Label-free fluorescent detection of DNA sequence based on interaction of brilliant green with double-stranded DNA
Microchimica Acta An International Journal on Micro and Trace Chemistry ISSN 0026-3672 Volume 171 Combined 3-4 Microchim Acta (2010) 171:349-354 DOI 10.1007/ s00604-010-0443-9
1 23
Your article is protected by copyright and all rights are held exclusively by SpringerVerlag. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to self-archive your work, please use the accepted author’s version for posting to your own website or your institution’s repository. You may further deposit the accepted author’s version on a funder’s repository at a funder’s request, provided it is not made publicly available until 12 months after publication.
1 23
Author's personal copy Microchim Acta (2010) 171:349–354 DOI 10.1007/s00604-010-0443-9
ORIGINAL PAPER
Label-free fluorescent detection of DNA sequence based on interaction of brilliant green with double-stranded DNA Yanyan Liu & Baoxin Li
Received: 6 July 2010 / Accepted: 18 August 2010 / Published online: 28 August 2010 # Springer-Verlag 2010
Abstract The dye Brilliant Green (BG) is shown to be an excellent fluorogenic probe for the detection of doublestranded DNA (ds-DNA). Typically, the detection limit of a 21-mer is as low as 6 nM ((3σ), and the method can clearly distinguish between fully complementary ds-DNA and a ds-DNA with a single mismatch. Labeling is not required, hybridization and detection occur in homogenous aqueous solution in short time, and the dye is easily accessible, commercially available, and affordable. Keywords DNA sequence detection . Fluorescence . Brilliant green . Label-free . Homogenous
Introduction Detection of specific DNA sequence is central to modern molecular biology and also to molecular diagnostics where identification of a particular disease is based on nucleic acid identification [1, 2]. There are many methods for DNA sequence detection, and fluorescence spectroscopy dominates the detection technologies because fluorescence offers many advantages in terms of sensitivity and ease of use [3–6]. Current fluorescence detections of DNA hybridization focus on the design of a single-stranded DNA (ssDNA) labeled with a dye-quencher pair (molecular beacons) [7, 8]. However, the approaches require the dye-quencher pair optimization, sophisticated probe design and synthesis (labeling), and these complicated steps limited their Y. Liu : B. Li (*) Key Laboratory of Analytical Chemistry for Life Science of Shaanxi Province, School of Chemistry and Materials Science, Shaanxi Normal University, Xi’an 710062, China e-mail:
[email protected]
application as common biosensing approaches [6]. An alternative strategy uses some DNA-intercalating dyes to recognize and signal DNA hybridization. The intercalating dyes are fluorescent molecules that preferably bind to the major groove of a double helix DNA over ssDNA. Ethidium bromide (EB) is a commonly used DNAintercalating dyes, but it has a high mutation to biological molecules. Some new fluorescent dyes for DNA detection were developed in recent years, such as Ruthenium polydiimine complex [9], Thiazole orange homodimer (TOTO) [10] and Oxazole yellow homodimer (YOYO) [11]. However, these intercalating dyes themselves are fluorescent and can also stain ss-DNA, resulting in high background. At the same time, these dyes suffer from timeconsuming synthesis and high price. Brilliant green (BG) is one of the commonly known cationic triphenylmethane dyes. It is rather cheap and is used for various purposes, e.g. dermatologic agent, veterinary medicine, textile dying and paper printing [12]. BG has a strong chromophore in 550–620 nm range, and it is a nonfluorescent compound in aqueous solution due to the fast relaxation processes that occur via rotational motions of the aromatic rings [13]. In this work, we observed the interesting phenomenon that when double-stranded DNA (dsDNA) was added into BG solution, the dsDNA–BG system can produce the strong fluorescence emission, whereas the addition of ssDNA can not result in the fluorescence emission. By taking advantage of this phenomenon, we suggested a new strategy for DNA hybridization detection using BG as fluorescence probe. In the absence of the target ssDNA, BG can not interact with the capturing ssDNA, and the system shows no fluorescence emission; in the presence of the target ssDNA, formation of dsDNA between the capturing ssDNA and the target ssDNA enables the BG dye to intercalate into the dsDNA,
Author's personal copy 350
resulting in strong fluorescence emission. In this method, the easily-obtained BG is used as fluorescence probe, and BG is 250-fold less expensive than TOTO. In addition, unlike the other DNA-intercalating dyes (such as EB and YOYO), BG can specifically stain dsDNA, and can not stain ssDNA. More importantly, BG is not fluorescent unless BG is bound to dsDNA. Thus, the background signal is very low in this fluorescence system. On the other hand, the fluorescence emission (lmax =657 nm) of BG-DNA complex is in red region, which can decrease the interferences from fluorescence of impurities and scattered light by the matrix [14]. Furthermore, this label-free method for DNA hybridization detection can avoid the laborious labeling or modifying steps, which can make the process simple, rapid, and low in cost; the hybridization and detection are performed in homogeneous solution without steric constraints.
Y. Liu, B. Li
Procedure for fluorescence detection of DNA hybridization A 60.0 μL capturing DNA solution (2.0×10−4 M), 50.0 μL of hybridization buffer solution, 60.0 μL target DNA solution with desired concentration, and 50.0 μL 0.02 M NaCl solution were added to a 1.5-mL microtube. The above mixed solution was heated at 88 °C for 5 min and hybridized at 37 °C for 30 min. After the hybridization solution was slowly cooled to room temperature, 50.0 μL of a 0.2 mM dye solution was added. The mixture was diluted to 1.0 mL with water, and then vortex-mixed thoroughly for reaction 5 min before the fluorescence measurements. The fluorescent spectra were obtained with excitation wavelength of 585 nm at room temperature. The concentration of target DNA was quantified by the fluorescent intensity at 657 nm. Reagent blank was prepared and measured following the same procedure.
Experimental Results and discussion Apparatus Fluorescent spectral property of the BG–DNA system Fluorescence spectra were measured with a Hitachi F-4600 fluorescence spectrophotometer (http://www.hitachi.com, Tokyo, Japan). UV-visible absorption spectra were recorded on a Hitachi U-3900H spectrophotometer (Tokyo, Japan). Circular dichroism (CD) spectra were measured with Chirascan Circular Dichroism Spectrometer (http://www. photophysics.com/chirascan.php, Application Photophysical Ltd., British). Chemical and reagents The used oligonucleotide sequences were synthesized by Shanghai Sangon Biotechnology Co. (http://www.sangon. com, Shanghai, China), and used without further purification. The base sequences are as follows: capturing sequence (21-mer base sequence), 5′–AGACATGCCCAGA CATGCCC–3′; target sequence (21-mer base sequence), 5′–GGGCATGTCTGGGCATGTCT–3′; one–base mismatched sequence, 5′–GGGCATGTCAGGGCATGTCT–3′; three–base mismatched DNA sequence, 5′–GGCCATGTC ACGGCATGTCT–3; noncomplementary DNA sequence, 5′–CTCACGTAAACTCACGTAAA–3′. All the reagents were of analytical-reagent grade unless specified otherwise; the water used was double deionized water. BG stock solution (0.2 mM) was prepared by dissolving a certain amount of BG (http://tjtdsj.b2b.hc360.com/shop/ show.html, Tianjin Tianda Chemical Plant, Tianjin, China) in water. All of the stock solutions and their diluted solutions were stored in a refrigerator at 4 °C. A concentration of 10 mM KH2PO4/K2HPO4 buffer saline (PBS, pH 7.4) was used as hybridization buffer solution.
BG is a non-fluorescent substrate, but the strong fluorescent signal is observed when dsDNA is added into BG solution, whereas ssDNA can not do so (Fig. 1a). We just make use of this property to design our assay. As shown in Fig. 1a, in the absence of the target DNA, the system containing BG and the capturing DNA (ssDNA) does no emit fluorescence; upon hybridization with a target DNA (the experimental procedure for hybridization is described in Experimental Section 2.3), the capturing DNA is converted into ds-DNA conformation, resulting in strong fluorescence emission of the system. It is obvious that BG can specifically bind to dsDNA and can not stain ssDNA. For comparison, we also measured the fluorescence spectra of EB (classical DNA dye) in the presence of ssDNA and dsDNA (Fig. 1b). It can be seen that EB can also stain ssDNA, resulting in high background signal [15], whereas BG–ssDNA system show very low fluorescence signal. Furthermore, the maxima emission wavelengths of this system is 657 nm, so BG is one red-region indicator of DNA hybridization detection, decreasing the interference from sample matrix and increasing the variations of fluorescence emission for the detection of low levels of DNA. Optimization of DNA hybridization condition Factors affecting the DNA hybridization were optimized in order to maximize the sensitivity and to shorten the assay time when BG concentration was fixed at 2×10−4 M of the final concentration. If the hybridization temperature is too
Author's personal copy Label-free fluorescent detection of DNA sequence
Fluorescence Intensity
2500
A
351
intensity of the system increased with increasing captured DNA concentration, and above the concentration of 12 μM, the fluorescence intensity remained almost constant. So, the optimum capturing DNA concentration is selected for 12 μM.
BG BG+ssDNA BG+dsDNA
2000 1500 1000
Optimization of fluorescence detection condition
500 0 620
640
660
680
700
720
Wavelength/nm
Fluorescence Intensity
2500
B
EB EB+ssDNA EB+dsDNA
2000 1500 1000 500 0 550
575
600 625 Wavelength/nm
650
675
Fig. 1 Fluorescence emission spectra of BG–DNA system (a) and EB–DNA system (b). capturing DNA, 12 μM; target DNA, 12 μM; media, pH 7.4 PBS (10 mM). a BG, 10 μM, λex =585 nm; b EB, 10 μM, λex =490 nm
low, much longer hybridization time is required; if the hybridization temperature is higher than the melting temperature (Tm), the DNA duplex will denature. The experimental results showed that the best hybridized temperature and time is 37 °C and 30 min for this system. The influence caused by ionic strength of the hybridization buffer was examined by varying the amount of 0.02 M NaCl form 0 to 150 μL. Without addition of NaCl, there was low fluorescence signal because of strong electrostatic repulsion of DNA backbone; when 50 μL NaCl was added into the system, the fluorescence intensity rose to the most value. When the amount of NaCl was larger than 50 μL, the fluorescence intensity decreased, possibly because of influencing the interaction between dsDNA and BG molecule. So we added 50 μL 0.02 M NaCl in the hybridization solution. In this system, the media pH for hybridization reaction is fixed at 7.4. We also investigated the effect of the capturing DNA concentration. When the capturing DNA concentration was very low (
