Lactobacillus helveticus

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, June 2003, p. 3238–3243 0099-2240/03/$08.00⫹0 DOI: 10.1128/AEM.69.6.3238–3243.2003 Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Vol. 69, No. 6

Unusual Organization for Lactose and Galactose Gene Clusters in Lactobacillus helveticus Maria Grazia Fortina,* Giovanni Ricci, Diego Mora, Simone Guglielmetti, and Pier Luigi Manachini Industrial Microbiology Section, Department of Food Science and Microbiology, University of Milan, 20133 Milan, Italy Received 2 December 2002/Accepted 20 March 2003

The nucleotide sequences of the Lactobacillus helveticus lactose utilization genes were determined, and these genes were located and oriented relative to one another. The lacLM genes (encoding the ␤-galactosidase protein) were in a divergent orientation compared to lacR (regulatory gene) and lacS (lactose transporter). Downstream from lacM was an open reading frame (galE) encoding a UDP-galactose 4 epimerase, and the open reading frame had the same orientation as lacM. The lacR gene was separated from the downstream lacS gene by 2.0 kb of DNA containing several open reading frames that were derived from fragmentation of another permease gene (lacSⴕ). Northern blot analysis revealed that lacL, lacM, and galE made up an operon that was transcribed in the presence of lactose from an upstream lacL promoter. The inducible genes lacL and lacM were regulated at the transcriptional level by the LacR repressor. In the presence of glucose and galactose galE was transcribed from its promoter, suggesting that the corresponding enzyme can be expressed constitutively. Lactose transport was inducible by addition of lactose to the growth medium. ␤-galactosidase genes (lacZ) are downstream (14). In Leuconostoc lactis (5) and Lactobacillus sake (17) the ␤-galactosidase is encoded by two partially overlapping genes, lacL and lacM, and no operon-like organization of lactose genes seems to be present. Leuconostoc lactis has a novel arrangement, with lacS separated from lacLM by 2.0 kb of DNA containing an insertion sequence (33). Within the LAB, Lactobacillus helveticus is an industrially important thermophilic starter for the fermentation of food products. This organism is found predominantly in the fermentation of milk products and is mainly used for the manufacture of cheeses such as Grana and Provolone (8, 9, 29). Despite the industrial use and broad application of this thermophilic Lactobacillus species, the molecular biology of the microorganism is very poorly understood. Mollet and Pilloud (15) identified two genes involved in galactose utilization, galK and galT, in L. helveticus, but the genes coding for the other enzymes of the Leloir pathway of galactose metabolism, which in many LAB are organized in a single operon (4, 35), have not been found yet. Until now no information concerning the organization and location of lac genes in L. helveticus has been available. This presented a challenge to us to attempt to identify the genes involved. By employing several degenerate primers, self-ligation, and inverted PCR, we identified two partially overlapping genes encoding the L. helveticus ␤-galactosidase and a gene (with the opposite orientation) encoding a lactose permease. Downstream from the ␤-galactosidase genes we found another open reading frame (ORF) encoding a UDP-galactose 4 epimerase, and upstream from the lactose permease gene we found a regulatory gene encoding a protein belonging to the LacIGalR family. Here we describe the nucleotide sequences of these genes and the surrounding DNA regions and the results of transcriptional analyses.

The bioconversion of lactose into lactic acid is one of the principal metabolic events for which lactic acid bacteria (LAB) are employed in the dairy industry. During growth in milk good starter cultures produce lactic acid rapidly and reliably; thus, LAB viability depends on the ability of LAB to metabolize lactose. Today, due to recent developments in molecular biology applications, it is possible to improve existing fermentation processes by enhancing specific metabolic fluxes. Needless to say, doing this requires detailed metabolic and/or genetic knowledge. Genetic studies of the metabolic pathways for lactose utilization in the gram-positive LAB have revealed a variety of lac operons. In lactococci and some Lactobacillus casei strains (11, 22, 28) lactose transport and hydrolysis depend on a phosphoenolpyruvate-dependent phosphotransferase system combined with phospho-␤-galactosidase, and the relevant genes are plasmid encoded. A lactose permease system in which a ␤-galactosidase catalyzes sugar cleavage is the characteristic system of lactose uptake and hydrolysis found in Streptococcus thermophilus (10, 19), Lactobacillus bulgaricus (14), and Leuconostoc lactis (5, 33). The lac genes of S. thermophilus and L. bulgaricus are located chromosomally, whereas in Leuconostoc lactis a plasmid codes for ␤-galactosidase. Moreover, it is possible to find within a species (e.g., Lactococcus lactis or L. bulgaricus) some strains that have both ␤-galactosidase and phospho-␤-galactosidase activities (11). Also, the genomic organization of lac clusters and the gene order can vary. In S. thermophilus and L. bulgaricus the lactose transport genes (lacS) are organized like an operon, and the

* Corresponding author. Mailing address: Dipartimento di Scienze e Tecnologie Alimentari e Microbiologiche, Sezione di Microbiologia Industriale, Universita` degli Studi di Milano, Via Celoria 2, 20133 Milan, Italy. Phone: 39 02 50316692. Fax: 39 02 50316694. E-mail: [email protected]. 3238

LACTOSE GENES IN L. HELVETICUS

VOL. 69, 2003

3239

TABLE 1. Sequences and positions of the primers used in this study Primer

Locus

Position

Reference sequence accession no.

Sequence (5⬘ 3 3⬘)

B-gal R7 B-gal F9 B-gal F11 Perm F9 Perm Ra Epim Fb Epim Rl Reg F Reg R Perm F1A Perm FT Perm RX

␤-Galactosidase ␤-Galactosidase ␤-Galactosidase Lactose permease Lactose permease Lactose epimerase Lactose epimerase Lactose regulator Lactose regulator Lactose permease Lactose permease Lactose permease

2198–2217 1369–1389 2495–2514 2667–2686 3240–3259 32–51 949–968 18–37 972–991 29–48 1415–1435 518–538

AJ512877 AJ512877 AJ512877 AJ512878 AJ512878 AJ512879 AJ512879 AJ512880 AJ512880 AJ512878 AJ512878 AJ512878

GCACTTTTTGCATACTCGTG CACACCTCTATTCTCTTTTGG GTTCCGCAGGAAAATGGAAT CTTGGTGCCTTTTCAGGTAT ACAGTTACCAACAGAGCGAA ATATCGGCTCACATGCTGTT TGACTCTTGTGCCACTTCCA AATTGCGCTGGAATCAGGCT CGAAGCTTTTTCGTACTACC AAGTCATTTCCTATGCGTCC GATCGAAGATGGCAATTTACC CAACAATGATAGTTAGTCCGT

MATERIALS AND METHODS Bacterial strains and culture conditions. The L. helveticus strains used in this study include the type strain, ATCC 15009, and four strains previously isolated from Grana (ILC31) and Provolone (ILC54, ILC59, ILC60) cheese starters (8). The strains were grown at 42°C in MRS broth (Difco, Detroit, Mich.) unless indicated otherwise. DNA isolation and manipulation. Chromosomal DNA was extracted from L. helveticus strains as described previously (7). For plasmid DNA isolation the alkaline extraction procedure described by Anderson and McKay (3) was used. Further purification of plasmid DNA was performed by using previously described procedures (23). Restriction endonucleases and other enzymes employed for DNA manipulation were purchased from Boehringer (Mannheim, Germany) and were used according to the supplier’s specifications. Southern blot hybridization studies were carried out as previously described (7, 16). For the PCR, 100 ␮l of an overnight culture in MRS broth was added to 300 ␮l of 1⫻ TE buffer (10 mM Tris-HCl, 1 mM Na2EDTA; pH 8), and the DNA was extracted as described by Mora et al. (16). Selection of primers. On the basis of conserved regions identified by sequence comparison of the ␤-galactosidase and lactose permease gene products from Lactobacillus delbrueckii subsp. bulgaricus (accession number M55068), Lactobacillus acidophilus (AB004867), Leuconostoc lactis (M92281 and U47655), S. thermophilus (M63636 and M23009), Lactobacillus plantarum (AJ011859), L. sake (X82287), and Lactococcus lactis (U60828), a set of degenerate oligonucleotides were designed and used for PCR amplification of L. helveticus genes. The primers were designed so that most of the nucleotide similarity was at the 3⬘ end. All the primers were obtained from PRIMM s.r.l. (Milan, Italy). DNA amplification procedure. Each 25-␮l reaction mixture contained 200 ␮M dATP, 200 ␮M dCTP, 200 ␮M dGTP, 200 ␮M dTTP, 2.5 ␮l of 10⫻ reaction buffer (Amersham Pharmacia Biotech, Milan, Italy), 2.5 mM MgCl2, each primer at a concentration of 0.5 ␮M, 0.5 U of Taq polymerase (Amersham), and 1 ␮l of a bacterial DNA solution (containing about 100 ng of DNA) obtained as described above. All the amplification reactions were performed with a Gene Amp PCR System 2400 (Perkin-Elmer). The initial denaturation step at 94°C for 2 min was followed by 35 cycles of denaturation at 94°C for 45 s and annealing at 58°C for 45 s with extension at 72°C for 1 min. The final cycle was followed by an additional 7-min elongation period at 72°C. After amplification, 10 ␮l of the product was directly electrophoresed at 5 V cm⫺1 in a 1.5% agarose gel (with 0.2 ␮g of ethidium bromide ml⫺1) in TAE buffer (40 mM Tris-acetate, 1 mM EDTA; pH 8) and photographed in UV light. Nucleotide sequencing. The amplified products obtained by PCR were visualized by agarose gel electrophoresis and excised from the gel by using a NucleoSpin Extract extraction kit (Macherey-Nagel GmBH & Co., Du ¨ren, Germany). The nucleotide sequences were determined by using the dideoxy chain termination principle (24) and an ABI Prism Big Dye terminator kit (Applied Biosystems) with an ABI Prism310 DNA sequencer. Self-ligation and inverted PCR. For 4 h at 22°C, 80 ng of digested DNA was self-ligated in a 40-␮l reaction mixture containing 4 ␮l of 10⫻ ligation buffer and 20 U of DNA ligase (Promega Corp., Madison, Wis.); the low DNA concentration favored intramolecular circularization (18, 30). The reaction mixture was then heated at 75°C for 10 min to inactivate the DNA ligase. By using 1 to 2 ␮l of the ligation mixture as a template, a first inverted PCR was carried out with divergent primers to amplify the DNA sequences lying outside the boundaries of the known sequences. The reaction product was gel

electrophoresed to confirm the size expected by Southern analysis. At this point 0.1 ␮l of the PCR product was employed as a template in a nested PCR with a second pair of divergent primers to enhance the specificity. RNA isolation, RT-PCR, and Northern blotting. L. helveticus ATCC 15009T was grown in MRS broth containing 1% lactose, galactose, or glucose to an optical density at 600 nm of 0.5 to 0.75. Total RNA was isolated from the harvested cells and was purified further by using a NucleoSpin RNAII kit (Macherey-Nagel). Northern hybridization was carried out as described by Rivas et al. (20). ␤-Galactosidase-, lactose permease-, UDP-galactose 4 epimerase-, and lactose transcriptional regulator-specific probes were generated by PCR amplification by using primers B-gal F9 plus B-gal R7, primers Perm F9 plus Perm Ra, primers Epim Fb plus Epim Rl, and primers Reg F plus Reg R, respectively (Table 1). The probes were labeled as previously described (7). For the reverse transcriptase PCR (RT-PCR) analysis, first-strand cDNA synthesis was carried out as recommended by the RT supplier (Promega) by using 0.5 to 1.5 ␮g of total RNA per reaction mixture. Amplification was carried out essentially as described above with primers B-gal F9 plus B-gal R7, primers B-gal F11 plus Epim Rl, primers Perm F9 plus Perm Ra, primers Perm Ft plus Perm Ra, primers Perm F1a plus Perm Rx, primers Epim Fb plus Epim Rl, and primers Reg F plus RegR. (Table 1). Database search and sequence comparison. The database searches were performed by using the basic local alignment tool (BLAST) programs (1, 2) from the National Center for Biotechnology Information BLAST website. Multiple-sequence alignments were constructed by using DNASIS software (Hitachi Software Engineering Co. Ltd.). Nucleotide sequence accession numbers. The nucleotide sequences described here have been deposited in the GenBank database under accession numbers AJ512877 (lacLM), AJ512878 (lacS), AJ512879 (galE), and AJ512880 (lacR).

RESULTS AND DISCUSSION Organization and localization of L. helveticus lac region. The geography of the L. helveticus operon was established by determining the relative positions of the genes studied (Fig. 1). Computer analysis revealed the presence of three ORFs, which were oriented in the same direction. Two of these ORFs are partially overlapping genes that exhibit significant similarity to the known sequences of the ␤-galactosidase genes of L. acidophilus (71%) (accession number AB004867), Leuconostoc lactis (56%) (5), and L. sake (53%) (17). A low level of similarity (30%) was found with the ␤-galactosidase genes of L. bulgaricus (14) and S. thermophilus (25). We therefore designated the first ORF the L. helveticus lacL gene and the second ORF the L. helveticus lacM gene. The other ORF started 104 bp from the end of the lacM gene. We referred to this third ORF as the L. helveticus galE gene. The amino acid sequence encoded by this gene showed similarity to different UDP-galactose 4 epimerases. L. helveticus GalE exhibited the highest levels of similarity to GalE of L. casei (4) and S. thermophilus

3240

FORTINA ET AL.

APPL. ENVIRON. MICROBIOL.

FIG. 1. Organization of the genes involved in lactose utilization in L. helveticus ATCC 15009T. The grey arrows indicate the localization of the genes (the directions of transcription are indicated). The positions of potential promoters (arrows) and terminators (stem-loop structures) are indicated. The transcripts are represented by lines with arrowheads, and their estimated lengths (in kilobases) are indicated.

(31) (62% identity). It also exhibited significant similarity to GalE of Lactococcus lactis (34) and Bacillus halodurans (27) (58 and 51% identity, respectively). Upstream from lacL, with a divergent orientation, we found an ORF that exhibited significant homology to the transcriptional regulators designated lacR. Sequence analysis revealed that in the region downstream from the lacR gene there was an ORF that encoded a predicted amino acid sequence similar to the sequences of the lactose transport proteins, and for this reason we referred to this ORF as lacS. Sequencing of the lacR-lacS intercistronic region also indicated that there was another lacS gene, which was inactivated by a series of mutations that led to fragmentation of the gene in several ORFs in the different reading frames (lacS⬘). To establish the localization of the lac genes in L. helveticus, total DNAs of previously studied strains harboring two to five plasmids (9) were tested by Southern hybridization. The results indicated that the lac genes of L. helveticus ATCC 15009T were widespread in the species and chromosomally located (data not shown). The organization of these genes in L. helveticus is unique since it is the only occurrence of galE interspersed in a lactose utilization gene cluster and of a lactose permease gene located elsewhere and not cotranscribed with the genes responsible for ␤-galactosidase activity. Although gene order in the Leloir pathway may vary greatly and be species specific, galK, galT, and galE are clustered or organized into a single operon in many LAB (4, 35). Similarly, the genes for lactose utilization are usually grouped together (13, 32). For a Lactococcus lactis strain, workers have described a galKT-lacAZ-galE organization, with the lac genes interspersed in an operon with genes encoding enzymes used for galactose utilization (34). The opposite, which seems to be the case with L. helveticus, has not been described until now. Downstream from galE we found stretches of a putative insertion element (IS)-like structure (data not shown). This finding could suggest that there are remnants of a former IS, probably no longer active, that may have played a role in this gene organization. However, at this stage the data are insufficient to ascertain how galE gene acquisition occurs in the ␤-galactosidase gene cluster. It is also possible, as suggested by Mollet and Pilloud (15), that the gal gene cluster of L. helveticus evolved independently from single genes into distinct transcriptional units. Further research on the presence and role of the IS is under way.

Nucleotide sequence analysis. lacL is 1,887 bp long and encodes 628 amino acid residues with a calculated molecular mass of 73,475 Da. A putative ribosome binding site (5⬘ GAGG 3⬘) is located 7 bp upstream from the start codon. The tentative assignment of the ⫺10 and ⫺35 promoter regions is indicated in Fig. 2A. At 44 bp from the start codon we found a putative ⫺10 sequence, TATAAT, that is identical to the consensus sequence recognized by RNA polymerase, which was preceded by a ⫺35 sequence, TTGTTT, having conserved bases in common with the consensus sequence. DNA sequence analysis revealed that downstream from lacL, overlapping a 17-nucleotide area (Fig. 2A), was the lacM gene (975 bp), which started with an ATG codon at position 1870 and encoded a 318-amino-acid protein with a calculated molecular mass of 35,893 Da. A putative Shine-Dalgarno sequence, AG GAAG, was observed 12 bp upstream from the initiation codon. A search for ⫺10 and ⫺35 conserved sequences did not reveal any strong promoter sequences upstream from this gene. At 104 bp downstream from lacM, another ORF, which was 993 bp long and encoded a 330-amino-acid (36,427-Da) protein, was found, and this ORF was designated galE. The intergenic region, which lies between the stop codon at the end of the lacM gene and the start codon at the beginning of the galE gene, was found to contain the putative promoter sequences of an epimerase gene around an inverted repeat that forms a stem-loop structure, and it also contains a putative ribosome binding site 18 bp upstream from the start codon (Fig. 2B). Upstream from lacL, located in a divergent orientation, a 1,008-bp ORF designated lacR with a coding capacity of 335 amino acids was found. The LacR protein has a molecular mass of 37,753 Da and resembles a protein belonging to the transcriptional regulator family. It exhibits 35 and 25% identity with the LacR repressors of B. subtilis (12) and L. delbrueckii subsp. lactis (13) respectively, 28% identity with the GalR repressor of S. thermophilus (35), and 24% identity with the LacR activator of Staphylococcus xylosus (6). The helix-turnhelix DNA binding motif of the regulator family is present, indicating that lacR probably encodes the regulator of the lactose utilization genes. The start codon is preceded by a putative ribosome binding site (5⬘ GAAAAG 3⬘) 8 bp upstream. The 226-bp lacR-lacL intercistronic region, shown in Fig. 2C, contains the promoter sequences of both genes in a back-to back configuration. An inverted repeat structure and a

VOL. 69, 2003

LACTOSE GENES IN L. HELVETICUS

3241

FIG. 2. (A) Locations of a lacL putative ribosome binding site (rbs), ⫺35 and ⫺10 promoters, and overlapping coding regions of the lacL and lacM genes. (B) Nucleotide sequence of the lacM-galE intergenic region (the stop codon for the lacM gene and the start codon for the galE gene are at the two ends). The putative promoter regions for galE are underlined. An inverted repeat sequence is shown in the form of a base-paired hairpin loop. (C) Intergenic region containing the promoter sequences and the putative ribosome binding sites for the lacR and lacL genes. Both strands of the DNA are shown. (D) Nucleotide sequence of the lacR-lacS⬘ intergenic region containing the potential transcriptional terminator following the lacR gene (indicated by arrows) and the potential promoters of lacS⬘. A catabolite-responsive element-like (cre-like) sequence is underlined. (E) Locations of a lacS putative ribosome binding site, potential promoters, and a cre-like sequence. (F) Arrows indicate a region of dyad symmetry representing a putative terminator of transcription of lacS.

3242

FORTINA ET AL.

APPL. ENVIRON. MICROBIOL.

FIG. 3. Northern analysis of transcripts from the regions studied in L. helveticus ATCC 15009T. Lane 1, lactose-grown cells; lane 2, glucosegrown cells; lane 3, galactose-grown cells. (A) UDP-galactose 4 epimerase; (B) ␤-galactosidase; (C) lactose transcriptional regulator; (D) lactose permease.

stretch of five T residues that could function as a rho-independent transcriptional terminator followed the lacR gene sequence (Fig. 2D). The lacS gene, which is located 2,366 bp downstream from lacR, encodes a 638-amino-acid protein showing significant similarity to the lactose transport proteins; 53 and 35% of the residues of L. helveticus LacS are identical to residues of the lactose permeases of Leuconostoc lactis (33) and S. thermophilus (31), respectively. A putative ribosome binding site (5⬘ GGAGG 3⬘) was located 7 bp upstream from the start codon. Two 6-bp sequences resembling ⫺10 and ⫺35 consensus sequences of promoters were found 161 bp upstream from ATG (Fig. 2E). A nucleotide sequence that could generate a stem-loop structure was identified 120 bp downstream from the lacS stop codon; the calculated free energy of formation was ⫺8.65 kcal mol⫺1 (Fig. 2F). No ORF was found downstream as far away as 800 bp. The 2,366-bp intercistronic region that lies between the lacR and the lacS genes was found to contain several ORFs that seemed to be derived from fragmentation of another lactose permease gene (data not shown). Indeed, the region designated lacS⬘, which starts with an ATG codon that is 194 bp from the stop codon of lacR and stops with a TAG codon that is 266 bp before the start codon of lacS gene, showed 77% sequence similarity with the following complete permease gene. Deletion or insertion events could have led to premature stop signals, with the formation of four small ORFs in two different reading frames. A search for promoter sequences upstream from lacS⬘ revealed regions that resembled ⫺10 and ⫺35 sequences 87 bp upstream from ATG (Fig. 2D). A search within the lacS⬘ and lacS promoter regions revealed the presence of two cre-like elements located proximal to the ⫺10 box of each gene, suggesting that they are involved in transcriptional control

(Fig. 2D and E). These cre-like elements match the cre consensus sequence (36) in at least 12 of 14 positions. Transcriptional analyses. To determine the transcriptional organization and nature of induction of the genes studied, total RNA from glucose-, lactose-, and galactose-grown L. helveticus ATCC 15009T cells was analyzed by Northern hybridization (Fig. 3). When a probe for the galE gene was used, two dominant signals, corresponding to about 1.0- and 4.5-kb transcripts, were visible for lactose-grown cells (Fig. 3A). The 1.0-kb transcript was the expected size of a galE monocistronic mRNA, supporting the functional role of its own promoter and of the terminator following galE. The 4.5-kb transcript was a lacLlacM-galE polycistronic mRNA initiated from the putative promoter upstream from lacL and arrested at the terminator downstream from galE. A series of RT-PCR experiments, carried out with combinations of primers derived from the ends and interiors of the ORFs, demonstrated the presence of mRNA representing the three genes (data not shown). The transcripts were also present in RNA from glucose- and galactose-grown cells, but in this case the more intense and sharper signal was that corresponding to the 1.0-kb transcript. The presence of this transcript in glucose-grown cells suggests that the UDP-galactose 4 epimerase enzyme can have functions other than metabolism of galactose, and thus the enzyme could be constitutively expressed from its promoter. It is not unreasonable to assume that this enzyme has functions other than galactose metabolism and that the other functions are essential for cell viability. In different L. helveticus strains extracellular polysaccharides composed of D-glucose and D-galactose have been found (21, 26). Thus, in L. helveticus, as in other organ-

LACTOSE GENES IN L. HELVETICUS

VOL. 69, 2003

isms, the galE product could be involved in preparation of carbohydrate residues for incorporation into complex polymers, such as exopolysaccharides. When lacL and lacM probes were used, a dominant 4.5-kb transcript and a less intense signal corresponding to a 3.0-kb transcript were observed for the lactose-grown cultures (Fig. 3B). The sizes of the transcripts were in agreement with the lengths of a lacL-lacM-galE mRNA and a lacL-lacM mRNA, respectively. The stem-loop structure in the intergenic region between lacM and galE (⌬G ⫽ ⫺4.83 kcal mol⫺1) (Fig. 2B) could be responsible for mRNA processing due to its role in regulating the rate of expression of the galE gene relative to the lacLM genes. When the probe for lacR was used, a single signal at approximately 1.0 kb was obtained. The size of the transcript suggests that it was transcribed alone and supports the functional role of the terminator following lacR. As shown in Fig. 3C, only glucose induced lacR transcription, suggesting that the lacR gene product is a negative transcriptional regulator of the lactose utilization genes. No signals were visible when RNA from lactose- and galactose-grown cells was used. Two signals corresponding to 6.0- and 4.0-kb transcripts were detected in lactose-grown cells with the lacS probe (Fig. 3D). The 4.0-kb transcript was the size of an mRNA covering lacS⬘ and lacS, suggesting that the lacS gene and the defective lacS⬘ gene could be cotranscribed from the promoter upstream from lacS⬘. This suggestion was tested and confirmed by carrying out a series of RT-PCR experiments (data not shown). The 6.0-kb transcript could be an mRNA comprising lacS⬘-lacS and downstream sequences, even if the first 800 bp downstream of lacS appeared to be noncoding. Neither the importance nor the functional significance of this phenomenon is clear at present. ACKNOWLEDGMENT This work was supported by a grant from the Ministry of University and Technological and Scientific Research (MURST—PRIN 2001). REFERENCES 1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389–3402. 2. Altschul, S. F., W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410. 3. Anderson, D. G., and L. L. McKay. 1983. Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl. Environ. Microbiol. 46:549–552. 4. Bettenbrock, K., and C.-A. Alpert. 1998. The gal genes for the Leloir pathway of Lactobacillus casei 64H. Appl. Environ. Microbiol. 64:2013–2019. 5. David, S., H. Stevens, M. van Riel, G. Simons, and W. M. de Vos. 1992. Leuconostoc lactis ␤-galactosidase is encoded by two overlapping genes. J. Bacteriol. 174:4475–4481. 6. Egeter, O., and R. Bruckner. 1996. Catabolite repression mediated by the catabolite control protein CcpA in Staphylococcus xylosus. Mol. Microbiol. 21:739–749. 7. Fortina, M. G., G. Ricci, D. Mora, C. Parini, and P. L. Manachini. 2001. Specific identification of Lactobacillus helveticus by PCR with pepC, pepN and htrA targeted primers. FEMS Microbiol. Lett. 198:85–89. 8. Fortina, M. G., G. Nicastro, D. Carminati, E. Neviani, and P. L. Manachini. 1998. Lactobacillus helveticus heterogeneity in natural cheese starters: the diversity in phenotypic characteristics. J. Appl. Microbiol. 84:72–80. 9. Giraffa, G., P. De Vecchi, P. Rossi, G. Nicastro, and M. G. Fortina. 1998. Genotypic heterogeneity among Lactobacillus helveticus strains isolated from natural cheese starters. J. Appl. Microbiol. 85:411–416. 10. Herman, R. E., and L. L. McKay. 1986. Cloning and expression of the ␤-D-galactosidase gene from Streptococcus thermophilus in Escherichia coli. Appl. Environ. Microbiol. 52:45–50.

3243

11. Hickey, M. W., A. J. Hillier, and G. R. Jago. 1986. Transport and metabolism of lactose, glucose, and galactose in homofermentative lactobacilli. Appl. Environ. Microbiol. 51:825–831. 12. Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin, et al. 1997. The complete genome sequence of the grampositive bacterium Bacillus subtilis. Nature 390:249–256. 13. Lapierre, L., B. Mollet, and J.-E. Germond. 2002. Regulation and adaptive evolution of lactose operon expression in Lactobacillus delbrueckii. J. Bacteriol. 184:928–935. 14. Leong-Moegenthaler, P., M. C. Zwahlen, and H. Hottinger. 1991. Lactose metabolism in Lactobacillus bulgaricus: analysis of the primary structure and expression of the genes involved. J. Bacteriol. 173:1951–1957. 15. Mollet, B., and N. Pilloud. 1991. Galactose utilization in Lactobacillus helveticus: isolation and characterization of the galactokinase (galK) and galactose-1-phosphate uridyl transferase (galT) genes. J. Bacteriol. 173:4464–4473. 16. Mora, D., C. Parini, M. G. Fortina, and P. L. Manachini. 2000. Development of molecular RAPD marker for the identification of Pediococcus acidilactici strains. Syst. Appl. Microbiol. 23:400–408. 17. Obst, M., E. L. Meding, R. F. Vogel, and W. P. Hammes. 1995. Two genes encoding the ␤-galactosidase of Lactobacillus sake. Microbiology 141:3059–3066. 18. Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621–623. 19. Poolman, B., T. J. Royer, S. E. Mainzer, and B. F. Schmidt. 1989. Lactose transport system of Streptococcus thermophilus: a hybrid protein with homology to the melibiose carrier and enzyme III of phosphoenolpyruvate-dependent phosphotransferase system. J. Bacteriol. 171:244–253. 20. Rivas, R., N. Vizcaino, R. M. Buey, P. F. Mateos, E. Martinez-Molina, and E. Vela `zuez. 2001. An effective, rapid and simple method for total RNA extraction from bacteria and yeast. J. Microbiol. Methods 47:59–63. 21. Robijn, G. W., J. R. Thomas, H. Haas, D. J. van den Berg, J. P. Kamerling, and J. F. Vliegenthart. 1995. The structure of the exopolysaccharide produced by Lactobacillus helveticus 766. Carbohydr. Res. 276:137–154. 22. Romano, A. H., J. D. Trifone, and M. Brustolon. 1979. Distribution of the phosphoenolpyruvate:glucose phosphotransferase system in fermentative bacteria. J. Bacteriol. 139:93–97. 23. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 24. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467. 25. Schroeder, C. J., C. Robert, G. Lenzen, L. L. McKay, and A. Mercenier. 1991. Analysis of the lacZ sequences from two Streptococcus thermophilus strains: comparison with the Escherichia coli and Lactobacillus bulgaricus beta-galactosidase sequences. J. Gen. Microbiol. 137:369–380. 26. Staaf, M., Z. Yang, E. Huttunen, and G. Widmalm. 2000. Structural elucidation of the viscous exopolysaccharide produced by Lactobacillus helveticus Lb161. Carbohydr. Res. 326:113–119. 27. Takami, H., K. Nakasone, C. Hirama, Y. Takaki, N. Masui, F. Fuji, Y. Nakamura, and A. Inoue. 1999. An improved physical and genetic maps of the genome of alkaliphilic Bacillus sp. C-125. Extremophiles 3:21–28. 28. Thompson, J. 1978. In vivo regulation of glycolysis and characterization of sugar:phosphotransferase system in Streptococcus lactis. J. Bacteriol. 136: 465–476. 29. Torriani, S., M. Vescovo, and G. Scolari. 1994. An overview on Lactobacillus helveticus. Ann. Microbiol. 44:163–191. 30. Triglia, T., M. G. Peterson, and D. J. Kemp. 1988. A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res. 16:81–86. 31. Vaillancourt, K., S. Moineau, M. Frenette, C. Lessard, and C. Vadeboncoeur. 2002. Galactose and lactose genes from the galactose-positive bacterium Streptococcus salivarius and the phylogenetically related galactosenegative bacterium Streptococcus thermophilus: organization, sequence, transcription, and activity of the gal gene product. J. Bacteriol. 184:785–793. 32. van Rooijen, R. J., M. J. Gasson, and W. M. de Vos. 1992. Characterization of the Lactococcus lactis lactose operon promoter: contribution of flanking sequences and LacR repressor to promoter activity. J. Bacteriol. 174:2273–2280. 33. Vaughan, E. E., S. David, and W. M. de Vos. 1996. The lactose transporter in Leuconostoc lactis is a new member of the LacS subfamily of galactosidepentose-hexuronide translocators. Appl. Environ. Microbiol. 62:1574–1582. 34. Vaughan, E. E., R. D. Pridmore, and B. Mollet. 1998. Transcriptional regulation and evolution of lactose genes in the galactose-lactose operon of Lactococcus lactis NCDO2054. J. Bacteriol. 180:4893–4902. 35. Vaughan, E. E., P. T. C. van den Bogaard, P. Catzeddu, O. P. Kuipers, and W. M. de Vos. 2001. Activation of silent gal genes in the lac-gal regulon of Streptococcus thermophilus. J. Bacteriol. 183:1184–1194. 36. Weickert, M. J., and G. H. Chambliss. 1990. Site-directed mutagenesis of a catabolite repressor operator sequence in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 87:6238–6242.