Leader switching occurs during the rescue of ... - Semantic Scholar

Journal of General Virology (2000), 81, 791–801. Printed in Great Britain ...................................................................................................................................................................................................................................................................................

Leader switching occurs during the rescue of defective RNAs by heterologous strains of the coronavirus infectious bronchitis virus Kathleen Stirrups,† Kathleen Shaw, Sharon Evans, Kevin Dalton,‡ David Cavanagh and Paul Britton Division of Molecular Biology, Institute for Animal Health, Compton Laboratory, Compton, Newbury, Berkshire RG20 7NN, UK

A defective RNA (D-RNA), CD-61, derived from the Beaudette strain of the avian coronavirus infectious bronchitis virus (IBV), was rescued (replicated and packaged) using four heterologous strains of IBV as helper virus. Sequence analysis of the genomic RNA from the four heterologous IBV strains (M41, H120, HV10 and D207) identified nucleotide differences of up to 17 % within the leader sequence and up to 4n3 % within the whole of the adjacent 5' untranslated region (UTR). Analysis of the 5' ends of the rescued D-RNAs showed that the Beaudette leader sequence, present on the initial CD-61, had been replaced with the corresponding leader sequence from the helper IBV strain but the adjacent 5' UTR sequence of the rescued D-RNAs corresponded to the original CD-61 Beaudette sequence. These results demonstrated that the phenomenon of leader switching previously identified for the coronaviruses murine hepatitis virus and bovine coronavirus (BCoV) also occurred during the replication of IBV D-RNAs. Three predicted stem–loop structures were identified within the 5' UTR of IBV. Stem–loop I showed a high degree of covariance amongst the IBV strains providing phylogenetic evidence that this structure exists and is potentially involved in replication, supporting previous observations that a BCoV stem–loop homologue was essential for replication of BCoV defective interfering RNAs.

Introduction Avian infectious bronchitis virus (IBV) is a member of the genus Coronavirus (order Nidovirales, family Coronaviridae). IBV primarily grows in the epithelial cells of the respiratory tract causing respiratory disease and retarded growth with reduced egg production, making it the most important poultry respiratory pathogen. Coronaviruses are enveloped RNA viruses with unsegmented single-stranded, positive-sense RNA genomes of 27–32 kb that are 5h capped and 3h polyadenylated (Siddell, 1995 ; de Vries et al., 1997 ; Lai & Cavanagh, 1997). The 5h twothirds of coronavirus genomes encode the polymerase gene Author for correspondence : Paul Britton. Fax j44 1635 577263. e-mail paul.britton!bbsrc.ac.uk † Present address : University of Cambridge, Department of Haematology, Division of Transfusion Medicine, Long Road, Cambridge CB2 2PT, UK. ‡ Present address : Departments of Pathology and Cell Biology (BML 342), Yale University School of Medicine, 310 Cedar St, New Haven, CT 06510, USA.

0001-6708 # 2000 SGM

producing two polyproteins, Pol1a and Pol1ab, the latter resulting from a k1 frameshift. During coronavirus replication a 3h-coterminal nested set of subgenomic mRNAs is synthesized that encodes other virus proteins. Each subgenomic mRNA has a short non-translated leader sequence (60–90 nt), derived from the 5h end of the genome by a discontinuous process. IBV has a genome of 27 608 nt (Boursnell et al., 1987) which produces six subgenomic mRNAs, each containing a 64 nt leader sequence. Two models have been proposed for the discontinuous mechanism for the addition of coronavirus leader sequences, leader-primed transcription and discontinuous transcription during negative-strand synthesis (Sawicki & Sawicki, 1990 ; van der Most & Spaan, 1995 ; Brian & Spaan, 1997 ; Lai & Cavanagh, 1997). Both models require the presence of a consensus sequence, which we previously termed the transcriptionassociated sequence (TAS ; Hiscox et al., 1995), on the genomic sequence, required for leader sequence acquisition during synthesis of subgenomic mRNAs. Following high multiplicity passage of coronaviruses, defective RNAs (D-RNAs) or in some cases defective interfering RNAs (DI-RNAs), have been found to be produced ; they lack large internal parts of the genome, have complete 5h HJB

K. Stirrups and others

and 3h UTRs and require helper virus for replication. The internal deletions result in the fusion of different regions of the polymerase gene and varying amounts of the N gene (Makino et al., 1988 b, 1990 ; van der Most et al., 1991 ; Chang et al., 1994 ; Pe! nzes et al., 1994 ; Mendez et al., 1996). Makino et al. (1986) demonstrated that leader sequences from different murine hepatitis virus (MHV) strains can be exchanged during a mixed infection, indicating that there is some interaction of the MHV polymerase between the heterologous RNAs during replication. Initial work by Makino et al. (1988 a) to determine whether leader sequences can be switched between helper virus and an MHV DI-RNA failed to demonstrate this event using naturally occurring MHV JHMderived DI-RNAs rescued with MHV A59. All the naturally occurring MHV JHM-derived DI-RNAs had a 9 nt deletion, UUUAUAAAC, downstream of the leader sequence. Replacement of the 9 nt sequence in an MHV JHM-derived DIRNA, DIssE, resulted in a modified DI-RNA, DE5-w3, that was able to leader switch following rescue with MHV A59 (Makino & Lai, 1989). This phenomenon of an MHV DI-RNA acquiring the leader sequence of the helper virus was termed leader switching and was believed to be the result of a high-frequency recombination event (Makino & Lai, 1989). The second coronavirus system from which D-RNAs were isolated involved the Mebus strain of bovine coronavirus (BCoV ; Hofmann et al., 1990). A synthetic BCoV DI-RNA, derived from a naturally occurring Mebus DI-RNA, was modified by the introduction of specific point mutations within the leader sequence to determine their potential effect(s) on replication of the DI-RNA (Chang et al., 1994). All the mutations appeared to affect replication only minimally, following rescue with homologous Mebus helper virus. However, analysis of the leader sequences on the rescued D-RNAs showed that they had all reverted to the wild-type, Mebus, leader sequence (Chang et al., 1994). In a recent review (Brian & Spaan, 1997) the authors proposed that an AU-rich region, immediately downstream of the leader junction sequence at the 5h ends of BCoV and MHV DI-RNAs, is involved in leader switching. The authors also indicated that a similar AU-rich region is also present downstream of the leader junction sequence on DI-RNAs of the porcine coronavirus transmissible gastroenteritis virus (TGEV ; Mendez et al., 1996) but not on D-RNAs of IBV (Pe! nzes et al., 1994). These observations led the authors to raise the question as to whether leader switching could occur on IBV D-RNAs. At that time the phenomenon of leader switching had not been demonstrated for DI-RNAs from TGEV or DRNAs from IBV.

Methods

Virus and cells. IBV strains Beaudette, M41, HV10 and H120 (Darbyshire et al., 1979) and D207 (Davelaar et al., 1984) were adapted for growth in primary chick kidney (CK) cells and stocks made in 11-day-old embryonated domestic fowl eggs at 37 mC [harvested from allantoic fluid HJC

at 20 h post-infection (p.i.)] or in CK cells. RNA derived from all five IBV strains was analysed for the presence of endogenous D-RNAs and found to be D-RNA free and was therefore used for the rescue of IBV D-RNA CD-61 (Pe! nzes et al., 1996). The passage and growth of IBV in CK cells was as described previously (Pe! nzes et al., 1994).

Oligonucleotides. The oligonucleotides used in this study were obtained from Cruachem or MWG-Biotech and are listed in Table 1.

Recombinant DNA techniques. Procedures for recombinant DNA techniques were either standard (Ausubel et al., 1987 ; Sambrook et al., 1989) or according to manufacturersh instructions. RT–PCRs and PCRs were as described previously (Pe! nzes et al., 1994, 1996). Sequence determination of plasmid DNA and PCR products was as described previously (Pe! nzes et al., 1994 ; Hiscox et al., 1995).

Sequences analysis of the 5h end of IBV genomic RNA. IBV genomic RNA, from strains M41, HV10, H120 or D207, was extracted from virions grown in embryonated eggs (Kottier et al., 1995). A slightly modified version of the cRACE method (Maruyama et al., 1995) was used to determine the very 5h ends of the IBV genomic RNAs. Essentially, 1 µg of each viral RNA was copied into single-stranded cDNAs (402 nt) using oligonucleotide K5UTR-2 and Superscript II RNase H− reverse transcriptase (200 U ; GibcoBRL) at 47 mC for 2 h. The RNA–DNA hybrids were incubated with RNase H (4 U ; GibcoBRL) at 37 mC for 20 min and the cDNAs purified on GLASSMAX (GibcoBRL) spin columns. The cDNAs were eluted using 50 µl H O at 65 mC and # circularized using T4 RNA ligase (1 U ; USB) in 50 mM Tris–HCl (pH 7n5), 10 mM MgCl , 10 mM DTT, 1 mM ATP and 60 µg\ml BSA at # 17 mC for 18 h. The reaction was terminated by the addition of EDTA to a final concentration of 20 mM. The circularized cDNAs were used as templates for PCRs across the ligated ends using oligonucleotides 93\137 and 18A with Pfu DNA polymerase (Stratagene). The PCR products (280 bp) were sequenced, using oligonucleotide 93\137, either directly or following ligation into EcoRV-digested pBluescript SK from which several IBV-derived cDNAs were sequenced. This method produced sequence data corresponding to nt 1–151 of the genomic RNAs. To determine sequence data beyond nt 151 each viral RNA was copied into cDNA by RT–PCR using Pfu DNA polymerase (Stratagene). Different oligonucleotide pairs were utilized depending on the IBV strain, i.e. oligonucleotides 42j93\102 and 94\155jK5UTR-3 were used for HV10 ; 5deg-vej43 for H120 ; and 93\101j93\102 and 94\155j K5UTR-3 for D207. The PCR products were sequenced either directly or from cloned DNA from which several IBV-derived cDNAs were sequenced.

In vitro transcription and electroporation of primary CK cells. RNA corresponding to IBV D-RNA CD-61 was synthesized in vitro from 2 µg NotI-linearized pCD-61 (Pe! nzes et al., 1996) in a total volume of 40 µl. This was done using 40 U T7 RNA polymerase (Promega) in 40 mM Tris–HCl (pH 7n5), 6 mM MgCl , 2 mM sperm# idine, 10 mM NaCl, 30 nmol each of ATP, UTP, CTP and GTP, 400 nmol DTT, 40 U RNasin (Promega) at 37 mC for 2 h. CK cells were grown to 80–90 % confluence in 25 cm# tissue culture flasks (Falcon) and infected with 0n5 ml egg-grown IBV helper virus or 1 ml of CK-grown D207 virus. At 8 h p.i. the cells were washed twice with PBSa (172 mM NaCl, 3 mM KCl, 100 mM Na HPO , 2 mM KH PO , pH 7n2), once with # % # % trypsin–versene (0n03 % trypsin in 0n5 mM EDTA). The IBV-infected cell sheets were disrupted using 1 ml trypsin–versene for 3–5 min at 37 mC, followed by addition of 0n3 ml 10 % newborn calf serum, cooled on ice, centrifuged at 2500 r.p.m. for 3 min and the cells resuspended in 0n3 ml ice-cold PBSa. Transcription reactions (40 µl) were mixed with the resuspended IBV-infected cells in 0n4 cm electroporation cuvettes (Invitrogen) for electroporation at 220 V using a BTX Electro Cell

Leader switching in IBV defective RNAs

Table 1. Oligonucleotides used Oligonucleotide

Sequence*

Position†

Polarity‡ Purpose

94\155 43 93\102 93\137

GAAGGATCCATTAATACGACTCACTATAGGGACTTAAGATAGATATTAATATAT GGGCCCACTTAAGATAGATATTAATATA GCTGGTCCTCATAGGTGTTC TGACAGGTGGCCAGGTGC

1–23 1–22 85–104 134–151

j j j k

K5UTR-1 18A K5UTR-2

CTAGGTAGCCCAAGCAAC GGCGGATCCCGGGCGTCGTGGCTGG CTCAAAAGCCCTTAGAGG

223–240 255–270 385–402

k j k

K5UTR-3 93\106 93\120 5deg-ve 95\165 42 93\101 ST4 93\136 N1145 93\100

GTCTGCTCACTAAACACCAC GGCAGAAGTTTGACCGTAG CGCGCTAAAGGAGAGACAC CCAYTGRCATGCTGT‡ GGATGCTCTGGGCTCATAGTAGAGTGCTCTTTTTC CCTCTCCAAGCACTGCTG GTCTTGCCCGGGTTGGTTTTCTGGAAGTG CTAGCGCAGTTACGCTTCAA GTCCCATTTTAGCCAACATG AGAGGAACAATGCACAGCTGG CAGGATATCGCTCTAACTCTATACTAGCCT

492–501 674–692 833–851 874–888 1040–1074 1997–2014 2402–2420 12 471–12 490 12 857–12 876 27 017–27 037 27 587–27 607

k j k k j k k k k j k

RT–PCR RT–PCR RT–PCR RT–PCR, sequencing Sequencing RT–PCR RT–PCR, sequencing Sequencing RT–PCR Sequencing RT–PCR Sequencing RT–PCR RT–PCR Sequencing RT–PCR RT–PCR RT–PCR

* Underlined regions represent non-IBV sequence. † Refers to the position of the nucleotides in the Beaudette sequence (Boursnell et al., 1987). ‡ Degenerate oligonucleotide, in which Y l C or T and R l A or G.

Fig. 1. Schematic diagram to outline the rescue of IBV D-RNAs. The CK cells (P0) were infected with helper IBV and at 8 h p.i. they were prepared for electroporation with in vitro T7-transcribed CD-61 RNA. The electroporated cells were incubated at 37 mC for 16 h (to 24 h p.i.). Virus (V1) in the supernatants of the infected cells was used to infect CK cells (P1) and after 20–24 h p.i. virus (V2) in the supernatants was used to infect CK cells (P2). This was repeated for several passages. Total cellular RNA was extracted from the infected cells (P1–P7) for either Northern blot analysis or for RT–PCR and sequence analysis.

Manipulator (model ECM-395). The electroporated IBV-infected cells were placed on ice for 5 min, diluted 1 : 10 in CK cell medium (Pe! nzes et al., 1994), transferred onto tissue culture plates and incubated at 37 mC for 16 h. Virus (V ) in 1 ml of the supernatants was used to infect CK cells " and after 20–24 h p.i. virus (V ) from the supernatants was passaged on # CK cells. This was repeated up to five more passages, V –V . RNA was $ ( isolated from cells (P –P ) infected with each virus (V –V ) passage as " ( " ( outlined in Fig. 1.

Isolation and Northern blot analysis of IBV-derived RNA. Total cellular RNA was extracted from the IBV-infected CK cells using guanidinium isothiocyanate (Pe! nzes et al., 1994). The RNAs were separated in denaturing 1 % agarose–2n2 M formaldehyde gels (Sambrook et al., 1989) and Northern blotted onto Hybond-C extra 0n45 µm nitrocellulose membranes (Amersham). IBV-specific RNAs were detected by hybridization to a mixture of $#P-labelled PCR fragments (590 bp) generated from the five IBV strains using oligonucleotides N1145 and 93\100, corresponding to nt 27017–27607 at the 3h end of the IBV genome. The PCR fragments were labelled with [$#P]dCTP using the random oligonucleotide-primed synthesis method (Feinberg & Vogelstein, 1983).

Sequence analysis of IBV D-RNAs. Total cellular RNA extracted from P -infected CK cells containing the D-RNAs, CD-61, CD61M41, ( CD61H120, CD61HV10 and CD61D207 rescued with helper IBVs, Beaudette, M41, H120, HV10 or D207, respectively, was used for RT–PCRs, using oligonucleotide 93\136 for the RT reactions. A variety of oligonucleotides was used for the PCRs to : (a) distinguish D-RNAs from either genomic RNA or subgenomic mRNAs and to confirm the adenosine deletion at nt 749 (A-749) of CD-61 [a characteristic of the DRNA (Pe! nzes et al., 1994)] and (b) to characterize the leader sequence and adjacent 5h UTR on the rescued D-RNAs. The PCRs for (a) used oligonucleotides 93\136 and 93\106, which result in a fragment of 910 bp spanning domains I and II of D-RNA CD-61 (Pe! nzes et al., 1994). Oligonucleotide 93\120 was used to sequence part of the 910 bp PCR fragment to confirm the absence of A-749. Oligonucleotides 95\165 and ST4 were used to sequence the domain I\II junction within the 910 bp PCR fragment. The PCRs for (b) used oligonucleotides 93\136 and 94\155, which resulted in a fragment of 1n6 kb extending from within HJD


Fig. 2. Alignment of the first 376 nt from cDNA sequences derived from the 5h end of the genomic RNA of five strains of IBV to identify potential differences between the leader and adjacent 5h UTR sequences. The leader junction sequence, CTTAACAA, is the point differentiating the leader and adjacent 5h UTR sequences. The figure was generated using GeneDoc in which uppercase letters in the consensus sequence, below the alignments, relate to complete conservation of the nucleotides. The level of shading relates to the degree of conservation, i.e. 100 % conservation black and less than 60 % conservation white. The leader sequence is denoted by a solid black line and the leader junction sequence is boxed.

domain II of CD-61 to nt 23 from the 5h end of D-RNA CD-61. Oligonucleotides 93\137, K5UTR-1, K5UTR-2 and K5UTR-3 were used to sequence nt 24–342 of the rescued D-RNAs.

Computer analysis of sequence data. Sequence data were assembled using Gap4 of the Staden Sequence Software Programs HJE

(Bonfield et al., 1995). Sequences were aligned using ClustalX version 1.64b (Thompson et al., 1997) and the alignments analysed using GeneDoc version 2.5 (Nicholas & Nicholas, 1997). Identification of potential RNA structures was determined using RNAdraw version 1.1 (Matzura & Wennborg, 1996) and MFOLD (Zuker & Stiegler, 1981 ;

Leader switching in IBV defective RNAs Jaeger et al., 1989, 1990 ; Zuker, 1989 a, b). The MFOLD program used was part of the Wisconsin package (GCG version 9.0 UNIX software ; Genetics Computer Group Inc., 1997) (Devereux et al., 1984). Both types of analyses work on the basis of free-energy minimization.

Results Sequence analysis of the 5h UTR of IBV genomes

To investigate whether the phenomenon of leader switching occurs during the rescue of IBV D-RNAs we decided to use the IBV Beaudette-derived D-RNA CD-61 for rescue with four heterologous IBV strains. This system has the advantage over the MHV and BCoV systems, for which coronavirus leader switching had been previously shown, because the IBV D-RNA is unmodified within the 5h UTR. Three of the heterologous strains, M41, HV10 and H120, belong to the same serotype, Massachusetts, as Beaudette from which CD-61 was derived, based on either serology of the spike (S) protein (Darbyshire et al., 1979) or S gene sequence identity determined from Beaudette (Binns et al., 1985 ; Boursnell et al., 1987), M41 (Binns et al., 1986 ; Niesters et al., 1986) and H120 (Kusters et al., 1989). The fourth heterologous strain, D207, is of a different antigenic serotype to the Massachusetts strains based on serology of the S protein (Davelaar et al., 1984) and S gene sequence (Kusters et al., 1989). Serotyping of IBV strains is entirely based on the S protein\gene and therefore any similarities between the viruses may not be reflected in nucleotide sequences over other regions of the genome. To confirm whether leader switching occurs during the rescue of IBV D-RNAs we needed to identify potential nucleotide differences, within the leader and adjacent 5h UTR sequences, between the IBV strains. The potential substitutions had to be sufficiently different to act as markers capable of distinguishing resultant sequences, derived from any leader switching events, from both the helper virus and the D-RNA CD-61. Sequences (nt 1–151) of the 5h ends of the genomic RNAs were determined for the four heterologous IBV strains using cRACE (Maruyama et al., 1995). Further genomic sequence, following nt 151, was determined from IBV strains HV10, H120 and D207 by RT–PCR. The genomic sequences (nt 1–376) obtained as described here and from previously derived sequence data, for M41 (Pe! nzes, 1995) and Beaudette (Boursnell et al., 1987), were aligned. Comparison of the aligned sequences identified a variety of nucleotide substitutions between the IBV sequences (Fig. 2). M41 had 3 (4n7 %) and 4 (1n3 %), HV10 had 11 (17n2 %) and 11 (3n5 %), H120 had 3 (4n7 %) and 19 (6n1 %) and D207 had 11 (17n2 %) and 8 (2n6 %) substitutions within the leader and adjacent 5h UTR sequences, respectively, when compared to the Beaudette sequence. This indicated, except for strain H120, that the proportion of substitutions was higher within the leader sequence than the adjacent 5h UTR. The percentage differences of the complete heterologous IBV 5h UTRs (nt

Fig. 3. Analysis of IBV-specific RNAs following the rescue of electroporated in vitro T7-transcribed CD-61 RNA into IBV-infected CK cells. CK cells were infected with IBV strains (lane 1, Beaudette ; 2, M41 ; 3, HV10 ; 4, D207 ; 5, H120 helper virus) and at 8 h p.i. the cells were electroporated with the in vitro T7-transcribed CD-61 RNA. The cells were incubated for 16 h and virus (V1) in the supernatants was used to infect CK cells. The cells were incubated for 20–24 h and progeny virus (V2) was used to infect CK cells. This was repeated, generating V3–V7 virus. Total cellular RNA from the infected cells at each passage (P1–P7) was isolated. The total cellular RNA from P7 was electrophoresed in denaturing formaldehyde–agarose gels, and hybridized with 32P-labelled PCRgenerated cDNAs derived from the 3h UTR of seven different IBV strains. The IBV subgenomic mRNAs, genomic RNA and CD-61 D-RNA are indicated. The IBV mRNAs marked S, E, M and N express the virion proteins spike, envelope, membrane and nucleoprotein, respectively. The smaller molecular mass mRNAs, particularly mRNAs 3–6, of IBV M41 migrated faster than those of the other strains because of a 184 nt deletion in the 3h UTR. The gel was overexposed so that the low abundance mRNA 3 can be observed. The RNAs detected between mRNAs 4 and 5 and below mRNA 6 are routinely observed from all strains of IBV, as originally identified by Stern & Kennedy (1980), and are of unknown origin.

1–528) compared to the Beaudette sequence were 0n9 % (M41), 2n8 % (HV10), 4n3 % (H120) and 1n7 % (D207) (data not shown), confirming that there were fewer substitutions within the complete adjacent 5h UTR when compared to the leader sequences. It should be noted that nucleotide substitutions between Beaudette and the four heterologous viruses over other regions of the genome range between 10–20 %. Some of the substitutions within the leader and adjacent 5h UTR sequences, when compared to the Beaudette sequence, were present in more than one strain of IBV (Fig. 2). However, HJF


Fig. 4. For legend see facing page.

HJG


some of the substitutions were strain-specific, i.e. HV10, H120 and D207 had 1, 10 and 4 substitutions, respectively, unique to their particular sequence. Therefore, the substitutions present on a particular sequence and their distribution between the leader sequence and the adjacent 5h UTR, when compared to the Beaudette sequence, were sufficient to differentiate leader and adjacent 5h UTR sequence combinations. Rescue of D-RNA CD-61 using heterologous IBV helper strains

To investigate whether the heterologous IBV strains would support replication of the Beaudette-derived CD-61 D-RNA, CK cells were infected with the heterologous strains of IBV and electroporated with in vitro T7-transcribed CD-61 D-RNA. Progeny virus (V ) was serially passaged on CK cells, " generating progeny virus V –V (Fig. 1). Total cellular RNA # ( was extracted from CK cells (P –P ) previously infected with " ( V –V virus and examined by Northern blot analysis. An RNA " ( species, corresponding to the size of D-RNA CD-61, was identified in the RNA isolated from P –P CK cells infected # ( with the four heterologous strains. The IBV RNAs isolated from P -infected cells are shown in Fig. 3 ; however, it should ( be noted that the passage number for either initially observing rescue of the D-RNA or detecting the highest amount of DRNA varied depending on the helper strain used (data not shown). The system was not optimized for the rescue of the DRNA and was therefore only semi-quantitative. Hence, as can be seen from Fig. 3, the amounts of CD-61 rescued in the P ( cells varied depending on the heterologous helper virus used, rescue efficiency being least with strain D207. We cannot rule out the possibility of some incompatibility between the sequences involved in either replication or packaging, of the Beaudette-derived D-RNA, and those present in the helper virus D207, resulting in a lower efficiency of rescue. RT–PCR, using oligonucleotides 93\136 and 93\106, was used to determine whether the 6n1 kb RNA, isolated from P ' CK cells infected with each IBV helper strain, corresponded to D-RNA CD-61. The product of the two oligonucleotides spans the junction of domains I and II of CD-61 (Pe! nzes et al., 1996), resulting in a 910 bp DNA fragment if derived from CD-61 or 12n2 kb from genomic RNA. RT–PCR DNA products of 910 bp were generated from RNA isolated from P ' CK cells infected with each heterologous helper strain, indicating that CD-61 D-RNA was present in each cell extract,

confirming the Northern blot data. Sequence analysis confirmed that the 910 bp RT–PCR products had sequences identical to the domain I\II junction in D-RNA CD-61. Further analysis confirmed that the A-749 nucleotide deletion, initially identified in IBV D-RNA CD-91 (Pe! nzes et al., 1994) from which CD-61 was derived (Pe! nzes et al., 1996), occurred in the D-RNAs rescued by the heterologous helper viruses. These results confirmed that the 6n1 kb RNA, rescued by all four heterologous IBV strains, represented D-RNA CD-61, despite the observed nucleotide substitutions within the leader and adjacent 5h UTR sequences. Analysis of D-RNA CD-61 leader sequences following rescue by heterologous helper viruses

RNA was isolated from P CK cells and analysed by ' RT–PCR using oligonucleotides 93\136 and 94\155. Oligonucleotide 94\155 corresponded to nt 1–23 of the Beaudette genome. The 1n59 kb RT–PCR products represented sequences derived from the rescued D-RNAs from nt 24 in the leader sequence to within domain II. Sequences representing nt 24–64 of the leader and nt 65–342 of the adjacent 5h UTR sequences were determined from the 1n59 kb RT–PCR products. The 318 nt sequences, derived from D-RNAs CD61M41, CD61H120, CD61HV10 and CD61D207, rescued with the heterologous IBV strains M41, H120, HV10 and D207, respectively, were compared to the corresponding genomic and Beaudette sequences. The results showed that all the rescued D-RNAs had leader sequences corresponding to the specific helper virus and not Beaudette-derived CD-61 sequence (Fig. 4). In contrast, nt 65–342 of the adjacent 5h UTR sequences corresponded to Beaudette sequence and were therefore derived from CD-61 (Fig. 4). The only exception was that D-RNA CD61D207, rescued with D207, had a thymidine residue at nt 94, which corresponded to D207 genomic sequence, and not a cytosine residue corresponding to Beaudette sequence. None of the D207-specific nucleotide substitutions, downstream of nt 94 in the D207 genomic sequence, were present in the rescued CD61D207 sequence. Nucleotide 94 is the first substitution in the adjacent 5h UTR sequence of the D207 genomic sequence 30 nt from the leader junction sequence. Our results demonstrated that leader switching occurred during rescue of CD-61 by the four heterologous IBV strains. The exact crossover points for leader switching could not be

Fig. 4. Alignment of the first 342 nt from cDNA sequences derived from the 5h ends of the rescued IBV D-RNA CD-61 following electroporation of in vitro synthesized T7-transcripts into CK cells infected with different strains of helper IBV. The sequences are presented along with the 5h ends derived from the genomic RNA of the viruses to compare any potential differences in the input D-RNA, derived from the Beaudette strain, and the sequence following rescue with the different heterologous strains. The first 23 nt of the D-RNA sequences are not presented as these were derived from the oligonucleotide used for the RT–PCR amplifications. The black shading represents complete conservation between the virus and D-RNA sequences and the white regions represent either differences between virus sequences or differences between the input D-RNA sequence and the sequence of the rescued D-RNA. The dashes represent sequence not determined for DRNA CD61D207. The leader sequence is denoted by a solid line and the leader junction sequence, the point differentiating the leader sequence and the adjacent 5h UTR, is boxed.

HJH


Fig. 5. Predicted RNA secondary structure of the IBV 5h-terminal region (nt 1–100) based on the Beaudette sequence. Stem–loops I, II and III are identified. The thin arrows indicate the positions of the nucleotide substitutions identified within the 5h UTRs of the heterologous IBV strains, M41, HV10, H120 and D207 (indicated in parentheses), used in the rescue of D-RNA CD-61. The start of the leader junction sequence is indicated with a thick arrow and the consensus sequence is boxed. The dashed line in stem–loop I indicates the extra base paired nucleotides identified in IBV strains D207 and HV10 resulting from the nucleotide substitution of a U A at nt 16.

determined from the available nucleotide substitutions in the IBV strains used. However, IBV strains M41, H120 and D207 have a substitution at nt 54 when compared to the Beaudette sequence, indicating that the left-hand boundary of the crossover region was 2 nt proximal to the leader junction sequence, CUUAACAA. The right-hand boundary of the crossover region can be determined for H120 and HV10 rescued D-RNAs due to the substitution at nt 93, 28 nt distal to the leader junction sequence. Overall, the observed 3h boundaries of the crossover region are at nt 93 for H120 and HV10, nt 168 for D207 and nt 222 for M41 (Fig. 4) ; however, the actual crossover points could be further upstream. Identification of potential RNA secondary structures in the IBV 5h UTRs.

Computer analysis of potential RNA secondary structures within the leader and adjacent 5h UTR genomic sequences (nt 1–100) of the five IBV strains was carried out. Three stem–loop structures were predicted with thermodynamic stabilities of k6n2 to k8n8 kcal\mol for stem–loop I, k3n94 kcal\mol for stem–loop II and k3n74 kcal\mol for stem–loop III (1 cal l 4n184 J) (Fig. 5). HJI

Comparison of the predicted secondary structures showed that the various nucleotide substitutions identified did not alter the overall predicted structures. Most of the nucleotide substitutions occurred within predicted single-stranded regions. However, 7 nt substitutions in D207 and HV10 occurred in stem–loop I. Six of the seven nucleotide substitutions showed covariance maintaining the predicted stem– loop structure, providing phylogenetic evidence for the structure. The seventh nucleotide substitution occurred at nt 30 (U C) to produce a G–C rather than a G–U base pair. This nucleotide substitution also occurred in the M41 sequence, accounting for the increased thermodynamic stability of stem–loop I for M41 (k8n5 kcal\mol) when compared to Beaudette (k6n2 kcal\mol) and H120 (k6n2 kcal\mol), possibly indicating that this substitution and resultant base pairing may incur some advantage. Nucleotide substitution at nt 16 (U A) in HV10 and D207 resulted in a further base pairing within stem–loop I (Fig. 5), decreasing the number of nucleotides within the predicted loop region. This nucleotide substitution, possibly together with the nucleotide substitution at nt 30, counteracts the potential destabilizing effect of the covariant U–G base pair (nt 9 and 28) resulting from these nucleotide substitutions in HV10 and D207. The overall result


of the nucleotide substitutions in the predicted stem–loop I of HV10 and D207 was an increased thermodynamic stability, k8n8 kcal\mol, when compared to the predicted structure for Beaudette and H120, and more similar to that found for M41. The leader junction sequence is predicted to occur in a singlestranded region between stem–loops II and III (Fig. 5). Stem–loop III is predicted to occur 4 nt distal to the leader junction sequence and probably represents the stem–loop structure identified in the 5h UTR of BCoV, and subsequently for MHV and TGEV, that has been suggested to contribute towards template switching (Chang et al., 1996).

Discussion This study reports the phenomenon of leader switching during the replication of the IBV Beaudette-derived D-RNA CD-61 following rescue with four heterologous helper IBVs. This is the first description of leader switching for IBV and the first report of leader switching using a coronavirus D-RNA unmodified in the 5h UTR. Our results also answer the recent query by Brian & Spaan (1997) as to whether IBV D-RNAs can undergo leader switching. Coronavirus leader switching was first demonstrated to occur during the replication of an MHV JHM-derived synthetic DI-RNA modified by the inclusion of a 9 nt sequence, deleted from all naturally occurring MHV JHM DI-RNAs, adjacent to the leader sequence. The second report of a coronavirus DRNA undergoing leader switching was for BCoV using a synthetic DI-RNA derived from the Mebus strain of BCoV (Chang et al., 1994). Leader switching, referred to as leader reversion by the authors, was observed to occur following experiments designed to investigate the potential role of various nucleotides on the replication of the D-RNA. A series of point mutations was introduced into the leader sequence of the D-RNA but no potential effect of the mutations could be determined because the replicated D-RNAs were found to have leader sequences identical to the helper virus. The BCoV system differed from the MHV system in that homologous helper virus was used whereas the MHV system used heterologous helper virus. Chang et al. (1996) showed that, unlike the acquisition of the leader sequence onto coronavirus subgenomic mRNAs, leader switching does not require a complete leader junction sequence. BCoV DI-RNAs containing either a scrambled or a deleted leader junction sequence were replicated, the modified DI-RNAs re-acquiring leader junction sequences as a result of leader switching. The authors concluded that leader switching involves a recombination event over a region of 24 nt comprising the last base of the leader junction sequence and the adjacent 23 nt. Analysis of IBV D-RNAs rescued with heterologous strains indicated that the boundaries of the crossover region were nt 55 and 95, the latter 31 nt downstream of the leader junction sequence. Whilst we cannot rule out the possibility that the IBV leader junction sequence is

involved in leader switching it would appear from the work of Chang et al. (1996) that the event may take place downstream of the IBV leader junction sequence, potentially involving nt 64–95. The BCoV crossover region contains an 8 nt palindromic AU-rich sequence, UUUAUAAA, comprising 8 nt of the 9 nt deleted from the MHV DI-RNAs that did not undergo leader switching (Makino et al., 1988 a). No such AU-rich sequence is present in any of the five IBV genomic sequences. Absence of the AU-rich sequence in the Beaudette sequence led Brian & Spaan (1997) to query whether IBV D-RNAs could undergo leader switching. Interestingly, the five IBV strains have the sequence AAAUACCU (nt 74–81), reminiscent of the palindromic sequence, AAAUAUUU, found in the TGEV 5h UTR sequence. It should be noted that the IBV AAAUACCU sequence is not adjacent but 9 nt downstream of the leader junction sequence whereas the AU-rich sequence in BCV, MHV and TGEV is adjacent to the leader junction sequence. Deletion of the first 7 nt of the 8 nt AU-rich palindromic sequence in a BCoV D-RNA prevented replication. This is in contrast to the situation in MHV where many of the natural MHV JHM DI-RNAs lacked the 8 nt AU-rich palindromic sequence. Three stem–loop structures have been identified within the 5h end of the BCoV DI-RNA (Chang et al., 1994, 1996). Deletion mutagenesis of the DI-RNA (Chang et al., 1994) showed that nt 1–8 were not required for replication but larger deletions, 12 nt, resulting in loss of stem–loop I, abolished replication. Disruption of BCoV DI-RNA stem–loop I by base substitution only minimally impaired DI-RNA replication. Analysis of the rescued DI-RNAs showed that they had acquired helper virus-type leader sequence via leader switching. Chang et al. (1994) concluded that stem–loop I is critical for the cis-acting replication signal associated with the leader sequence. Analysis of the 5h UTR of IBV D-RNA CD61 and genomic RNAs identified three potential stem–loop structures (Fig. 5). However, unlike the BCoV DI-RNA structures, we have no biochemical evidence for the structures in the IBV 5h UTR. Our phylogenetic evidence for the existence of stem–loop I in the IBV 5h UTR supports the BCoV data that this structure plays a major role in replication. IBV leader sequences tend to have more nucleotide substitutions than the adjacent 5h UTR, possibly a consequence of some substitutions requiring compensatory substitutions to maintain stem–loop I. It would be interesting to know whether MHV DI-RNAs lacking the 9 nt AU-rich sequence are able to replicate, in the absence of leader switching, following the introduction of stem–loop I destabilizing mutations. The demonstration that rescue of IBV D-RNA CD-61 with heterologous virus results in leader switching is similar to the observation that of Chang et al. (1994) for rescue of BCoV DIRNAs. However, in our case, rather than reversion to wildtype sequence, as for BCoV, the leader sequence acquired by the rescued IBV D-RNA was from the heterologous helper HJJ


virus. For the IBV system there was no intrinsic requirement for altering the leader sequence as no potentially destabilizing nucleotide substitutions had been introduced. We conclude that it is possible that leader switching is part of the replication mechanism for IBV D-RNAs occurring with both heterologous and homologous helper viruses. We saw no evidence of Beaudette-type leader sequence on any D-RNA following rescue by heterologous virus. RT–PCR products derived from the rescued D-RNAs, CD61M41 and CD61H120, were cloned and several IBV-derived cDNAs sequenced to confirm that there were no minor populations of rescued D-RNAs with Beaudette-type leader sequences. The results presented in this study together with previous observations support the hypothesis that in general coronavirus D-RNAs do not appear to replicate by reiterative replication. IBV D-RNAs leader switch in the absence of introduced point mutations indicating that leader sequence acquisition is part of the replicative process. In this manner it is feasible that coronavirus D-RNAs replicate in a manner analogous to the synthesis of coronavirus subgenomic mRNAs, i.e. that they acquire a leader sequence by a discontinuous process. However, leader acquisition in mRNA synthesis is TAS dependent whereas leader acquisition during D-RNA replication appears to be TAS independent. The discontinuous addition of a leader sequence during replication of D-RNAs is an RNA recombination event since it involves both donor and acceptor templates. The recombination event must, by definition, be extremely efficient at a very early stage and\or there is some positive selection of the chimaeric DRNA. Otherwise a mixed population of D-RNAs with the two different leader sequences would be found. Therefore, we would propose that replication of coronavirus D-RNAs involves acquisition of the leader sequence from the helper virus, either from a homologous or heterologous virus, as part of the replication cycle, analogous to the manner that subgenomic mRNAs acquire their leader sequence via a discontinuous mechanism. The acquisition of the leader sequence therefore probably occurs via an enzymatic process involving the polymerase. Such a potential activity will only be clarified following the development of a reverse genetics system for coronaviruses.

Binns, M. M., Boursnell, M. E. G., Cavanagh, D., Pappain, D. J. C. & Brown, T. D. K. (1985). Cloning and sequencing of the gene encoding

the spike protein of the coronavirus IBV. Journal of General Virology 66, 719–726. Binns, M. M., Boursnell, M. E. G., Tomley, F. M. & Brown, T. D. K. (1986). Comparison of the spike precursor sequences of coronavirus IBV

strains M41 and 6\82 with that of IBV Beaudette. Journal of General Virology 67, 2825–2831. Bonfield, J. K., Smith, K. F. & Staden, R. (1995). A new DNA sequence assembly program. Nucleic Acids Research 24, 4992–4999. Boursnell, M. E. G., Brown, T. D. K., Foulds, I. J., Green, P. F., Tomley, F. M. & Binns, M. M. (1987). Completion of the sequence of the genome

of the coronavirus avian infectious bronchitis virus. Journal of General Virology 68, 57–77. Brian, D. A. & Spaan, W. J. M. (1997). Recombination and coronavirus defective interfering RNAs. Seminars in Virology 8, 101–111. Chang, R. Y., Hofmann, M. A., Sethna, P. B. & Brian, D. A. (1994). A cis-acting function for the coronavirus leader in defective interfering RNA replication. Journal of Virology 68, 8223–8231. Chang, R. Y., Krishnan, R. & Brian, D. A. (1996). The UCUAAAC promoter motif is not required for high-frequency leader recombination in bovine coronavirus defective interfering RNA. Journal of Virology 70, 2720–2729. Darbyshire, J. H., Rowell, J. G., Cook, J. K. A. & Peters, R. W. (1979).

Taxonomic studies on strains of avian infectious bronchitis virus using neutralisation tests in tracheal organ cultures. Archives of Virology 61, 227–238. Davelaar, F. G., Kouwenhoven, B. & Burger, A. G. (1984). Occurrence and significance of infectious bronchitis virus variant strains in egg and broiler production in the Netherlands. Veterinary Quarterly 6, 114–120. Devereux, J., Haeberli, P. & Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, 387–395. de Vries, A. A. F., Horzinek, M. C., Rottier, P. J. M. & de Groot, R. J. (1997). The genome organisation of the Nidovirales : similarities and

differences between arteri-, toro- and coronaviruses. Seminars in Virology 8, 33–47. Feinberg, A. P. & Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Analytical Biochemistry 132, 6–13. Hiscox, J. A., Mawditt, K. L., Cavanagh, D. & Britton, P. (1995).

References

Investigation of the control of coronavirus subgenomic mRNA transcription by using T7-generated negative-sense RNA transcripts. Journal of Virology 69, 6219–6227. Hofmann, M. A., Sethna, P. B. & Brian, D. A. (1990). Bovine coronavirus mRNA replication continues throughout persistent infection in cell culture. Journal of Virology 64, 4108–4114. Jaeger, J. A., Turner, D. H. & Zuker, M. (1989). Improved predictions of secondary structures for RNA. Proceedings of the National Academy of Sciences, USA 86, 7706–7710. Jaeger, J. A., Turner, D. H. & Zuker, M. (1990). Predicting optimal and suboptimal secondary structure for RNA. Methods in Enzymology 183, 281–306. Kottier, S. A., Cavanagh, D. & Britton, P. (1995). Experimental evidence of recombination in coronavirus infectious bronchitis virus. Virology 213, 569–580.

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1987). Current Protocols In Molecular Biology.

Kusters, J. G., Niesters, H. G. M., Lenstra, J. A., Horzinek, M. C. & Van Der Zeijst, B. A. M. (1989). Phylogeny of antigenic variants of avian

New York : John Wiley and Sons.

coronavirus IBV. Virology 169, 217–221.

This work was supported by the Ministry of Agriculture, Fisheries and Food, UK, Project code OD1905 and by grant number CT950064 of the Fourth RTD Framework Programme of the European Commission. K. Stirrups and K. Dalton were the holders of Research Studentships from the Biotechnology and Biological Sciences Research Council (BBSRC). S. Evans was supported by a BBSRC Realizing Our Potential Award (ROPA).

IAA

Leader switching in IBV defective RNAs Lai, M. M. & Cavanagh, D. (1997). The molecular biology of coronaviruses. Advances in Virus Research 48, 1–100. Makino, S. & Lai, M. M. C. (1989). High-frequency leader sequence switching during coronavirus defective interfering RNA replication. Journal of Virology 63, 5285–5292. Makino, S., Stohlman, S. A. & Lai, M. M. C. (1986). Leader sequences of murine coronavirus mRNAs can be freely reassorted : evidence for the role of free leader RNA in transcription. Proceedings of the National Academy of Sciences, USA 83, 4204–4208. Makino, S., Shieh, C., Keck, J. G. & Lai, M. M. C. (1988 a). Defectiveinterfering particles of murine coronavirus : mechanism of synthesis of defective viral RNAs. Virology 163, 104–111. Makino, S., Shieh, C.-K., Soe, L. H., Baker, S. C. & Lai, M. M. C. (1988 b). Primary structure and translation of a defective interfering

RNA of murine coronavirus. Virology 166, 550–560. Makino, S., Yokomori, K. & Lai, M. M. C. (1990). Analysis of efficiently packaged defective Interfering RNAs of murine coronavirus : localization of a possible RNA-packaging signal. Journal of Virology 64, 6045–6053. Maruyama, I. N., Rakow, T. L. & Maruyama, H. I. (1995). cRACE : a simple method for identification of the 5h end of mRNAs. Nucleic Acids Research 23, 3796–3797. Matzura, O. & Wennborg, A. (1996). RNAdraw : an integrated program for RNA secondary structure calculation and analysis under 32-bit Microsoft Windows. Computer Applications in the Biosciences 12, 247–249. Mendez, A., Smerdou, C., Izeta, A., Gebauer, F. & Enjuanes, L. (1996).

Molecular characterization of transmissible gastroenteritis coronavirus defective interfering genomes : packaging and heterogeneity. Virology 217, 495–507. Nicholas, K. B. & Nicholas, H. B., Jr (1997). GeneDoc : a tool for editing and annotating multiple sequence alignments, 2.4.002 edn : Distributed by author (http :\\www.cris.com\"ketchup\genedoc. html). Niesters, H. G. M., Lenstra, J. A., Spaan, W. J. M., Zijderveld, A. J., Bleumink-Pluym, N. M. C., Hong, F., Van Scharrenburg, G. J. M., Horzinek, M. C. & Van Der Zeijst, B. A. M. (1986). The peplomer

protein sequence of the M41 strain of coronavirus IBV and its comparison with Beaudette strains. Virus Research 5, 253–263. Pe! nzes, Z. (1995). Defective replicating RNAs of coronavirus infectious bronchitis virus : investigation of replication and genome packaging signals. PhD thesis, University of Hertfordshire, UK.

Pe! nzes, Z., Tibbles, K., Shaw, K., Britton, P., Brown, T. D. K. & Cavanagh, D. (1994). Characterization of a replicating and packaged

defective RNA of avian coronavirus infectious bronchitis virus. Virology 203, 286–293. Pe! nzes, Z., Wroe, C., Brown, T. D., Britton, P. & Cavanagh, D. (1996). Replication and packaging of coronavirus infectious bronchitis virus defective RNAs lacking a long open reading frame. Journal of Virology 70, 8660–8668. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring Harbor Laboratory. Sawicki, S. G. & Sawicki, D. L. (1990). Coronavirus transcription : subgenomic mouse hepatitis virus replicative intermediates function in RNA synthesis. Journal of Virology 64, 1050–1056. Siddell, S. G. (1995). The Coronaviridae. In The Coronaviridae, pp. 1–10. Edited by S. G. Siddell. New York : Plenum. Stern, D. F. & Kennedy, S. I. T. (1980). Coronavirus multiplication strategy. I. Identification and characterization of virus-specific RNA. Journal of Virology 34, 665–674. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The Clustal X Windows interface : flexible strategies for

multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882. van der Most, R. G. & Spaan, W. J. M. (1995). Coronavirus replication, transcription, and RNA recombination. In The Coronaviridae, pp. 11–31. Edited by S. G. Siddell. New York : Plenum. van der Most, R. G., Bredenbeek, P. J. & Spaan, W. J. M. (1991). A domain at the 3h end of the polymerase gene is essential for encapsidation of coronavirus defective interfering RNAs. Journal of Virology 65, 3219–3226. Zuker, M. (1989 a). Computer prediction of RNA structure. Methods in Enzymology 180, 262–288. Zuker, M. (1989 b). On finding all suboptimal foldings of an RNA molecule. Science 244, 48–52. Zuker, M. & Stiegler, P. (1981). Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Research 9, 133–148. Received 10 September 1999 ; Accepted 23 November 1999

IAB