(Labeo rohita) DRIVES REPORTER GENE

CELLULAR & MOLECULAR BIOLOGY LETTERS http://www.cmbl.org.pl Received: 02 October 2014 Final form accepted: 06 February 2015 Published online: 28 February 2015

Volume 20 (2015) pp 237-247 DOI: 10.1515/cmble-2015-0010 © 2014 by the University of Wrocław, Poland

Short communication THE -actin GENE PROMOTER OF ROHU CARP (Labeo rohita) DRIVES REPORTER GENE EXPRESSIONS IN TRANSGENIC ROHU AND VARIOUS CELL LINES, INCLUDING SPERMATOGONIAL STEM CELLS HIRAK KUMAR BARMAN*, RAMYA MOHANTA, SWAGAT KUMAR PATRA, VEMULAWADA CHAKRAPANI, RUDRA PRASANNA PANDA, SWAPNARANI NAYAK, SASMITA JENA, PALLIPURAM JAYASANKAR and PRIYANKA NANDANPAWAR Fish Genetics and Biotechnology Division, ICAR - Central Institute of Freshwater Aquaculture, Kausalyaganga, Bhubaneswar 751002, Odisha, India Abstract: We previously characterized the -actin gene promoter of Indian domesticated rohu carp (Labeo rohita) and made a reporter construct via fusion to green fluorescence protein (GFP) cDNA. In this study, the same construct was used to breed transgenic rohu fish. About 20% of the transgenic offspring showed ubiquitous expression of the reporter GFP gene. In a few of the transgenic fish, we documented massive epithelial and/or muscular expression with visible green color under normal light. The expression of GFP mRNA was higher in the muscle tissue of transgenic fish than in that of non-transgenic fish. A highly efficient nucleofection protocol was optimized to transfect proliferating spermatogonial cells of rohu using this reporter construct. The -actin promoter also drove expressions in HEK293 (derived from human embryonic kidney cells), K562 (human leukemic cells) and SF21 (insect ovarian cells) lines. These findings imply conserved regulatory mechanisms of -actin gene expression across eukaryotes. Furthermore, the isolated -actin promoter with consensus regulatory elements has the potential to be used in generating transgenic carp with genes of interest and in basic biology research. * Author for correspondence. Email: [email protected] or [email protected], phone: +916742465446, +916742465414, fax: +916742465407 Abbreviations used: cDNA – complementary DNA; E-box – enhancer box; ES – embryonic stem; FBS – fetal bovine serum; GFP – green fluorescence protein; GH – growth hormone; HEK293 – human embryonic kidney cells 293; MEF2 – myocyte enhancer factor 2; mRNA – messenger RNA; PGC – primordial germ cell; PI – propidium iodide; RPMI – Roswell Park Memorial Institute; SF21 – Spodoptera frugiperda 21; SSC – spermatogonial stem cell

Brought to you by | New York University Bobst Library Technical Services Authenticated Download Date | 6/6/15 3:29 AM

238

Vol. 20. No. 2. 2015

CELL. MOL. BIOL. LETT.

Keywords: -actin promoter, Labeo rohita, Rohu, Transgenic, GFP, Spermatogonial cells, HEK293, K562, SF21, Transfection protocol INTRODUCTION In fundamental research, the promoter of a gene that is expressed ubiquitously or in a tissue-specific manner has long been used to express reporter genes, particularly color genes, such as GFP (green fluorescence protein) and RFP (red fluorescence protein). -actin is a candidate gene that is expressed in all cells. Its promoter has been isolated and characterized from a wide range of species [1, 2]. This promoter is not only useful for basic research but also in the generation of transgenic animals, including fish. For example, transgenic fish [3–6] have successfully been generated using the -actin promoter to drive genes of interest, such as the growth hormone (GH) gene. Previously, we cloned and characterized promoter elements of -actin from rohu (Labeo rohita), a widely cultured Indian carp [7]. Its promoter activity was validated after direct injection into muscle tissue expressing GFP. This has provided an avenue to use such a construct for basic research. If it is also capable of driving reporter gene expression in heterologous species, there will be considerable benefit to research. Spermatogonial stem cells (SSCs), originating from a founder population of primordial germ cells (PGCs), can self-renew to maintain the stem cell pool and differentiate into male gametes. Although there are insufficient candidate markers and characteristic phenotypic features for identifying differentiated and undifferentiated SSCs, ample information is available about in vitro cultivation of enriched SSCs in mammals, avians and teleosts [8–11]. Long-term in vitro cultivation of enriched, undifferentiated spermatogonial cells from the testis of the economically important L. rohita [12, 13] provided an avenue to investigate in vivo functions of the complex process of spermatogenesis. Interestingly, a population of dividing spermatogonial cells is capable of producing motile/fertile sperm [13] in a poorly defined microenvironment consisting of culture media containing fetal bovine serum (FBS) and carp serum. This provided an opportunity to undertake research into the basic and applied aspects of gene manipulation. Unlike in mammals, zygotic divisions and differentiation take place within a few minutes of fertilization in most fish species, including L. rohita, making it difficult to generate transgenic fish with ubiquitous expressions and/or targeted disruptions. A suitable embryonic stem (ES) cell line is also lacking in the teleosts. Gene manipulation with SSCs essentially requires a well-defined transfection protocol. Lipofectamine and calcium phosphate-mediated DNA transfection to somatic cell lines are well-established techniques. Liposome-mediated transfection to spermatogonial cells of rat and mouse was reported on earlier [14]. However, data regarding transfection efficiency was lacking. Recently, lentil virus-mediated transfection of rat spermatogonial cells was shown to be a successful method [14, 15]. This is


CELLULAR & MOLECULAR BIOLOGY LETTERS

239

also a cumbersome protocol that requires specific constructs. Moreover, a welldefined transfection protocol for spermatogonial cells of teleosts was lacking. In this study, we further validated the functional activity of the rohu -actin promoter by raising transgenic rohu fish. We also optimized a protocol of nucleofection to proliferating spermatogonial cells of L. rohita with higher efficiency and survivability. Additionally, evidence is provided for the heterologous species specificity of the rohu -actin promoter. MATERIALS AND METHODS Construct We used a DNA construct (b.4pAcGFP1-1) that expresses GFP driven by the rohu (L. rohita) -actin promoter [7]. Transgenesis Electroporated sperm was used to raise transgenic rohu carp (L. rohita) as described [16]. Briefly, about 0.5 ml of milt was mixed with 0.5 ml of HEPESbuffered saline (21 mM HEPES at pH 7.05, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4 and 6 mM glucose), containing 40 µg/ml of the DNA construct for electroporation (at 560 V/cm and two pulses of 160 µs) using a Multiporator (Eppendorf). The electroporated sperm was fertilized with rohu eggs. Cell culture HEK293 cells, derived from human embryonic kidney cells, were maintained in Dulbecco’s modified Eagle’s medium with 100 IU/ml penicillin, 100 µg/ml streptomycin, 20 mM glutamine and 10% FBS at 37ºC in a humidified CO2 (5%) incubator. K562 cells, a human erythroleukemic cell line, were maintained in RPMI1640 medium supplemented with 100 IU/ml penicillin, 100 mg/ml streptomycin, 20 mM glutamine and 10% fetal bovine serum at 37ºC in a humidified CO2 (5%) incubator. Enriched spermatogonial stem cells of rohu were cultivated in vitro in gelatinized flasks at 28ºC in L15 (Invitrogen) media containing 100 µM ascorbic acid (Sigma), 10 ng/ml platelet-derived endothelial cell growth factor (Sigma) and other supplements [13]. SF21 insect cell lines (derived from the ovaries of the fall armyworm, Spodoptera frugiperda) were maintained at 27ºC in Grace’s Insect Medium supplemented with 10% FBS. Spermatogonial cell transfection The optimization of nucleofection for rohu (L. rohita) spermatogonial cells was performed through combinations of three electric parameters, namely the electric field, pulse width, and pulse number, using the Neon Transfection System (Invitrogen) as per the manufacturer’s protocol. Briefly, spermatogonial cells were cultivated as described above, and 24 x 105 cells were pelleted and re-suspended in 240 µl Resuspension Buffer (Invitrogen). The 12 µg DNA construct was mixed with cell suspension and 10 µl of above mixer (cells and DNA) was pipetted in Neon Tip (gold-coated) using a Neon pipette. The Neon


240

Vol. 20. No. 2. 2015


pipette with the Tip containing the sample Tip was placed into a Neon pipette station that contained 3 ml electrolytic buffer (Invitrogen). An optimization protocol was followed for 24 samples, in different combinations of pulse voltages (ranging from 850 to 1700), pulse widths (from 10 to 40) and pulse number (from 1 to 3) as outlined in the manufacturer’s protocol. Each electroporated sample was plated into 24-well culture plate (1 x 105 cells/500 µl/well) in an antibiotic-free complete medium of L15 for 24 h. Subsequently, the cells were cultivated in the presence of penicillin and streptomycin [12, 13]. GFP signals and cell viability were measured using a Tali Image-based Cytometer (Invitrogen) after 72 h and 60 days of propagation. A Tali Viability Kit - Dead Cell Red (Invitrogen) containing propidium iodide (PI), a live cellimpermeant fluorogenic DNA-binding dye, was used to examine cell viability. Both GFP signals and cell viability were assessed as per the manufacturer’s protocol. Cells were also observed under a fluorescence microscope (Leica) and photographed. Somatic cell transfection DNA was transiently transfected into HEK293 cells (1 x 105 cells/well of a 24-well plate) and K562 cells (1 x 105 cells/well of a 24-well plate), respectively using Lipofectamine 2000 and Lipofectamine LTX (Invitrogen) according to the manufacturer’s protocol [12]. Unlike other cell lines, spermatogonial cells could not be transfected with either Lipofectamine 2000 or Lipofectamine LTX after repeated attempts. RNA extraction, cDNA preparation and quantitative real-time PCR (qPCR) The protocols for DNA-free total RNA extraction using TRIzol reagent (Invitrogen), reverse transcription using SmartScribe reverse transcriptase (Clontech), and qPCR analyses using a Light Cycler-480 SYBR Green I kit (Roche Diagnostics) in a Light Cycler 480 RT-PCR instrument (Roche Diagnostics) were described elsewhere [12, 13, 16, 17]. Elongation factor 1-alpha (Elf1α) and β-actin were considered as reference genes [12]. The primers used are listed in Table 1. Table 1. Nucleotide sequences of the primers used for β-actin driven GFP expression in L. rohita. Purpose

Gene

qPCR

GFP

qPCR

β-actin

qPCR

Elf1α

Construct verification

β-actin & GFP

Primer RT-GFP.F1 RT-GFP.R1 B.F_15-37 B.R_ 295-315 E.F_374 -392 E.R_714-731 3F1_219-238 2R1_633-652

Sequence (5’ - 3’) ACCCTGAGCTACGGCGTGCA AATCGGTGCCGGTCAGCTCGATG ATCCTGACCGAGAGAGGCTACAG CCTTACGGATATCGACGTCAC CTTCTCAGGCTGACTGTGC CCGCTAGCATTACCCTCC ACACGCAGCTAGTGCGGAAT CTGCTTCATGTGATCGGGGT


Amplicon length (bp) 202 299 358 434


241

Histological slides Histological slides of muscles from transgenic and non-transgenic fish were prepared and observed under a fluorescence microscope [16]. RESULTS AND DISCUSSION Generation of transgenic rohu fish driven by -actin promoter To reconfirm the functional activity of the -actin promoter, transgenic rohu fish (L. rohita) were generated using the gene delivery method to sperm via electroporation. -actin promoter-driven GFP expression was documented in the muscle (Fig. 1, upper and lower panels) in addition to other organs (data not presented). GFP expression was detected in about 20% (average of three independent experiments) of rohu offspring. Massive -actin promoter-driven expression, visible under normal daylight, was also documented in a few individuals (Fig. 1). The presence of the transgene in transgenic fish was examined using PCR-amplification with primer combinations positioned at the -actin promoter (sense primer) and GFP cDNA (anti-sense primer). As shown in Fig. 1, an expected 434-bp fragment was amplified in transgenic rohu, but not in non-transgenic fish. The sequence of this amplified fragment was validated via bi-directional sequencing. This reconfirmed the successful generation of transgenic rohu fish. These findings were supported by the elevated levels (approximately five-fold) of GFP mRNA in the skeletal muscle of transgenic rohu (L. rohita) fish (two months old) as compared to non-transgenic fish (Fig. 1). These findings demonstrated that the consensus enhancer elements such as CArG box (serum responsive element), E-box (enhancer-box) and the MEF2 (myocyte enhancer factor 2) motif positioned within or surrounding the TATA- and CAAT-boxes of the -actin promoter should play key regulatory roles for -actin gene expression in various organs and tissues, as also reported earlier [18]. This also implied that isolated -actin promoter could efficiently be used in generating transgenic food fish (homologous species) for ubiquitous expression of genes of interest, e.g. GH or disease resistance gene. Optimization of highly efficient transfection protocol for rohu spermatogonial stem cells Unlike in other cell lines, an optimized protocol of efficient transfection for spermatogonial cells is still lacking. One of the important findings of this study was the optimization of nucleofection parameters to successfully transfect undifferentiated proliferating rohu spermatogonial cells. Electroporation using a Neon Transfection System for spermatogonial cells was optimized via the combination of three electric parameters, namely the electric field (voltage), pulse width and pulse number.


242

Vol. 20. No. 2. 2015


Fig. 1. Documented GFP expressions driven by the -actin promoter in transgenic rohu. The first representative image shows a transgenic fish (dorsal and lateral views) with massive expression visible under daylight. Skeletal tissue was taken from both transgenic and non-transgenic fish and observed under a confocal microscope (boxed). Fluorescence expression was detected in the muscle of transgenic rohu, but not in non-transgenic rohu. The second representative figure shows the presence of the transgene construct in transgenic fish – an expected PCR-amplified fragment (434 bp), using a forward primer positioned in the -actin promoter and a reverse primer from GFP cDNA, was generated from the genomic DNA of transgenic fish. The relative expression profile of GFP between transgenic and non-transgenic (control) fish through qPCR analysis (average of three independent experiments, each in triplicate) validated transgene expression.



243

As shown in Fig. 2 and Table 2, nucleofected (with 3 pulses at 1300 volts and 10 widths) spermatogonial cells efficiently expressed GFP protein. On average, 76 ± 2.18% cells could efficiently be transfected with 92 ± 0.88% cell viability, which includes both transfected and non-transfected cells and 57 ± 1.66% GFP positivity (Table 2), which indicates a higher rate of efficient transfection. GFP expression was also documented after 60 days of cultivation of transfected cells (data not presented). Thus, it was possible to successfully transfect undifferentiated proliferating rohu spermatogonial cells.

Fig. 2. GFP expressions in various cell lines driven by the -actin promoter. Documented expressions in rohu spermatogonial, HEK293, K562 and SF21 cells. The left panel shows the bright-field view, and the right panel represents the fluorescent view. Table 2. Tali Image-based readings of transfected cell lines (72 h post-transfection), showing the percentage of cells expressing GFP including cell viability (average of three independent experiments, each in triplicate). Data are presented as means ± standard error (SE).

Spermatogonial cell

Total GFP/Transfection efficiency (%) 76 ± 2.18

Live GFP (%) 57 ± 1.66

Dead GFP (%) 19 ± 1.76

Total viability (%) 92 ± 0.88

HEK293

72 ± 1.15

68 ± 3.52

4 ± 2.90

97 ± 1.45

K562

83 ± 1.45

75 ± 4.35

8 ± 2.90

94 ± 1.76

SF21

68 ± 0.81

52 ± 2.40

16 ± 2.60

90 ± 0.57

Cell type


244

Vol. 20. No. 2. 2015


This has a particular significance: transfected spermatogonial cells could be induced in vitro to differentiate and mature into motile and fertile sperm bearing the transgene. In such a scenario, the transgene will most likely be integrated within sperm chromatin (n). Genetically modified sperm could fertilize normal female eggs to generate transgenic fish (heterozygous). This is possible since fertile sperm were successfully produced from in vitro-cultivated spermatogonial cells of medaka fish (Oryzius latipes) [19], zebrafish (Danio rerio) [20] and rohu carp (Labeo rohita) [13]. Thus, spermatogonial cell-mediated gene manipulation could be an excellent alternate tool over conventional methods of gene delivery. Nucleofected spermatogonial cells with this -actin construct (genetically tagged) could also be the ideal alternative to commonly used fluorescence dyelabeled spermatogonial cells [21] for undertaking in vivo transplantation experiments, especially given the limited shelf-life of the latter. This will offer a further advantage by enabling the developmental process of germ cell migration to occur immediately after hatching. Additionally, it will have enormous impact on the study of spermatogenesis and germ-line stem cell biology. The rohu -actin promoter drove faithful expressions in insect and human cell lines To further investigate heterologous species specificity, rohu -actin promoter activity was examined in human HEK293 and K562 cells and SF21 insect cells following transfection. As shown in Fig. 2, GFP expressions driven by the rohu-actin promoter were documented in a population of these transfected cells. The details of the percentage of cells expressing GFP including cell viability for each cell line are given in Table 2. Thus, the rohu -actin promoter functioned faithfully in human cells, indicating the existence of highly conserved regulatory mechanisms for gene expression in various cells. The medaka (O. latipes) -actin promoter also drove GFP expression in transgenic Nile tilapia (Oreochromis niloticus) [22] and the Chinese black carp (Mylopharyngodon piceus) -actin promoter drove GFP expression in human HeLa cells [23]. Together, these implied that the regulatory mechanisms of ubiquitous expression are largely conserved from lower to higher eukaryotes. The universal promoters (e.g., CMV, cytomegalovirus promoter), capable of expressing across mammalian species, have long been used in making DNA constructs for comparative functional analyses of particular genes of interest. Such a universal promoter in the teleosts is still lacking. Our findings of heterologous specificity should offer an opportunity to use the rohu -actin promoter in studies linked to comparative functional genomics. CONCLUSIONS The isolated -actin promoter of rohu (L. rohita), a commercially important farmed carp, is capable of driving ubiquitous expression of a reporter gene (GFP) in transgenic rohu. The optimized nucleofection protocol in proliferating



245

spermatogonial cells using this promoter provides an opportunity to study developmental dynamics and gene manipulation. Furthermore, its faithful expression in insect and human cells implied that its regulatory mechanisms are likely to be highly conserved across eukaryotes. The availability of the GFP reporter system, driven by the conserved rohu -actin promoter/regulatory elements, offers the possibility of using it as an experimental tool of functional genomics and applied research, such as germ-line manipulation in fish. Acknowledgements. This work was supported by a grant from the NFBSFARA (Indian Council of Agricultural Research) and Department of Biotechnology of the Government of India. Thanks are due to the Director of ICAR-CIFA for providing facilities. We would also like to thank Dr. C. Mohapatra and Ms. S.D. Mohapatra for their technical assistance. REFERENCES 1. Kato, K., Takagi, M., Tamaru, Y., Akiyama, S.-I., Konishi, T., Murata, O. and Kumai, H. Construction of an expression vector containing a β-actin promoter region for gene transfer by microinjection in red sea bream Pagrus major. Fisheries Sci. 73 (2007) 440–445. 2. Xiao, X., Li, M., Wang, K., Qin, Q. and Chen, X. Characterization of large yellow croaker (Pseudosciaena crocea) β-actin promoter supports β-actin gene as an internal control for gene expression modulation and its potential application in transgenic studies in fish. Fish Shellfish Immunol. 30 (2011) 1072–1079. DOI: 10.1016/j.fsi.2011.02.008. 3. Devlin, R.H., Yesaki, T.Y., Donaldson, E.M., Du, S.-J. and Hew, C.L. Production of germline transgenic Pacific salmonids with dramatically increased growth performance. Can. J. Fish. Aquat.Sci. 52 (1995) 1376–1384. 4. Liu, Z.J., Moav, B., Faras, A.J., Guise, K.S., Kapuscinski, A.R. and Hackett, P.B. Functional analysis of elements affecting expression of the β-actin gene of carp. Mol. Cell Biol. 10 (1990) 3432–3440. 5. Liu, Z.J., Moav, B., Faras, A.J., Guise, K.S., Kapuscinski, A.R. and Hackett, P.B. Development of expression vectors for transgenic fish. Biotechnology (NY) 8 (1990) 1268–1272. 6. Moav, B., Liu, Z., Caldovic, L.D., Gross, M.L., Faras, A.J. and Hackett, P.B. Regulation of expression of transgenes in developing fish. Transgenic Res. 2 (1993) 153–161. 7. Barman, H.K., Das, V., Mohanta, R., Mohapatra, C., Panda, R.P. and Jayasankar, P. Expression analysis of b-actin promoter of rohu (Labeo rohita) by direct injection into muscle. Curr. Sci. 99 (2010) 1030–1032. 8. Conrad, S., Azizi, H., Hatami, M., Kubista, M., Bonin, M., Hennenlotter, J., Renninger, M. and Skutella, T. Differential gene expression profiling of enriched human spermatogonia after short- and long-term culture. Biomed. Res. Int. 2014 (2014) 138350. DOI: 10.1155/2014/138350.


246

Vol. 20. No. 2. 2015


9. Kuwana, T., Hashimoto, K., Nakanishi, A., Yasuda, Y., Tajima, A. and Naito, M. Long-term culture of avian embryonic cells in vitro. Int. J. Dev. Biol. 40 (1996) 1061–1064. 10. Saiki, A., Tamura, M., Matsumoto, M., Katowgi, J., Watanabe, A. and Onitake, K. Establishment of in vitro spermatogenesis from spermatocytes in the medaka, Oryzias latipes. Dev. Growth. Differ. 39 (1997) 337–344. 11. Song, M. and Gutzeit, H. Primary culture of medaka (Oryzias latipes) testis: a test system for the analysis of cell proliferation and differentiation. Cell Tissue Res. 313 (2003) 107–115. 12. Mohapatra, C., Patra, S.K., Panda, R.P., Mohanta, R., Saha, A., Saha, J.N., Mahapatra, K.D., Jayasankar, P. and Barman, H.K. Gene structure and identification of minimal promoter of Pou2 expressed in spermatogonial cells of rohu carp, Labeo rohita. Mol. Biol. Rep. 41 (2014) 4123–4132. DOI: 10.1007/s11033-014-3283-6. 13. Panda, R.P., Barman, H.K. and Mohapatra, C. Isolation of enriched carp spermatogonial stem cells from Labeo rohita testis for in vitro propagation. Theriogenol. 76 (2011) 241–251. DOI: 10.1016/j.theriogenology.2011.01.031. 14. Hamra, F.K., Chapman, K.M., Nguyen, D.M., Williams-Stephens, A.A., Hammer, R.E. and Garbers, D.L. Self renewal, expansion, and transfection of rat spermatogonial stem cells in culture. Proc. Natl. Acad. Sci. USA 102 (2005) 17430–17435. DOI: 10.1073/pnas.0508780102. 15. Kanatsu-Shinohara, M., Kato, M., Takehashi, M., Morimoto, H., Takashima, S., Chuma, S., Nakatsuji, N., Hirabayashi, M. and Shinohara, T. Production of transgenic rats via lentiviral transduction and xenogeneic transplantation of spermatogonial stem cells. Biol. Reprod. 79 (2008) 1121–1128. DOI: 10.1095/biolreprod.108.071159. 16. Mohanta, R., Jayasankar, P., Mahapatra, K., Saha, J. and Barman, H. Molecular cloning, characterization and functional assessment of the myosin light polypeptide chain 2 (mylz2) promoter of farmed carp, Labeo rohita. Transgenic Res. 23 (2014) 601–607. DOI: 10.1007/s11248-014-9798-8. 17. Panda, R.P., Chakrapani, V., Patra, S.K., Saha, J.N., Jayasankar, P., Kar, B., Sahoo, P.K. and Barman, H.K. First evidence of comparative responses of Toll-like receptor 22 (TLR22) to relatively resistant and susceptible Indian farmed carps to Argulus siamensis infection. Dev. Comp. Immunol. 47 (2014) 25–35. DOI: 10.1016/j.dci.2014.06.016. 18. Krasnov, A., Teerijoki, H., Gorodilov, Y. and Molsa, H. Cloning of rainbow trout (Oncorhynchus mykiss) alpha-actin, myosin regulatory light chain genes and the 5'-flanking region of alpha-tropomyosin. Functional assessment of promoters. J. Exp. Biol. 206 (2003) 601–608. 19. Hong, Y., Liu, T., Zhao, H., Xu, H., Wong, W., Liu, R., Chen, T., Deng, J. and Guij, J. Establishment of a normal medakafish spermatogonial cell line capable of sperm production in vitro. Proc. Natl. Acad. Sci. USA 101 (2004) 8011–8016.



247

20. Sakai, N. Transmeiotic differentiation of zebrafish germ cells into functional sperm in culture. Development 129 (2002) 3359–3365. 21. Koster, R. and Fraser, S. Tracing transgene expression in living zebrafish embryos. Dev. Biol. 233 (2001) 329–346. DOI: 10.1006/dbio.2001.0242. 22. Farlora, R., Kobayashi, S., Franca, L.R., Batlouni, S.R., Lacerda, S.M.S.N. and Yoshizaki, G. Expression of GFP in transgenic tilapia under the control of the medaka β-actin promoter: establishment of a model system for germ cell transplantation. Anim. Reprod. 6 (2009) 450–459. 23. Hao, F., Jia, C., Jian, L., Shao-Jun, L. and Yun, L. Cloning of black carp β-actin gene and primarily detecting the function of its promoter region. Acta Genetica Sinica 33 (2006) 133–140.
