Lactobacillus farciminis - Wiley Online Library

Journal of Applied Microbiology 2003, 95, 1207–1216

doi:10.1046/j.1365-2672.2003.02117.x

Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S–23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide C.N. Rachman, P. Kabadjova, H. Pre´vost and X. Dousset Unite´ de Recherche Qualite´ Microbiologique et Aromatique des Aliments, ENITIAA, rue de la Ge´raudie`re, BP 82225, 44322 Nantes 2 Cedex 03, France 2003/0251: received 25 March 2003, revised 19 June 2003 and accepted 21 June 2003

ABSTRACT C . N . R A C H M A N , P . K A B A D J O V A , H . P R E´ V O S T A N D X . D O U S S E T . 2003.

Aims: The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S–23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. Methods and Results: The 16S–23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S–23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR2Æ1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. Results and Conclusions: The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. Significance and Impact of the Study: In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level. Keywords: 16S–23S rDNA, intergenic spacer region, Lactobacillus alimentarius, Lactobacillus farciminis, restriction fragment length polymorphism.

INTRODUCTION Facultatively homofermentative lactic acid bacteria (LAB), Lactobacillus alimentarius, and obligatorily homofermentative Correspondence to: X. Dousset, Unite´ de Recherche Qualite´ Microbiologique et Aromatique des Aliments, ENITIAA, rue de la Ge´raudie`re, BP 82225, 44322 Nantes Cedex 3, France (e-mail: [email protected]).

ª 2003 The Society for Applied Microbiology

Lact. farciminis were described by Reuter (1983) and have been isolated mainly from marinated fish and meat products (Tanasupawat et al. 1998; Lyhs et al. 2001; Paludan-Mu¨ller et al. 2002). Some studies have shown the occurrence of these two species in raw sausage (Reuter 1983), sourdough starters (Corsetti et al. 2001) and cold-smoked salmon (Leroi et al. 1998). Recently, Lact. farciminis was isolated

1208 C . N . R A C H M A N ET AL.

from soya sauce mash in Thailand (Tanasupawat et al. 2002). Lactobacillus alimentarius and Lact. farciminis are two closely related Lactobacillus species with 96% similarity in the 16S rDNA. The role of these two species in food spoilage is not completely established. Recently, Lact. alimentarius has been found to be the specific spoilage organism in marinated herring (Lyhs et al. 2001). In cold-smoked salmon, Lact. alimentarius has been frequently isolated but has not been reported as a predominant spoilage organism (Leroi et al. 1998). Juven et al. (1998) have shown that the addition of Lact. alimentarius, or its antibiotic-resistant mutants, could significantly reduce the final population of Listeria monocytogenes in refrigerated ground beef. A psychrotrophic strain of Lact. alimentarius has been tested for its biopreservative capacity to improve quality and safety in a cooked and acidified chicken meat model (Lemay et al. 2002). Some strains of Lact. farciminis are sensitive to many antibiotics and bacteriocins, and can be adopted as indicator organisms for the assay of antibiotic treatments and also for the screening of bacteriocinogenic strains in food (Halami et al. 2000). In view of the widespread interest in Lact. alimentarius and Lact. farciminis, it is highly desirable to develop a molecular approach for their clear and reliable identification. The 16S rRNA gene has been widely used to infer phylogenetic relationships among bacteria (Amann et al. 1995). However, as evolutionary distances decrease, the diversity found in the 16S rRNA gene is often insufficient and genetic relationships of closely related species cannot be accurately defined. In eubacteria, ribosomal genes are found in the form of an operon (Krawiec and Riley 1990). The classic order of the ribosomal operon called rrn operon (5¢–3¢) is composed of 16S, 23S and 5S rRNA sequences. In contrast, relatively few 23S gene sequences have been reported. A spacer region called the intergenic spacer region (ISR) separates these 3 genes and may contain tRNA genes of amino acids. The sequence of the 16S–23S rRNA ISR exhibits greater variations than that of the 16S rRNA structural gene (Barry et al. 1991). This variation can occur between species in both the length and the sequence of this region (Gu¨rtler and Stanisich 1996). Hence, this region can be analysed by some methods to identify closely related species. The restriction fragment length polymorphism (RFLP) of the PCR-amplified 16S–23S rDNA ISR has proved to be a rapid method to characterize bacterial isolates and populations (Navarro et al. 1992; Jensen et al. 1993) and has been applied to identify acetic acid bacteria to species level (Ruiz et al. 2000; Trcek and Teuber 2002). The PCR amplification of the 16S–23S spacer region has been used to discriminate closely related Carnobacterium (Kabadjova et al. 2002). Berthier and Ehrlich (1998) have shown the presence of a variable region in the 16S–23S rDNA region between related Lactobacillus species, allowing the construction of

specific primers. A large number of lactobacilli can be identified using specific oligonucleotide probes and PCR amplification (Tilsala-Timisja¨rvi and Alatossava 1997; Berthier and Ehrlich 1998; Tannock et al. 1999; Song et al. 2000; Chagnaud et al. 2001). Species-specific primers from the 16S–23S rDNA ISR have been designed for Lact. sakei, Lact. curvatus, Lact. graminis, Lact. plantarum, Lact. paraplantarum and Lact. pentosus (Berthier and Ehrlich 1998). However, no species-specific primers have yet been designed for Lact. farciminis and Lact. alimentarius. The first objective of this study was to carry out a restriction analysis of the spacer region in order to develop a reliable diagnostic algorithm for the identification of some related Lactobacillus species with one or two endonucleases. The second objective was to sequence the spacer region of well-characterized Lact. farciminis and Lact. alimentarius in order to design species-specific primers for these two species, targeting the 16S–23S spacer region, and to test the specificity of these primers against Lactobacillus species.

MATERIALS AND METHODS Strains and media The Lactobacillus strains used in this study are listed in Table 1. The strains were stored as 20% glycerol stock 4 cultures at )80C in Man Rogosa Sharp (MRS) medium (Biokar Diagnostics, Beauvais, France) and were grown at 30C for 24 h in MRS medium. Escherichia coli INV aF¢ strain (Invitrogen Life Technology, Cergy Pontoise, France), used for cloning procedures, was grown in Luria– Bertani broth (Sambrook and Russell 2001) for 16 h at 37C. Upon transformation, E. coli was grown on Luria–Bertani agar plates containing ampicillin 100 lg ml)1, isopropylb-D-galactopyranoside 0Æ5 mol l)1 and 5-bromo-chloro-3indolyl-b-galactopyranoside at 80 lg ml)1. DNA preparation and PCR amplification Total DNA was extracted as described by Tudor et al. (1990). The oligonucleotide primers used in this study were obtained from Invitrogen Life Technology and are listed in Table 2. The DNA fragments containing ISRs were amplified with primer pairs 16S/p2 and 23S/p7, which anneal to positions 1388–1406 of the 16S rRNA gene and to positions 207–189 of the 23S rRNA gene, E. coli numbering (GenBank accession number V00331), respectively. The primer 23S/p7 was designed from sequences of the 23S gene conserved among various bacteria (Gu¨rtler and Stanisich 1996). It should be noted that PCR-amplified DNA carried out with primers 16S/p2–23S/p7 contained the complete 16S–23S ribosomal intergenic spacer region and parts of the flanking rDNAs (ca 17 bp of 16S rDNA and 207 bp of 23S rDNA). PCR reactions

ª 2003 The Society for Applied Microbiology, Journal of Applied Microbiology, 95, 1207–1216, doi:10.1046/j.1365-2672.2003.02117.x

SPECIES-SPECIFIC PRIMERS FOR LACT. FARCIMINIS AND LACT. ALIMENTARIUS

1

Table 1 List of lactobacilli used in this study

1209

Table 1 (Contd.)

Species

Strain designation

Species

Strain designation

Lactobacillus sp. Lact. sakei Lact. sakei Lact. sakei Lact. sakei Lact. sakei Lact. sakei Lact. sakei Lact. sakei Lact. curvatus Lact. curvatus Lact. curvatus Lact. curvatus Lact. plantarum Lact. plantarum Lact. plantarum Lact. plantarum Lact. plantarum Lact. plantarum Lact. plantarum Lact. plantarum Lact. plantarum Lact. plantarum Lact. paraplantarum Lact. paraplantarum Lact. farciminis Lact. farciminis Lact. farciminis Lact. farciminis Lact. farciminis

DSM 20182 ATCC 15521 NBIMCC 3453 INRA Theix 381 INRA Theix 214 IFREMER SF 811 IFREMER SF 812 IFREMER SF 699 IFREMER SF 771 DSM 20019 INRA Theix H382 INRA Theix H383 INRA Theix 648 ATCC 14917 INRA Jouy 1228 INRA Jouy 432 INRA Jouy 738 INRA Theix 702 ENITIAA ST 31 DANONE 1Æ011 DANONE 1Æ060 DANONE 1Æ175 DANONE 1Æ287 INRA Jouy 1885 INRA Jouy 1888 DSM 20180 DSM 20184 SIGMO P222 LTH 692 LTH 693

Lact. farciminis Lact. farciminis Lact. alimentarius Lact. alimentarius Lact. alimentarius Lact. alimentarius Lact. alimentarius Lact. alimentarius Lact. kimchii Lact. mindensis Lact. pontis Lact. panis Lact. sanfranciscensis Lact. brevis Lact. acidophilus Lact. amylovorus Lact. frumenti Lact. reuteri Lact. paralimentarius Lact. delbrueckii ssp. delbrueckii

LTH 694 LTH 4812 DSM 20249 DSM 20181 NBIMCC 3315 TMW 1Æ418 LTH 691 LTH 954 DSM 13961 DSM 14500 DSM 8475 DSM 6035 CIP 103252 DSM 20556 DSM 20079 DSM 20531 DSM 13145 DSM 20016 DSM 13238 DSM 20074

were performed in a PTC-100 Thermocycler (MJ Research Inc., Watertown, MA, USA) in a total volume of 50 ll containing 1· PCR buffer (Appligene Oncor, Espoo, Finland), 2Æ5 mmol l)1 MgCl2 (Appligene Oncor), 1 lg ml)1 DNA, 0Æ3 lmol l)1 of each primer (Invitrogen Life Technology), 0Æ25 mmol l)1 of each dNTP (Finnzymes OY, Espoo, Finland) and 1 U Taq DNA polymerase (Appligene Oncor). The amplification programme consisted of a 1-min denaturation step at 94C, a 1-min annealing step at 56C and a 1-min extension step at 72C. The first cycle was preceded by incubation for 5 min at 94C. After 35 cycles, there was a final 5-min extension at 72C. Negative controls without DNA template were included in parallel. PCR products were separated in a 1Æ5% (w/v) agarose gel and were subsequently visualized by u.v. illumination after ethidium bromide staining. 16S–23S rDNA ISR cloning and sequencing Clone libraries of the PCR-amplified rDNA of strain types Lact. farciminis DSM 20184 and Lact. alimentarius DSM

DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany; ATCC, American Type Culture Collection, USA; INRA, Institut National de Recherche Agroalimentaire, France; NBIMCC, National Bank for Industrial Microorganisms and Cell Cultures, Bulgaria; IFREMER, Institut Français de Recherche pour l’Exploitation de la Mer, Nantes, France; SIGMO, Service Identification Geńe´tique des MicroOrganismes, Nantes, France; LTH, Institute of Food Technology, University of Hohenheim, Stuttgart, Germany; TMW, Technische Mikrobiologie Weihenstephan, Germany.

20249 with primers 16S/p2 and 23S/p7 were constructed using the pCR2Æ1 TA cloning kit (Invitrogen Life Technology). For each strain, three independent clones of each type of 16S–23S ISR identified in Lactobacillus were selected and sequenced. Double-stranded DNA from the recombinant plasmid of the positive clones was purified using the QIAprep spin miniprep kit (Qiagen, Courtaboeuf, France). Three independent clones containing the insert rDNA corresponding to each of two PCR ISR amplicons were identified and sequenced. Anticipated errors of PCR and sequencing reactions were avoided by sequencing both strands from each cloned fragment of separate PCR experiments. The nucleotide sequences of the cloned 16S–23S ISRs were determined by the dideoxynucleotide chain termination method (Sanger et al. 1977) with an ABI 370 automated sequencer using the Taq Dye-Deoxy TM terminator cycle sequencing kit (PerkinElmer Life Sciences, Zaventem, Belgium). The sequencing was carried out in the ESGS Company (Evry, France). Sequences were submitted to the National Center for


1210 C . N . R A C H M A N ET AL.

Table 2 Sequences of the oligonucleotide primers used for PCR amplification and sequencing Primer

Location

Oligonucleotide sequence (5¢ fi 3¢)

Reference

16S/p2 23S/p7 23S/p10 tAla Lc Ls Lpl La Lf

16S rRNA gene, forward (position 1390–1407) 23S rRNA gene, reversed (position 188–208) 23S rRNA gene, reversed (position 456–474) tAla gene, forward Lact. curvatus 16S/23S rRNA ISR gene, reversed Lact. sakei 16S/23S rRNA ISR gene, reversed Lact. plantarum 16S/23S rRNA ISR gene, reversed Lact. alimentarius 16S/23S rRNA ISR gene, forward Lact. farciminis 16S/23S rRNA ISR gene, forward

CTTGTACACACCGCCCGTC GGTACTTAGATGTTTCAGTTC CCTTTCCCTCACGGTACTG TAGCTCAGCTGGGAGAGC TTGGTACTATTTAATTCTTAG ATGAAACTATTAAATTGGTAC ATGAGGTATTCAACTTATG TCTCTGCAAAACTTAATAGTAAC CAGAAATTTTAATAGTACCATG

Gu¨rtler and Stanisich 1996 Gu¨rtler and Stanisich 1996 Gu¨rtler and Stanisich 1996 Le Jeune and Lonvaud-Funel 1997 Berthier and Ehrlich 1998 Berthier and Ehrlich 1998 Berthier and Ehrlich 1998 This study This study

ISR, intergenic spacer region.

Biotechnology Information (NCBI, Bethesda, MO, USA) for similarity searches in the GenBank database. The 5 computer program Clustal W (Thompson et al. 1994) was used for sequence alignment and the BLAST 2 program (Altschul et al. 1997) was used to represent ISR similarities for sequences, which did not include 16S nor 23S rDNA. Restriction enzyme analysis and computerassisted analysis of rDNA restriction patterns DNA restriction was performed on nonpurified PCR products in a final volume of 25 ll at optimal temperature according to the manufacturer’s recommendations (New 6 England BioLabs, Hitchin, UK). The total digested products were separated by electrophoresis in 2% (w/v) agarose gel. Gel images were digitized with a charged-coupled 7 device video camera (Sony, Clichy, France) and saved as TIFF files. These were converted, normalized with the molecular size markers 100-bp DNA ladder (New England BioLabs) and analysed with Bio Profile Software (Vilbert Lourmat, Marne La Valleé, France). For ISR-RFLP analysis, a band-matching algorithm was selected to calculate pairwise similarity matrices with the Dice coefficient. A band-matching tolerance of 5% was chosen. The Bio Profile Software was used to establish a standard database; however, for daily experimentation, identification of lactobacilli can be carried out without this software. Nucleotide sequence accession numbers The sequences of 16S–23S ISR DNA of Lact. alimentarius DSM 20249 and Lact. farciminis DSM 20184 were deposited in the EMBL, GenBank and DDBJ nucleotide databases under the following numbers: AF500490 (small 16S– 23S ISR rDNA of Lact. farciminis), AF500491 (large 16S–23S ISR rDNA of Lact. farciminis), AF500492 (small 16S–23S ISR rDNA of Lact alimentarius) and AF500493 (large 16S–23S ISR rDNA of Lact. alimentarius).

RESULTS PCR amplification of 16S–23S ISRs PCR amplification using primers 16S/p2 and 23S/p7 designed from the flanking terminal sequences of the 16S and 23S genes was performed with chromosomal DNA isolated from 38 Lactobacillus strains. Amplification yielded a nearly identical band pattern containing two fragments of ca 600 and 800 bp in length, except for Lact. farciminis which displayed a slightly different two-band profile of 550 and 750 bp. It should be noted that PCR products from each Lactobacillus strain always consisted of two ISR amplicons, designated as small (S-ISR) and large (L-ISR). This profile has already been reported by Berthier and Ehrlich (1998) for Lact. sakei, Lact. curvatus, Lact. graminis, Lact. plantarum, Lact. paraplantarum and Lact. pentosus. As shown in Fig. 1, lanes 3 and 6, the electrophoresis revealed a difference in length between the two fragments of Lact. farciminis and the other Lactobacillus strains. Nucleotide sequence analysis of the 16S–23S rDNA ISR The nucleotide sequences of S-ISR varied in length from 194 bp for Lact. farciminis to 230 bp for Lact. alimentarius (Fig. 2). According to the similarity analysis, they show 65Æ4–66% identity with S-ISR of Lact. sakei, Lact. curvatus and Lact. plantarum (GenBank numbers U97131, U97129 and U97133, respectively). The alignment between Lact. farciminis and Lact. alimentarius shows 75Æ4% similarity for S-ISRs and 85Æ6% for L-ISRs. The L-ISR of Lact. farciminis (388 bp) shows a 67Æ2% identity with those of Lact. curvatus, Lact. plantarum and Lact. sakei (GenBank numbers U97135, U97137 and U97139). The L-ISR of Lact. alimentarius contains 425 bp and shows 67Æ7% identity with those of Lact. plantarum, Lact. sakei and Lact. curvatus. As can be seen in Fig. 2, the L-ISRs are similarly organized and their central region contains genes coding


1


1

Fig. 1 Electrophoresis with 1Æ5% agarose gel of PCR-amplified 16S–23S intergenic spacer region (ISR) of lactobacilli. Lane 1: molecular weight marker (100-bp DNA ladder); lane 2: Lactobacillus curvatus DSM 20019; lane 3: Lact. farciminis DSM 20184; lane 4: Lact. sakei ATCC 15521; lane 5: Lact. alimentarius DSM 20181; lane 6: Lact. farciminis DSM 20180; lane 7: Lact. plantarum ATCC 14917; 9 lane 8: Lact. alimentarius DSM 20249; lane 9: Lactobacillus sp. DSM 20182

2

3

4

5

6

7

8

1211

9

1000 bp 500 bp

for tRNAIle and tRNAAla as well as noncoding sequences. The central region is flanked by sequences that are identical or almost identical to those of the corresponding small ISRs. The L-ISR of Lact. farciminis is composed of the corresponding S-ISR, interrupted at position 73 by a sequence of 203 bp in length containing a gene of tRNAIle (87 bp) located at position 74–159 and a gene of tRNAAla located at position 185–258 (75 bp). Similarly, the L-ISR of Lact. alimentarius is composed of the corresponding S-ISR, which is interrupted at position 75 by a sequence of 195 bp containing genes of tRNAIle and tRNAAla located at positions 84–158 (76 bp) and 185–258 (75 bp), respectively. PCR amplification and RFLP analysis of 16S–23S ISRs Useful restriction sites in the ISR region were searched for in order to obtain an ISR-RFLP profile specific to Lact. farciminis and Lact. alimentarius. The sequence analysis of S-ISR and L-ISR shows a polymorphism in the region located between tRNAAla and 23S-DNA. However, an in silico restriction analysis of the 16S/p2–23S/p7 amplicon did not enable the selection of a restriction enzyme able to generate restriction profiles that would distinguish between Lact. alimentarius and Lact. farciminis. Thus, we decided to use primer pairs tRNAAla and 23S/p10 to amplify alternative genetic targets. The gene coding for tRNAAla contains an 18-nucleotide sequence that is conserved in all the tRNAAla compared, making this region a suitable target for performing PCR inside the ISR. Region 10 in 23S rDNA is the most highly conserved among a specific group of organisms. Therefore, the primer 23S/p10 is the one recommended as the most likely to detect all copies of the spacer region, and hence to determine spacer and sequence variation (Gu¨rtler and

Stanisich 1996). The tRNAAla primer was designed from a conserved sequence of the tDNAAla gene located in the 16S–23S ISR of Oenococcus oeni (Le Jeune and LonvaudFunel 1997). The primer 23S/p10 anneals to positions 456–474 of the 23S rRNA gene, E. coli numbering. The four other Lactobacillus species (Lact. sakei, Lact. curvatus, Lact. plantarum and Lact. paraplantarum) showing the highest similarity in the 16S–23S rDNA ISR sequence with Lact. farciminis and Lact. alimentarius, were chosen to be tested using the RFLP method. PCR, using primers tRNAAla and 23S/p10, allowed amplification of one amplicon, which appeared as a single DNA fragment with a size of ca 720 bp for all Lactobacillus strains (results not shown). The PCR product amplified from each strain was digested separately by the endonucleases HinfI and TaqI, which were selected as the first-line enzymes that give the most discriminatory RFLP patterns (data not shown). Digestion with HinfI (Fig. 3) generated three genotypes distinguishing Lact. farciminis from the other two groups of lactobacilli. The same profile, with three well-resolved bands of 470, 120 and 100 bp, was observed for Lact. sakei and Lact. curvatus. Meanwhile, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum presented the same profile of two well-determined bands of 475 and 210 bp. Finally, Lact. farciminis had a profile of two well-resolved bands of 422 and 219 bp. As shown in Fig. 3, the TaqI digestion revealed five different genotypes enabling the Lactobacillus species to be differentiated, except for Lact. plantarum from Lact. paraplantarum. The five genotypes displayed the following patterns: three bands of 340, 190 and 110 bp for Lact. sakei; three bands of 380, 185 and 107 bp for Lact. curvatus; three bands of 420, 190 and 115 bp for Lact. plantarum and Lact. paraplantarum; two bands of 400 and 290 bp for Lact. alimentarius; and two bands of 370 and 290 bp for Lact. farciminis. The HinfI and TaqI restriction produced genotypes whose sizes could


1212 C . N . R A C H M A N ET AL.



1

b

Fig. 2 (a) Sequence alignment of two types of 16S–23S rDNA intergenic spacer region (ISR) found in Lactobacillus alimentarius. (b) Sequence alignment of two types of 16S–23S rDNA ISR of Lact. farciminis. L-ISR, long-type ISR; S-ISR, short-type ISR. Sequence gaps for the alignment are shown by hyphens. The encoding tRNA are indicated by a continuous black line. Conserved region flanking 16S and 23S rDNA are shaded in grey

be easily estimated and analysed with Bio Profile Software. The digestion profiles of these lactobacilli are reproducible and can also be compared easily without Bio Profile Software. The six species of lactobacilli studied were Lact. sakei (eight strains), Lact. alimentarius (three strains), Lact. paraplantarum (two strains), Lact. farciminis (three strains), Lact. curvatus (four strains) and Lact. plantarum (10 strains), listed in Table 1. All the species, except Lact. plantarum and Lact. paraplantarum, have been differentiated by digestion of the amplification product by tAla and 23S/p10 primers using HinfI and TaqI enzymes.

Design and validation of species-specific oligonucleotide PCR primers To design primers that would specifically identify species, we screened for the ISR regions that showed the highest variability between Lact. farciminis, Lact. alimentarius and the other Lactobacillus species. The spacer region between the two tRNA genes from the L-ISRs was analysed and this region met the requirement for designing species-specific primers (Fig. 4). The primer specific to Lact. farciminis (Lf) consists of 22 bp (5¢-CAGAAATTTTAATAGTACCATG-3¢) and the specific primer of Lact. alimentarius (La) consists of 23 bp (5¢-TCTCTGCAAAACTTAATAGTAAC-3¢). The primer sequences from this region are underlined in Fig. 4 and listed in Table 2. For species-specific PCR amplification assays, the speciesspecific primers, Lf and La, were paired with the reversed primer 23S/p7 from the 23S rRNA gene. In order to determine the suitability as diagnostic probes of the two primer pairs designed from 16S–23S ISR sequences, they were validated in PCR amplifications by using a collection of bacterial DNAs. The DNA collection tested comprised

Lactobacillus species

TaqI

Size marker

Hin fI

Fragment size Number of (bp) tested strains 500

Lact. farciminis

370, 290

3

Lact. alimentarius

400, 290

4

420, 190, 115

10

Lact. plantarum Size marker

500

Lact. paraplantarum 420, 190, 115

2

Lact. curvatus

380, 185, 107

4

Lact. sakei

340, 190, 110

8

Size marker

500

Lact. paraplantarum

Fig. 3 Gel electrophoresis of PCR-amplified 16S–23S intergenic spacer region (ISR) fragments of the Lactobacillus species digested with TaqI and HinfI. Algorithms of restriction fragment length polymorphism pattern species are presented by molecular size. The 500bp fragment of the 100-bp DNA ladder is indicated by an arrow

1213

475, 210

2

Lact. curvatus

470, 120, 100

4

Lact. sakei

470, 120, 100

8

Size marker

500

Lact. farciminis

422, 219

3

Lact. alimentarius

475, 210

4

Lact. plantarum

475, 210

10

Size marker

500


1214 C . N . R A C H M A N ET AL.

Fig. 4 Nucleotide sequence alignment of the large 16S–23S intergenic spacer regions (ISRs) of: Lactobacillus sakei (lane 1); Lact. curvatus (lane 2); Lact. plantarum (lane 3); Lact. farciminis (lane 4); Lact. alimentarius (lane 5). The sequences of species-specific primers of Lact. farciminis and Lact. alimentarius are underlined

(a) 1

2

3

4

(b) 5

6

7

8

1

2

3

4

5

6

7

8

1000 bp 500 bp

Fig. 5 (a) PCR amplification using Lf-23S/p7. Lane 1: molecular weight marker (100-bp DNA ladder); lane 2: Lactobacillus farciminis DSM 20184; lane 3: Lact. farciminis DSM 20180; lane 4: Lact. alimentarius DSM 20249; lane 5: Lact. alimentarius DSM 20181; lane 6: Lact. curvatus DSM 20019; lane 7: Lact. plantarum ATCC 14917; lane 8: Lact. sakei ATCC 15521. (b) PCR amplification using La-23S/p7. Lane 1: molecular weight marker (100-bp DNA ladder); lane 2: Lact. alimentarius DSM 20249; lane 3: Lact. alimentarius DSM 20181; lane 4: Lact. farciminis DSM 20184; lane 5: Lact. farciminis DSM 20180; lane 6: Lact. sakei ATCC 15521; lane 7: Lact. curvatus DSM 20019; lane 8: Lact. plantarum ATCC 14917. No amplification was obtained for Lact. kimchii, Lact. mindensis, Lact. panis, Lact. pontis, Lact. sanfranciscensis, Lact. brevis, Lact. 8 acidophilus, Lact. amylovorus, Lact. frumenti, Lact. reuteri, Lact. delbrueckii ssp. delbrueckii and Lact. paralimentarius (data not shown)

Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus, Lact. plantarum and Lact. kimchii, including Lactobacillus species isolated from sourdough such as Lact. panis, Lact. pontis, Lact. sanfranciscensis, Lact. brevis, Lact. mindensis, Lact. acidophilus, Lact. amylovorus, Lact. frumenti, Lact. reuteri, Lact. delbrueckii ssp. delbrueckii and Lact. paralimentarius. The experiment was repeated five times and no amplifications were obtained.

The DNA from each strain type listed in Table 1 was PCR-amplified in the presence of Lf and 23S/p7 or La and 23S/p7. Lf and 23S/p7 or La and 23S/p7 primer sets produced a single amplicon of ca 400 bp only when Lact. farciminis and Lact. alimentarius DNA, respectively, was used as the template. No products were amplified with our lactobacilli DNA collection as shown in Fig. 5. No primers matched nonspecific target sites when the sequences were



1

checked against the GenBank nonredundant DNA database. The presence of each product was visualized on a 1Æ5% agarose gel and was verified with a collection of environmental isolates of Lact. farciminis and Lact. alimentarius (Table 1). DISCUSSION In this study, we have clearly demonstrated the simultaneous amplification by PCR of two fragments, corresponding to the 16S–23S ISRs of DNAs from Lact. farciminis and Lact. alimentarius. This profile has been reported by Berthier and Ehrlich (1998) for six Lactobacillus species: Lact. sakei, Lact. curvatus, Lact. graminis, Lact. plantarum, Lact. paraplantarum and Lact. pentosus. Only the larger fragment exhibits interspecies variations in sequence. Primers derived from the larger ISR sequences were successfully applied to assign strains to the species Lact. farciminis and Lact. alimentarius. The 16S–23S spacers of Gram-positive bacteria contain either a tRNAAla or a tRNAIle gene or both of these (Gu¨rtler and Stanisich 1996). Two forms of ribosomal RNA (rrn) operons were identified in lactobacilli: one with tandem tRNAIle/tRNAAla genes and the other without tRNA genes (Nour 1998). The L-ISRs of Lact farciminis and Lact. alimentarius contain the coding sequence for tRNAIle and tRNAAla. As described for all other bacteria, the sequences of small and large lactobacilli ISRs are related to the tRNA genes inserted between the common sequences. The L-ISR sequences were ideal for designing such species-specific oligonucleotide probes, because we observed the lowest degree of identity between the L-ISR sequences. Moreover, the most variable region between the large sequences is located in a single region, i.e. the spacer between the two tRNA genes. The constructed primers, when paired with a 23S/p7 rDNA-specific primer, were successfully applied for the differentiation of Lact. farciminis and Lact. alimentarius from other lactobacilli investigated in this work. On the contrary, no species-specific probe could be designed from the small ISR sequences as only a few nucleotide differences were observed between Lact. farciminis and Lact. alimentarius. The RFLP was carried out both to distinguish the lactobacilli strains and to group them in order to facilitate identification (Fig. 3). All the species, except Lact. plantarum and Lact. paraplantarum, have been differentiated by digestion, using HinfI and TaqI enzymes, of the amplification product by tAla and 23S/p10 primers. HinfI can only be used to distinguish Lact. farciminis from the other lactobacilli tested. Lact. sakei and Lact. curvatus have the same restriction profile and Lact. alimentarius, Lact. plantarum and Lact. paraplantarum form a group having the same restriction profile. In contrast, TaqI offers the

1215

possibility of differentiating the lactobacilli studied, except for Lact. plantarum from Lact. paraplantarum. In order to verify these results, we carried out the digestion for different strains of Lact. farciminis and Lact. alimentarius. Two strains of Lact. farciminis had the same pattern as Lact. farciminis DSM 20180 while one strain of Lact. alimentarius revealed the same pattern as Lact. alimentarius DSM 20249. As shown in Fig. 5a, PCR amplification using the specific primer Lf and primer 23S/p7 only allowed the synthesis of a fragment of ca 400 bp from Lact. farciminis DNA, and also for five other strains of Lact. farciminis (results not shown). Meanwhile, PCR amplification using primers La and 23S/ p7 generated one fragment of 400 bp exclusively for Lact. alimentarius (Fig. 5b). We also tested these primers with four other strains of Lact. alimentarius (results not shown). These results confirm the specificity of Lact. farciminis and Lact. alimentarius specific primers. In conclusion, we have shown that the ISR sequence is useful for the design of oligonucleotide primers that can discriminate between closely related Lactobacillus species by PCR. In this study, such primers were designed for both Lact. farciminis and Lact. alimentarius. The PCR–RFLP technique is also a powerful tool to differentiate Lact. farciminis and Lact. alimentarius from Lact. sakei, Lact. curvatus, Lact. plantarum and Lact. paraplantarum. These two techniques are hence suggested for very rapid, easy and reliable species identification of closely related lactobacilli. ACKNOWLEDGEMENTS We thank our colleague Virginie Le Cam for her help in optimizing the RFLP method. We especially thank Dr Michael Ga¨nzle (Technische Universitat Mu¨nchen, Germany) and Dr Christian Hertel (University of Hohenheim, Germany) for providing strains of Lact. farciminis and Lact. alimentarius. We are grateful to the French Ministry of Research for financial support in the Bioressources et Traçabilite´ pour le Post-Geńome project. REFERENCES Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389–3402. Amann, R.I., Ludwig, W. and Schleifer, K.H. (1995) Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiology Review 59, 143–169. Barry, T., Colleran, G., Glennon, M., Dunnican, L.K. and Gannon, F. (1991) The 16S/23S ribosomal spacer region as a target for DNA probes to identify eubacteria. PCR Methods and Applications 1, 51–56. Berthier, F. and Ehrlich, S.D. (1998) Rapid species identification within two groups of closely related lactobacilli using PCR primers


1216 C . N . R A C H M A N ET AL.

that target the 16S/23S rRNA spacer region. FEMS Microbiology Letters 161, 97–106. Chagnaud, P., Machinis, K., Coutte, L.A., Marecat, A. and Mercenier, A. (2001) Rapid PCR-based procedure to identify lactic acid bacteria: application to six common Lactobacillus species. Journal of Microbiological Methods 44, 139–148. Corsetti, A., Lavermicocca, P., Morea, M., Bazurri, F., Tosti, N. and Gobbetti, M. (2001) Phenotypic and molecular identification and clustering of lactic acid bacteria and yeasts from wheat (species Triticum durum and Triticum aestivum) sourdoughs of Southern Italy. International Journal of Food Microbiology 64, 95–104. Gu¨rtler, V. and Stanisich, V.A. (1996) New approaches to typing and identification of bacteria using the 16S–23S rDNA spacer region. Microbiology 142, 3–16. Halami, P.M., Chandrashekar, A. and Nand, K. (2000) Lactobacillus farciminis MD, a newer strain with potential for bacteriocin and antibiotic assay. Letters of Applied Microbiology 30, 197–202. Jensen, M.A., Webster, J.A. and Straus, N. (1993) Rapid identification of bacteria on the basis of polymerase chain reaction-amplified ribosomal DNA spacer polymorphisms. Applied and Environmental Microbiology 59, 945–952. Juven, B.J., Barefoot, S.F., Pierson, M.D., McCaskill, L.H. and Smith, B. (1998) Growth and survival of Listeria monocytogenes in vacuumpackaged ground beef with Lactobacillus alimentarius FloraCarn L-2. Journal of Food Protection 61, 551–556. Kabadjova, P., Dousset, X., Le Cam, V., and Pre´vost, H. (2002) Differentiation of closely related Carnobacterium food isolates based on 16S–23S ribosomal DNA intergenic spacer region polymorphism. Applied and Environmental Microbiology 68, 5358–5366. Krawiec, S. and Riley, M. (1990) Organization of the bacterial chromosome. Microbiology Review 54, 502–539. Le Jeune, C. and Lonvaud-Funel, A. (1997) Sequence of DNA 16S/23S spacer region of Leuconostoc oenos (Oenococcus oeni): application to strain differentiation. Research in Microbiology 148, 79–86. Lemay, M.J., Choquette, J., Delaquis, P.J., Claude, G. and Saucier, L. (2002) Antimicrobial effect of natural preservatives in a cooked and acidified chicken meat model. International Journal of Food Microbiology 78, 217–226. Leroi, F., Joffraud, J.J., Chevalier, F. and Cardinal, M. (1998) A study of the microbial ecology of cold smoked salmon during storage at 8C. International Journal of Food Microbiology 39, 111–121. Lyhs, U., Korkeala, H., Vandamme, P. and Bjo¨rkroth, J. (2001) Lactobacillus alimentarius: a specific spoilage organism in marinated herring. International Journal of Food Microbiology 64, 355–360. Navarro, E., Simonet, P., Normand, P. and Bardin, R. (1992) Characterization of natural populations of Nitrobacter spp. using PCR/RFLP analysis of the ribosomal intergenic spacer. Archives of Microbiology 157, 107–115. Nour, M. (1998) 16S–23S and 23S–5S intergenic spacer regions of lactobacilli: nucleotide sequence, secondary structure and comparative analysis. Research in Microbiology 149, 433–448.

Paludan-Mu¨ller, C., Madsen, M., Sophanodora, P., Gram, L. and Moller, P.L. (2002) Fermentation and microflora of plaa-som, a thai fermented fish product, prepared with different salt concentrations. International Journal of Food Microbiology 73, 61–70. Reuter, G. (1983) Lactobacillus alimentarius sp. nov., nom rev. and Lactobacillus farciminis sp. nov., nom rev. Systematic and Applied Microbiology 4, 277–279. Ruiz, A., Poblet, M., Mas, A. and Guillamon, J.M. (2000) Identification of acetic acid bacteria by RFLP of PCR-amplified 16S rDNA and 16S–23S rDNA intergenic spacer. International Journal of Evolutionary Microbiology 50, 1981–1987. Sambrook, J. and Russell, D.W. (2001) Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences USA 74, 5463–5467. Song, Y.L., Kato, N., Liu, C., Matsumiya, Y., Kato, H. and Watanabe, K. (2000) Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S–23S rRNA intergenic spacer region and its flanking 23S rRNA. FEMS Microbiology Letters 187, 167– 173. Tanasupawat, S., Okada, S. and Komagata, K. (1998) Lactic acid bacteria found in fermented fish in Thailand. Journal of Genetic and Applied Microbiology 44, 193–200. Tanasupawat, S., Thongsanit, J., Okada, S. and Komagata, K. (2002) Lactic acid bacteria isolated from soy sauce mash in Thailand. Journal of Genetic and Applied Microbiology 48, 201–209. Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, S., Ng, J., Munro, K. and Alatossava, T. (1999) Identification of Lactobacillus isolates from the gastrointestinal tract, silage and yoghurt by 16S–23S rRNA gene intergenic spacer region sequence comparison. Applied and Environmental Microbiology 65, 4264–4267. Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Tilsala-Timisja¨rvi, A. and Alatossava, T. (1997) Development of oligonucleotide primers from the 16S–23S rRNA intergenic sequences for identifying different dairy and probiotic lactic acid bacteria. International Journal of Food Microbiology 35, 49–56. Trcek, J. and Teuber, M. (2002) Genetic and restriction analysis of the 16S–23S rDNA internal transcribed spacer regions of acetic acid bacteria. FEMS Microbiology Letters 208, 69–75. Tudor, J.J., Marri, L., Piggot, P.J. and Daneo-Moore, L. (1990) Size of the Streptococcus mutans GS-5 chromosome as determined by pulsed-field gel electrophoresis. Infection and Immunity 58, 838– 840.
