LEDGF/p75 Overexpression Attenuates Oxidative Stress ... - PLOS

RESEARCH ARTICLE

LEDGF/p75 Overexpression Attenuates Oxidative Stress-Induced Necrosis and Upregulates the Oxidoreductase ERP57/ PDIA3/GRP58 in Prostate Cancer Anamika Basu1*, Christina K. Cajigas-Du Ross1, Leslimar Rios-Colon1, Melanie Mediavilla-Varela1¤b, Tracy R. Daniels-Wells1¤a, Lai Sum Leoh1¤a, Heather Rojas2, Hiya Banerjee3, Shannalee R. Martinez1, Stephanny Acevedo-Martinez1¤c, Carlos A. Casiano1,4 1 Center for Health Disparities and Molecular Medicine, Department of Basic Sciences, Loma Linda University School of Medicine, Loma Linda, California 92350, United States of America, 2 Department of Pathology and Human Anatomy, Loma Linda University School of Medicine, Loma Linda, California 92350, United States of America, 3 Novartis Pharmaceutical Oncology, East Hanover, New Jersey 08807, United States of America, 4 Department of Medicine, Loma Linda University School of Medicine, Loma Linda, California 92350, United States of America OPEN ACCESS Citation: Basu A, Cajigas-Du Ross CK, Rios-Colon L, Mediavilla-Varela M, Daniels-Wells TR, Leoh LS, et al. (2016) LEDGF/p75 Overexpression Attenuates Oxidative Stress-Induced Necrosis and Upregulates the Oxidoreductase ERP57/PDIA3/GRP58 in Prostate Cancer. PLoS ONE 11(1): e0146549. doi:10.1371/journal.pone.0146549

¤a Current address: Department of Surgery, University of California Los Angeles, Los Angeles, California 90095, United States of America ¤b Current address: Department of Immunology, Moffitt Cancer Center, Tampa, Florida 33612, United States of America ¤c Current address: Department of Emergency Medicine, Hospital Dr. Federico Trilla, University of Puerto Rico, Carolina, Puerto Rico 00924 * [email protected]

Editor: Mohammad Saleem, Hormel Institute, University of Minnesota, UNITED STATES

Abstract

Received: September 8, 2015

Prostate cancer (PCa) mortality is driven by highly aggressive tumors characterized by metastasis and resistance to therapy, and this aggressiveness is mediated by numerous factors, including activation of stress survival pathways in the pro-inflammatory tumor microenvironment. LEDGF/p75, also known as the DFS70 autoantigen, is a stress transcription co-activator implicated in cancer, HIV-AIDS, and autoimmunity. This protein is targeted by autoantibodies in certain subsets of patients with PCa and inflammatory conditions, as well as in some apparently healthy individuals. LEDGF/p75 is overexpressed in PCa and other cancers, and promotes resistance to chemotherapy-induced cell death via the transactivation of survival proteins. We report in this study that overexpression of LEDGF/p75 in PCa cells attenuates oxidative stress-induced necrosis but not staurosporine-induced apoptosis. This finding was consistent with the observation that while LEDGF/p75 was robustly cleaved in apoptotic cells into a p65 fragment that lacks stress survival activity, it remained relatively intact in necrotic cells. Overexpression of LEDGF/p75 in PCa cells led to the upregulation of transcript and protein levels of the thiol-oxidoreductase ERp57 (also known as GRP58 and PDIA3), whereas its depletion led to ERp57 transcript downregulation. Chromatin immunoprecipitation and transcription reporter assays showed LEDGF/p75 binding to and transactivating the ERp57 promoter, respectively. Immunohistochemical analysis

Accepted: December 19, 2015 Published: January 15, 2016 Copyright: © 2016 Basu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper. Funding: This work was supported by NIH grants 5R25GM060507, 5P20MD001632 and 5P20MD006988, and by Loma Linda University School of Medicine Center for Health Disparities and Molecular Medicine. CKCD, MMV, LRC, and SRM were supported by graduate training fellowships under grant R25GM060507. SAM was supported by a medical research training internship under grant 5P20MD006988. HB is employed by a commercial

PLOS ONE | DOI:10.1371/journal.pone.0146549 January 15, 2016

1 / 25

Upregulation of LEDGF/p75 and ERp57 in Prostate Cancer

company—Novartis Pharmaceutical Oncology. The funders (NIH, Novartis) provided support in the form of salaries for authors (CAC, CKCD, MMV, LRC, SRM, SAM, HB), but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the "author contributions" section. Competing Interests: One of the authors, HB, is employed by a commercial company—Novartis Pharmaceutical Oncology. Novartis provided support in the form of salary for HB, but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. This commercial affiliation does not alter the authors' adherence to PLOS ONE policies on sharing data and materials.

revealed significantly elevated co-expression of these two proteins in clinical prostate tumor tissues. Our results suggest that LEDGF/p75 is not an inhibitor of apoptosis but rather an antagonist of oxidative stress-induced necrosis, and that its overexpression in PCa leads to ERp57 upregulation. These findings are of significance in clarifying the role of the LEDGF/ p75 stress survival pathway in PCa.

Introduction Prostate cancer (PCa) is the second leading cause of cancer deaths among men in the United States, affecting disproportionately African American men compared to other racial/ethnic groups [1]. PCa initiation and progression has been linked to chronic inflammation and increased oxidative damage in this gland [2,3]. As a mechanism of survival in this stressful environment, PCa cells activate stress survival pathways that promote tumor aggressive properties, including resistance to cell death and chemotherapy [4–6]. Lens epithelium-derived growth factor of 75 kD (LEDGF/p75) is an emerging oncoprotein that promotes mammalian cell survival in the presence of environmental stressors that increase cellular oxidative damage [7–14]. Also known as transcription co-activator p75, PC4 and SFRS1 interacting protein (PSIP1), and dense fine speckled autoantigen of 70 kD (DFS70), this multifunctional protein has gained relevance in the study of cancer, HIV-AIDS, autoimmunity, and eye disease (reviewed in refs. [9,10]). As the key cellular co-factor for HIV integration into host chromatin, LEDGF/p75 has attracted considerable attention during the past decade, and vigorous efforts are currently under way to target this protein for the treatment of HIV-AIDS [15]. The emerging role of LEDGF/p75 as a stress oncoprotein has been uncovered by several studies from our group and others documenting its overexpression in diverse human cancer types, and its ability to induce features associated with tumor aggressiveness in cancer cells [10–14,16–19]. In addition, LEDGF/p75 is aberrantly expressed in human leukemias, and interacts with the Menin-MLL (mixed leukemia lineage) transcription complex to activate the expression of cancer-associated genes and leukemogenesis [20,21]. The potential of LEDGF/ p75 as a promising target for cancer treatment has been highlighted by studies showing that its inhibition or downregulation attenuates the aggressive properties of cancer cells [14,17,19,21,22]. Our group and others demonstrated previously that LEDGF/p75 is the target of an autoantibody response in a subset of PCa patients, as well as in apparently healthy individuals and patients with diverse chronic inflammatory conditions ([23], also reviewed in refs. [9,10]). We also reported that LEDGF/p75 is overexpressed in prostate tumors and that this overexpression promotes PCa cell resistance to caspase-independent lysosomal cell death induced by the taxane drug docetaxel (DTX), the gold standard for PCa chemotherapy [11,13,23]. Interestingly, LEDGF/p75 upregulation occurs naturally during the selection of DTX-resistant PCa cells [24]. In concordance with these observations, several studies showed that LEDGF/p75 overexpression in cancer cells promotes resistance to drugs that induce oxidative DNA damage and lysosomal cell death [12–14,18,25], leading one group to refer to this protein as a “guardian of lysosomal stability in human cancer” [14]. The stress protective functions of LEDGF/p75 appear to be mediated by its ability to participate in DNA repair and transcriptionally activate stress survival proteins such as heat shock protein 27 (Hsp27), peroxiredoxin 6 (PRDX6), and vascular endothelial growth factor C (VEGF-C) [18,26–30]. We observed previously that LEDGF/p75 overexpression in PCa cells did not protect against caspase-dependent apoptosis triggered by TRAIL (tumor necrosis factor related


2 / 25


apoptosis inducing ligand), a well-characterized inducer of the death receptor apoptotic pathway [13]. TRAIL, staurosporine (STS), and other inducers of apoptosis lead to caspase-3 mediated cleavage of LEDGF/p75 into a prominent p65 fragment that lacks pro-survival activity and enhances cell death under stress conditions [22,23,30]. Furthermore, caspase-3 mediated cleavage of LEDGF/p52, the short alternative splice variant of LEDGF/p75, generates a p35 fragment that abrogates the transcriptional activity of LEDGF/p75 [30]. Because of its cleavage and inactivation during apoptosis, LEDGF/p75 may not act as a classical inhibitor of apoptosis but rather as an upstream protector of DNA and lysosomal integrity under an augmented state of cellular oxidative stress. Therefore, we focused the present study on investigating the ability of LEDGF/p75 to protect PCa cells against oxidative stress-induced necrosis, and contribute to the upregulation of endoplasmic reticulum protein of 57 kD (ERp57) in PCa. ERp57, also known as glucose regulated protein of 58 kD (GRP58) and protein disulfide isomerase family A member 3 (PDIA3), is a multi-functional thiol-oxidoreductase and a chaperone protein responsible for maintaining the appropriate folding of newly synthetized glycoproteins [31,32]. Our results indicate that LEDGF/p75 overexpression attenuates oxidative stress-induced necrotic cell death and contributes to ERp57 upregulation in the context of PCa.

Materials and Methods The studies involving human antibodies, cancer cell lines, and prostate tissues were performed under the approval of the Loma Linda University Institutional Review Board.

Cell lines, Antibodies, and Reagents The metastatic prostate cancer cell lines DU145 (Cat.# HTB-81) and PC3 (Cat.# CRL-1435), the K-ras transformed prostate epithelial cell line RWPE-2 (Cat.# CRL-11610), derived from the normal prostate cell line RWPE-1, and the osteosarcoma cell line U2OS (Cat.# HTB-96) were purchased from the American Type Culture Collection (ATCC). Cells were cultured as recommended by the suppliers in a humidified incubator with 5% CO2 at 37°C. The following antibodies were used: mouse monoclonals anti-β-actin (1:5000, Sigma-Aldrich) and antiERp57 (1: 200, Enzo Life Sciences); rabbit polyclonal anti-LEDGF/p75 (1:1000, Bethyl laboratories Inc); goat polyclonal anti-Lamin B antibody C-20 (1:1000. Santa Cruz Biotechnology); human autoantibody to topoisomerase I (1:100, Topo I), a kind gift from Dr. Eng M Tan (Scripps Research Institute, La Jolla, CA); anti-LEDGF/p75 rabbit polyclonal antibody ScrippsAb5087(1:1000), also donated by Dr. Eng M. Tan; and horseradish peroxidase (HRP)-labeled secondary IgG antibodies (1:5000, ThermoFisher Scientific). Tert-butyl hydrogen peroxide (TBHP), an organic peroxide, was purchased from Sigma-Aldrich. STS and N-acetyl-Asp-GluVal-Asp-7-amino-4-methylcoumarin (Ac-DEVD-amc, fluorogenic caspase-3/7 substrate) were purchased from Axxora. The broad caspase inhibitor benzylocarbonyl-Val-Ala-Aspfluoromethyl ketone (z-VAD-fmk) was purchased from Biomol International.

Cell Death and Viability Assays Cell death was induced by treatment with the cytotoxic agents TBHP (50, 75, 100, and 150 μM) or STS (4 μM) for up to 24 h. In some experiments cells were preincubated with 100 μM of zVAD-fmk for 1 h prior to exposure to these agents. Cell morphology was visualized on an Olympus IX70 microscope equipped with Hoffmann Modulation Contrast (Olympus American) and a digital Spot Imaging System (Diagnostic Instruments). To determine cell viability, cells seeded in 96-well plates (3 x 104 cells per well) were treated with TBHP or STS, washed with phosphate buffered saline (PBS), and fixed in 4% paraformaldehyde for 1 h at 4°C. Cells


3 / 25


were then washed three times with distilled water, and Accustain Crystal Violet solution (Sigma-Aldrich) (1:4) was added to each well followed by incubation for 20 minutes at room temperature. Cells were washed with distilled water to remove excess dye and then dried at room temperature. Acetic acid (10% v/v) was added to each well for 10 minutes and absorbance was measured at 570 nanometers (nm) using a μQuant microplate reader (Bio-Tek Instruments). DAPI (4',6-diamidino-2-phenylindole) staining was used to visualize condensed or fragmented chromatin in cells treated with TBHP or STS. Briefly, cells were seeded (3 x 104) in 8-well Lab-Tek1 Permanox1 chamber slides (ThermoFisher Scientific), treated after 24 h with the different cytotoxic agents, washed with PBS, and then fixed and permeabilized with methanol/acetone solution (3:1 v/v) for 10 minutes at -20°C. The fixing solution was removed and the slides were incubated at room temperature for 5–10 minutes for drying. Coverslips were mounted using VectaShield mounting medium containing DAPI (Vector Laboratories). DAPI staining was visualized using and Olympus BX50 Fluorescence Microscope and images were obtained with a Spot Imaging System (Diagnostic Instruments). Caspase activity assays were performed as described previously [30]. Briefly, cells were seeded in black, clear-bottomed 96-well plates (3 x 104 cells per well). At the conclusion of treatment with TBHP or STS, cells were incubated with 50 μl of 3X caspase buffer [150 mM HEPES pH 7.4, 450 mM sodium chloride, 150 mM potassium chloride, 30 mM magnesium chloride, 1.2 mM ethylene glycol-bis(2-aminoethylether)-N,N,N0 ,N0 -tetraacetic acid (EGTA), 30% sucrose, 10% CHAPS, and 1.5% NP-40], in the presence of 30 mM dithiothreitol (DTT), 3 mM phenylmethanesulphonylfluoride (PMSF), and 75 μM of the fluorogenic peptide substrate Ac-DEVD-amc (caspase-3/7) for 2 h at 37°C. This was followed by incubation of cells at room temperature for 12 h, and measurement of the absorbance at excitation of 360 nm and emission of 460 nm in a FLX800 Microplate Fluorescent Reader (Bio-tek Instruments). Fold activity was determined by normalizing to one the absorbance values for untreated, control cells.

Measurement of Reactive Oxygen Species The generation of reactive oxygen species (ROS) was assessed based on the intracellular oxidation of 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA, Invitrogen) to form the fluorescent compound 2’,7’-dicholorofluorescein (DCF). Cells were seeded in a 6-well plate at a density of 3 x 104 cells per well, cultured for 24 hours, and then treated with TBHP or STS for up to 12 h. DCFH-DA (0.5 μM) was then added to the cells, followed by incubation for 20 minutes at 37°C. Cells were washed with PBS and then resuspended in 0.5 mL of PBS. Fluorescence intensity was determined by flow cytometry using a FACScalibur cytometer (BD Biosciences).

Quantitative Real Time PCR Quantitative Real Time PCR (qPCR) was carried out as described previously [24]. Briefly, total RNA was extracted from cells using the RNeasy plus mini kit (Qiagen). RNA (0.5μg) was reverse trancribed into cDNA using iScript cDNA synthesis kit (BioRad). qPCR was performed on the MyiQ real-time PCR detection system with primers using iQ SYBR Green Supermix (BioRad) according to the manufacturer’s recommendations. Primer sequences for LEDGF/ p75 and ERp57 were designed using the Primer3 software and commercially synthesized by Integrated DNA Technologies (IDT) (Table 1). Target mRNA values were normalized using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA and data were expressed relative to normalized values of corresponding controls. Samples were analyzed in three independent experiments, each in triplicates.


4 / 25


Table 1. Nucleotide sequences of primers used for qPCR. Gene

Forward sequence (5' to 3')

Reverse Sequence (5' to 3')

LEDGF/p75

TGCTTTTCCAGACATGGTTGT

CCCACAAACAGTGAAAAGACAG

ERp57

GGTGTGGACACTGCAAGAGA

AGCACCTGCTTCTTCACCAT

GAPDH

CGAGATCCCTCCAAAATCAA

TTCACACCCATGACGAACAT

ERp57pr A

GCCCACTCAGTCCTGACTTC

ACTCGTTACCGCCGAGTG

ERp57pr B

CAAGACGGCATCTCAGACAA

GCTTTGGCATTTTGTCCAAT

ERp57pr C

ACTAGGAGCAGTTGGGCAGA

CGTGTTAGCCAGGATGGTCT

ERp57pr D

CCTCCCCAGAATTTTCCACT

CTGTAATCCTTGGTGCAGCTC

ERp57pr E

CCTCTGGGCATGTGAAATCT

CCAGCAGTAAGCCATTAGGG

doi:10.1371/journal.pone.0146549.t001

Generation of PCa cells with stable overexpression or depletion of LEDGF/p75 LEDGF/p75 cDNA was previously cloned in our laboratory into the mammalian expression plasmid pcDNA3.1 (Invitrogen) [22]. Briefly, both pcDNA3.1 empty vector and pcDNA3.1ledgf/p75 plasmids were transfected into RWPE-2 and PC3 cells using the Fugene 6 (Roche) method. Forty-eight hours post-transfection, cells were trypsinized and seeded into 6-well plates. Selection of stable transfectants was achieved by adding G418 (330μg/ml) (ThermoFisher Scientific) to the cell cultures. Surviving colonies were expanded and the expression of LEDGF/p75 in cells stably transfected with empty vector or pcDNA3.1-ledgf/p75 was confirmed by qPCR and immunoblotting. PC3 cells with stable overexpression or depletion of LEDGFp75 using viral vectors were generous gifts from Professors Zeger Debyser and Rik Gijsbers (Katholieke Universiteit Leuven, Belgium). Overexpressing PC3 cells were generated by transducing them with retroviral vectors encoding full-length LEDGF/p75 cDNA as described previously [24,33] PC3 cells with stable depletion of LEDGFp75 were generated using intensified lentiviral vector-based RNA interference as described previously [34]. Briefly, short hairpin (sh) RNA was used to stably knockdown LEDGFp75 while shSCR served as the non-interfering shRNA control. Transduced cells were selected with zeocin (200 μg/ml) and LEDGF/p75 overexpression or depletion in selected clones was assessed by qPCR and immunoblotting.

RNA interference-mediated knockdown of LEDGF/p75 in PCa cells Transient knockdown of LEDGF/p75 in PCa cells was achieved by delivering specific short inhibitory RNAs (siRNAs) into cells using the Oligofectamine method (Invitrogen, Life Technologies), according to manufacturer’s instructions. Briefly, LEDGF/p75 siRNA (siLEDGF/ p75) and a scrambled siRNA duplex (siSD, negative control) were designed as described previously [24] and synthesized by IDT. The siLEDGF/p75 sequence corresponded to nucleotides 1340–1360 (50 - AGACAGCAUGAGGAAGCGAdTdT-30 ) with respect to the first nucleotide of the start codon of the LEDGF/p75 open reading frame. This sequence corresponds to a region in the C-terminus of LEDGF/p75 that is not shared by its short alternative splice variant LEDGF/p52. The sequence for siSD was 50 - GCGCGCUUUGUAGGAUUCGdTdT-30 . Cells were transfected with 40 nM siRNAs and grown for 72 hours before analysis.

Docetaxel-Resistant PCa Cells Docetaxel (DTX)-resistant PC3 (PC3-DR) and DU145 (DU145-DR) cell lines were developed by culturing PC3 and DU145 cells in the presence of DTX in a dose-escalation manner [35].


5 / 25


Cells that survived the initial culture in 1 nM DTX were passaged 4 times prior to increasing the concentration of DTX to 5.5 nM and subsequently to 11 nM. Resistant cells were maintained continuously in 11 nM DTX.

Immunoblotting Analysis Immunoblotting was carried out essentially as described previously [24]. Briefly, proteins in whole-cell lysates from PCa cells were separated by SDS-PAGE (NuPAGE 4–12%, ThermoFisher Scientific) followed by transfer to polyvinyl difluoride (PVDF) membranes (Millipore). Membranes were blocked with 5% dry milk solution prepared in TBS-T buffer (20 mM TrisHCl, pH 7.6, 140 mM NaCl, 0.1% Tween 20) and probed with primary antibodies. After several washes with TBS-T, membranes were incubated with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies and washed again several times with TBS-T. Protein bands were detected by enhanced chemiluminescence (ThermoFisher Scientific Pierce).

Kinetworks™ Stress/Heat Shock Protein Screen The Kinetworks™ Stress/Heat Shock Protein Screen (Kinexus Bioinformatics Corporation) was used to quantify and compare the expression levels of 25 different stress and heat shock proteins in immunoblots of whole cell lysates from RWPE-2 cells stably overexpressing LEDGF/ p75 and control cells stably transfected with empty pcDNA vector. This platform was an antibody-based array service for the simultaneous screening of multiple stress proteins in cell lysates that was commercially available at the time we initiated this study. Cell lysates were probed by immunoblotting against a stress/heat shock protein antibody panel [36]. Immunoblotting procedures and quantification of individual stress protein immunoreactivity were performed by Kinexus.

Luciferase-based Transcription Reporter Assays ERp57 promoter (ERp57pr) luciferase-based transcription reporter assays were performed as described previously [30]. Briefly, RWPE-2, PC3, and DU145 cells were co-transfected with the expression vector encoding LEDGF/p75 (pcDNA3.1-ledgf/p75) or empty vector (pcDNA3.1), and the reporter vector (pLightSwitch empty vector, or pLightSwitch-ERp57pr) (Switchgear Genomics/Active Motif). At 48 hours post-transfection, cells were lysed and luciferase assays were performed using the LightSwitch Luciferase Assay Reagent (Switchgear Genomics/Active Motif). U2OS cells were transfected with a different LEDGF/p75 expression vector, pCruzHAledgf/p75, or empty pCruzHA, and luciferase assay in these cells was performed using the Luciferase Assay System from Promega. Relative light units were obtained in a MicroLumatPlus Lb 96V luminometer (Berthold Tech), and luciferase values were normalized to protein concentration of lysates from cells co-transfected with empty vectors and pLightSwitch-ERp57pr. Student’s t-test analysis was performed using Microsoft Excel. Experiments were repeated at least three times in triplicates.

Chromatin Immunoprecipitation Assays These assays were conducted essentially as described previously [37]. Briefly, PC3 and U2OS cells were fixed in 1% formaldehyde for 10 minutes and subjected to chromatin immunoprecipitation (ChIP) assay using the ChIP-IT Express Enzymatic kit (Active Motif). Anti-LEDGF/ p75 antibodies (A300-848A, Bethyl) was used to immunoprecipitate protein-chromatin complexes. Immunoprecipitated chromatin was then enzymatically digested. PCR was performed


6 / 25


using specific primers to amplify the ERp57 promoter (Table 1). Both non-specific immunoglobulin G (IgG) antibody and input chromatin were used as controls.

Immunohistochemical (IHC) Analysis of Prostate Cancer Tissue Microarrays Human PCa tissue microarrays (TMAs), commercially available from Novus Biologicals and US Biomax Inc. were used for IHC analysis of LEDGF/p75 and ERp57. Three different PCa TMAs (two from US Biomax Inc. and one from Novus Biologicals) were used to increase the sample size. Briefly, we acquired from US Biomax the PR807 and PR807a TMAs, each containing single cores of 3 disease-free normal tissue cases, 7 normal adjacent tissue cases, and 50 PCa tissue cases. We also used the IMH-303 TMA (Novus Biologicals), containing 40 PCa tissue cores and 9 matched normal adjacent tissues. The manufacturers of these TMAs provided only limited basic clinicopathological information (age, sex, tumor stage in some cases) corresponding to the tissue cores, with no patient identifiers. No information was available on patient race or ethnicity, treatment type, institutions that collected the tissues, follow- up routines, and tissue handling techniques. The limited patient follow-up data associated with the TMAs prevented us from performing a Kaplan-Meier survival analysis and other clinical correlation analyses. TMAs were stained using a Biogenic i6000 auto-stainer (Biogenex Corporation) as described previously [11]. Briefly, paraffin embedded tissue sections in the TMA slides were deparaffinized and the slides were subjected to antigen retrieval. Endogenous peroxidase activity was quenched by treatment with 3% hydrogen peroxide in 10% methanol, and Power Block© universal blocking reagent (Biogenex Corp.) was used to block non-specific protein binding. IHC staining of LEDGF/p75 was done using the Scripps-Ab5087 rabbit polyclonal antibody, which is specific for LEDGF/p75 and does not react with the short LEDGF/p52 splice variant [11]. IHC staining of ERp57 was done using the mouse monoclonal anti-ERp57 (Enzo Life Sciences). TMA slides were incubated overnight with primary antibodies, washed and then incubated with Multi-link© biotinylated secondary antibody (Biogenex Corp.), followed by incubation with streptavidin-coupled peroxidase supersensitive Label© (Biogenex Corp.). Immunostaining was detected by peroxidase activation of the 3-amino-9-ethycarbazole (AEC) chromagen (Biocare Medical). TMAs were counterstained lightly with hematoxylin (Sigma) and mounted with permount (ThermoFisher Scientific). For the negative control sample, the primary antibody was omitted and substituted with rabbit or mouse pre-immune serum. Tissue sections were examined under an Olympus BX50 microscope, and images were acquired using a digital Spot RT3TM camera (Diagnostic Instruments). Immunostained TMAs were scored blindly for LEDGF/p75 immunoreactivity by a board certified pathologist (HR). A 4-tier scoring system (0 = negative, 1 = weak, 2 = moderate, 3 = strong) was used to evaluate staining intensity. Tissues with scores of 0–1 were considered to have low intensity staining, whereas tissues with scores of 2–3 were considered to have high intensity staining. Tissue specimens that showed poor quality were excluded from the analyses. These studies were performed under approval by the Institutional Review Board. Statistical analysis of IHC data and their relationship to patients’ clinical outcomes was done using the SAS software package (version 9.2; SAS institute). For ease of statistical analysis, tissue specimens were grouped into two categories based on their scores. ‘Low’ staining was determined as pooled staining intensity scores of 0 and 1 while ‘high’ staining had pooled scores of 2 and 3. Correlation between expression levels of LEDGF/p75 and ERp57 in tumor and control (disease-free normal + normal adjacent) tissues was determined using Chi-square test. Probability values below 0.05 were considered significant.


7 / 25


Fig 1. Overexpression of LEDGF/p75 in RWPE-2 cells attenuates TBHP-induced necrosis but not STS-induced apoptosis. A. RWPE-2 cells were treated with 100 μM TBHP or 4 μM STS to induce necrosis or apoptosis, respectively. Cell viability was assessed by Crystal Violet assay. B. Changes in cellular morphology associated with necrosis or apoptosis in RWPE-2 cells treated with TBHP or STS, respectively, for 24 hours. C. Nuclear morphology of RWPE-2 cells (treated as in panel B) visualized by DAPI staining. D. Caspase 3 activity was measured after treatment with TBHP or STS. E. Cleavage of Lamin B into its signature apoptotic 45 kD fragment was detected by immunoblotting in RWPE-2 cells treated with STS but not in TBHP-treated cells. Lines indicate bands corresponding to intact proteins and the arrow points to the cleavage fragment. F. Immunoblot showing stable overexpression of LEDGF/p75 in RWPE-2–ledgf/p75 clones as compared to RWPE-2 Vec (empty pcDNA3.1 vector) clones and untransfected RWPE-2 cells. G. Crystal violet viability assay showing that overexpression of LEDGF/p75 in RWPE-2 cells promotes resistance to cell death induced by TBHP but not STS. Each graph represents the average of at least 3 independent experiments performed in triplicates (*P