, decide and act. a  Actionnable insight that anyonee can use reegardless of time and locaation to respoond at the pooint of impactt.(Fig2)

For the bbest business output, comppanies must set free the intelligence found in alll parts of th heir

wser-based workspace w can n help users explore e inform mation regarrdless of Fig2. A unified, inteeractive brow where the data is stored s

www.bo orjournals.co om Bllue Ocean Reesearch Jourrnals 77 7


Executives “Insight and foresight are linked with leadership. It’s insight that helps to capture opportunity.” —Zhou Ming, Executive Vice President and Secretary General, China Council for International Investment Promotion Executives require information that is brief and bears straight significance to their key initiatives. They need to be able to see the big picture quickly and clearly so they can take actions. To meet this need executives require preassembled, interactive collaboration tools and integrated workflow. Thus, a BI solution for this user group must provide these features so that it fulfils the following requirements:  Connect with other executives to share their views and collect more opinions.  Track activities and projects and gain instant access to a complete task list.  Trace the source of data or a report whenever they need it. The right BI solution gives executives the choice of working with the known interface, if that is what they are comfortable with because they don’t have the time to learn new technology. Executives’ decisions are ultimately responsible for taking the company in a new direction. Thus they require a BI solution that provides real-time analytics competence so they can be sure that they are making best decisions for their organisation with all the information they need at their fingertips.[3]

Business Managers With the aim of business success and profitability, business managers need both a high-level view of business and the skill to explore operational details. Quick access to relevant information can help them make better decisions. The right BI solution can help business managers in:  Reporting capabilities that can offer them a widespread and reliable view of business and operations.  Interacting with those views using a webbrowser with the help of various features.  Reconciling transaction and scheduling data to create a corporate sanctioned view of business information using multidimensional data management.  Providing meaning using an enterprise dictionary.  Providing facility for integrating external data to their corporate information.

For travelling managers, who require to access information instantly, a mobile facility should make it easy for them to access what they need the moment they need it. BI workflow capability can benefit managers in:  Initiating tasks at any time.  Assigning ownership of an activity to individuals.  Managing initiatives and tracking projects and activities.

Business Analysts Business analysts rely heavily on query and reporting to provide them with the information they require to connect the dots between revenues and losses, products and profitability, financial performance and market trends and so on.[4] The right BI solution would provide a complete query and reporting capability that would:  Present them with the complete and steady view of business and operations.  Help them access consistent statistical evidence, trends, patters and predictions easily  Expand visibility and intelligence beyond the information at hand. Similar to other business users, analysts need collaboration and networking capabilities so they can engage with business managers, executives and other analysts to share the insights they have uncovered.

Non-Technical Users Non-technical users are those workers who are not managers or analysts or in IT. These users require:  A starting point to understand information and uncover insight to check their performance.  A browser based reporting feature to help them work along with the data they need for actionable insight.  Automated scorecards and metrics to help envision their performance based on targets set for role-specific projects and activities. Formerly, non-technical users worked outside BI infrastructure which held back their abilities to make quick and effective decisions. Thus, a complete BI experience-browse, explore and author-in a self-contained offline environment is necessary. In this ever changing business world, companies are realising that non-technical users need a solution that offers most of the capabilities that executives, managers, analysts need but in a form that they are not burdened. An effective BI solution provides them with this.[5]



Conclusion BI is not only a group of processes, practices, applications and technologies, but it is this group that over time, is a path leading to destination. It helps each individual within an organisation to make day-to-day decisions through better analysis of different areas of the business. BI helps in problem solving by giving answers to each and every question. It provides access to external data which helps in satisfying each employee’s different analytical need. BI enables users to define new views and reports for better understanding and utilization of information. BI helps in automated generation of reports and its distribution throughout the organisation which reduces human efforts. Thus BI ensures making the fast, informed decisions that fuels success and helps business in moving towards a bright future.

References [1] R. Fitriana, Eriyatno, T. Djatna “Progress in Business Intelligence System research: A literature Review,” International Journal of Basic & Applied Sciences IJBAS-IJENS Vol: 11 No: 03. [2] White Paper: The Business Intelligence – Why should I care? – October 2011 [3] Business intelligence requirements for IT: What every IT manager should know about business users’ real needs for BI – January 2011 [4] Microsoft Dynamics GP Business Intelligence – April 2007 [5] Business intelligence for business users: Insight when and where you need it – May 2010


Journal of Applied Engineering & Computer Sciences

Journal of Applied Engineering & Computer Sciences

Suggest Documents

Journal of Applied Engineering & Computer Sciences

Journal of Applied Engineering & Computer Sciences

alhosn university journal of engineering & applied sciences

alhosn university journal of engineering & applied sciences

SUST Journal of Engineering and Computer Sciences

Technical Journal of Engineering and Applied Sciences Study of ...

1071-1073 - Technical Journal of Engineering and Applied Sciences

International Journal of Engineering and Applied Sciences (IJEAS)

Journal of Engineering and Applied Sciences 9 (2 ...

ARPN Journal of Engineering and Applied Sciences ...

Technical Journal of Engineering and Applied Sciences The Risks to ...

ARPN Journal of Engineering and Applied Sciences ...

Technical Journal of Engineering and Applied Sciences ... - TJEAS

Research Article - Nova Journal of Engineering and Applied Sciences

Tunisia - International Journal of Engineering and Applied Sciences

Journal of Applied Sciences, 2010

Journal of Applied Sciences, 2013

journal of applied sciences research

Download Download PDF - Journal of Engineering & Applied Sciences

Applied Electronics & Instrumentation Engineering - Computer ...

International Journal of Applied Engineering

Journal of Applied Mechanical Engineering

SMC-LD - International Journal of Computer Sciences and Engineering

International Journal of Computer Sciences and Engineering Open