letter - Nature

© 2001 Nature Publishing Group http://genetics.nature.com

letter

Deregulated expression of c-Myc depletes epidermal stem cells


Rebekah L. Waikel1, Yasuhiro Kawachi1, Patricia A. Waikel1, Xiao-Jing Wang1,2 & Dennis R. Roop1,2

The β-catenin/TCF signaling pathway is essential for the maintenance of epithelial stem cells in the small intestine1. c-Myc a downstream target of β-catenin/TCF (ref. 2), can induce differentiation of epidermal stem cells in vitro3. To determine the role of cMyc in epidermal stem cells in vivo, we have targeted expression of human MYC2 to the hair follicles and the basal layer of mouse epidermis using a keratin 14 vector (K14.MYC2). Adult K14.MYC2 mice gradually lose their hair and develop spontaneous ulcerated lesions due to a severe impairment in wound healing; their keratinocytes show impaired migration in response to wounding. The expression of β1 integrin, which is preferentially expressed in epidermal stem cells4 is unusually low in the epidermis of K14.MYC2 mice. Label-retaining analysis to identify epidermal stem cells reveals a 75% reduction in the number of stem cells in 3-month-old K14.MYC2 mice, compared with wildtype mice. We conclude that deregulated expression of c-Myc in stem cells reduces β1 integrin expression, which is essential to both keratinocyte migration and stem cell maintenance.

The oncoprotein c-Myc is known to induce proliferation, transformation and apoptosis in mammalian cells5. We have previously shown that overexpression of MYC2 (MYC cDNA beginning with the second AUG start site) throughout the interfollicular epidermis, not including the stem cells, induces proliferation and inhibits differentiation6. However, in vitro evidence indicates that c-Myc has a different role in epidermal stem cells3. To explore this possibility in vivo, we have targeted MYC2 expression using a keratin 14 vector (K14.MYC2), which is expressed in epidermal stem cells7. We established three founder lines, and confirmed expression of the transgene by RT-PCR (Fig. 1a). In contrast with mice expressing MYC2 in non-stem cells6, homozygous K14.MYC2 pups have a hyperplastic phenotype at postnatal day 3, are significantly smaller than wildtype littermates, and most die before 21 days. So, to better understand the role of MYC2 in stem cells, we characterized heterozygous K14.MYC2 mice, which do not have an obvious phenotype at birth and are viable. Adult K14.MYC2 mice lose their hair and develop spontaneous erosions of the skin. Ulcerated lesions develop in areas of chronic Fig. 1 Transgene expression and phenotype. The 3 transgenic lines established (D4316, D4331, D4354) all show transgene expression by RT-PCR (WT, wildtype control) (a) and exhibit a similar phenotype as shown in (b). A K14.MYC2 mouse of 12 weeks exhibits ulcerated lesions in areas of chronic mechanical stress, i.e. behind the ears (b). Histological analysis of these ulcerated lesions reveals epidermal hyperplasia, enlarged sebaceous glands, and complete epidermal loss (c). Epidermal hyperplasia and enlarged sebaceous glands are also observed in K14.MYC2 skin that is adjacent to ulcerated lesions. A comparison of wildtype (d) vs. transgenic (e) skin by Oil Red O staining (red) further documented the enlarged sebaceous glands in 8-week-old transgenic skin. The counterstain in d,e is hematoxylin. BrdU analysis of wildtype (f) and transgenic (g) littermates demonstrated an 8-fold increase in the number of proliferative cells in K14.MYC2 adult epidermis. The counterstain is K14 (red). Yellow stain indicates the presence of both BrdU and K14.

mechanical stress including the snout, throat and behind the ears (Fig. 1b). Owing to the severity of the lesions, we sacrifice the K14.MYC2 mice before they are 5 months old. Histological analysis of the lesions reveals areas of epidermal hyperplasia and areas of complete epidermal loss (Fig. 1c). K14.MYC2 skin adjacent to ulcerated lesions is hyperplastic, with enlarged sebaceous glands (confirmed by Oil Red O staining (Fig. 1d,e)). We carried out BrdU labeling of 16-week-old mice to determine the proliferation rate in the K14.MYC2 epidermis. K14.MYC2 epidermis adjacent to ulcerated lesions (Fig. 1g) has an eightfold greater proliferative index than wildtype epidermis (Fig. 1f). Epidermis from the lower back of K14.MYC2 mice, an unaffected area, has a threefold greater labeling index (data not shown). This finding is consistent with previous work demonstrating that c-Myc increases proliferation5,6. In vitro studies3 have shown that c-Myc expression accelerates epidermal stem cell differentiation. If this occurs in vivo, precocious expression of differentiation markers might be expected to occur in the basal compartment of the epidermis. However, the epidermis of K14.MYC2 mice expresses normal levels of differentiation markers such as keratins 1 and 10, loricrin and filaggrin (data not shown). As the K14.MYC2 mice have persistent, ulcerated lesions, we suspected a defect in wound-healing in these mice, and so determined the response to three-millimeter punch biopsies in the

b

a

c

d

e

f

g

Departments of 1Molecular and Cellular Biology and 2Dermatology, Baylor College of Medicine, Houston, Texas 77030, USA. Correspondence should be addressed to D.R.R. ([email protected])

nature genetics • volume 28 • june 2001

165



letter a

b

c

d

e

f

backs of 7-week-old K14.MYC2 and wildtype mice. Wounds of wildtype mice developed an epithelial ‘tongue’ by day 2 and were completely re-epithelialized by 4 days after wounding (Fig. 2a). In contrast, K14.MYC2 wounds showed no sign of re-epithelialization at day 4 (Fig. 2b). However, wound closure by contraction occurred by day 6. We observed no difference in angiogenesis between the normal and transgenic wounds (as determined by CD31 staining, data not shown). The only histologically observable defect of the transgenic animals was a lack of keratinocyte migration (Fig. 2b). To confirm adequate proliferation at the wound edge, we carried out BrdU analysis and found that the wound edge of K14.MYC2 mice proliferates at twice the rate of wildtype controls at both day 1 and 4 post-wounding (Fig. 2c–f). To assess the migration ability of the K14.MYC2 keratinocytes, we carried out an in vitro scrape wound assay. We plated both wildtype and K14.MYC2 primary keratinocytes on fibronectin, a major component of the provisional wound matrix8. Cells were treated with a subtoxic dose of mitomycin C to eliminate proliferation. A 1-mm scrape was placed through the middle of the cultures and plates were monitored for 24 hours. After 12 hours, wildtype keratinocytes had migrated and completely covered the scraped area by 24 hours, whereas K14.MYC2 keratinocytes were unable to migrate into the scraped area (Fig. 3). Integrins are cell surface molecules that mediate cell attachment and keratinocyte migration9–11. Integrins α6 and β1 are not only important for migration, but may have a role in epidermal stem cell maintenance, given their high levels of expression in these cells4,12. As it is thought that c-Myc represses integrin expression13,14, we determined integrin expression in K14.MYC2 mice. Notably, β1 integrin staining is greatly reduced at the wound edge and in non-wounded epidermis of K14.MYC2 mice compared with wildtype epidermis (Fig. 4a-d). Although we observed reduction of α6 integrin staining by immunofluorescence, we did not detect changes in α6 expression at the RNA level (data not shown). In contrast, β1 integrin transcripts were reduced by 55% in K14.MYC2 adult epidermis,

Fig. 2 K14.MYC2 mice exhibit impairment in wound healing. Full thickness wounds were created using a 3 mm punch on the backs of 7-week-old mice. Wounds were excised 4 days after wounding and analyzed histologically. Wildtype wounds were completely re-epithelialized (a), whereas K14.MYC2 wounds showed no evidence of re-epithelialization (b). Black dashed lines indicate the wound edges. Histologically, K14.MYC2 wounds show normal hyperproliferative wound edges, granulation and angiogenesis. BrdU analysis of wildtype and transgenic littermates at 1 day (c,d) and 4 days (e,f) after wounding revealed a 2-fold increase in the number of proliferative cells at the transgenic wound edge at both time points. BrdU positive cells appear green. Counterstain is K14 (red).

indicating that c-Myc represses β1 integrin expression at the transcriptional level (Fig. 5). Thus, c-Myc overexpression could impair keratinocyte migration through down-regulation of β1 integrin expression. These data also suggest that reduction of β1 integrin may cause the loss of stem cells in K14.MYC2 mice through reduced adherence to specific niches within the epidermis and hair follicles15. We used a label-retaining technique to assay the number of stem cells in K14.MYC2 epidermis16. By definition, epidermal stem cells rarely divide and have unlimited capacity for self-renewal17. We injected 10-day-old pups with 4 doses of BrdU over 48 hours and collected skin samples at 30 and 75 days after labeling, before spontaneous erosions developed. As stem cells have a longer period between divisions, they should be the only cells to retain the BrdU label after the 75-day chase period. The number of label-retaining cells (LRCs) detected in K14.MYC2 mice at 3 months of age (Fig. 6b) is 25% of that detected in wildtype mice. A shorter chase experiment (over 30 days) revealed a 50% reduction in the number of LRCs in the K14.MYC2 mice (Fig. 6a). To exclude the possibility that excessive c-Myc-induced proliferation, by itself, could explain the decrease in the number of stem cells, we carried out a labelretaining experiment on our previously developed transgenic mouse model which expresses MYC2 throughout the interfollicular epidermis, but not in stem cells. Although these mice show marked hyperproliferation, they do not develop spontaneous erosions6. Furthermore, the number of LRCs in this model is equivalent to that of wildtype mice (Fig. 6a). These data indicate that deregulated expression of c-Myc in stem cells leads to their depletion. To further exclude the possibility that stem cell depletion in K14.MYC2 mice is a secondary effect of epidermal hyperplasia, we cultured K14.MYC2 keratinocytes under conditions that enrich for LRCs by rapid attachment to specific substrates, and prevent keratinocytes from undergoing terminal differentiation18. Consistent with the reduction in LRCs, we observed a decrease in the number K14.MYC2 colonies (50% of wildtype controls) that grew on type IV collagen after rapid attachment of keratinocytes isolated from the ear epidermis of 8 week-old mice. Furthermore, the colonies that formed from K14.MYC2 primary keratinocytes were irregularly shaped and substantially smaller than those formed by wild-type keratinocytes (Fig. 6e,f). Taken together, these data demonstrate a gradual depletion of epidermal stem cells in the K14.MYC2 transgenic mice.

Fig. 3 K14.MYC2 primary keratinocytes exhibit a defect in migration. Primary keratinocytes were isolated from K14.MYC2 and wildtype pups. Primary keratinocytes were plated to 90-100% confluency and treated with mitomycin C. A 1 mm scrape was placed through the cultures. Migration into the scraped areas was monitored for 24 hours. Wildtype keratinocyte migration is observed by 12 hours and the scraped area is completely covered by 24 hours. K14.MYC2 keratinocytes exhibit minimal migration even at 24 hours.

166




a

b

c

d

Fig. 4 K14.MYC2 epidermis exhibits reduced staining for β1 integrin. Immunofluorescent staining for β1 integrin in the 4-day post-wounds of wildtype (a) and transgenic (b) littermates demonstrated a reduction in β1 integrin in the K14.MYC2 wound edge. β1 integrin is red (a,b). K14 counterstain is green. An analysis of unwounded epidermis in wildtype (c) and transgenic (d) littermates also revealed a reduction in β1 integrin in the K14.MYC2 epidermis. K14 counterstain in c,d is red. Yellow stain indicates coexpression of β1 integrin and K14.

Stem cell division gives rise to a daughter transit amplifying cell that continues to divide to populate the epidermis and a daughter stem cell that retains its parent stem cell property19. Like other cells, division of a stem cell requires the elevation of c-Myc, as c-Myc is required for transition from G1 to S phases of the cell cycle20. We suspect that transit amplifying cells continue to express elevated levels of c-Myc to facilitate subsequent cell divisions. In contrast, the daughter stem cell would be expected to down-regulate c-Myc to allow the cell to become quiescent. In our mouse model, c-Myc expression is forced in all basal cells including stem cells. As MYC2 transgene expression levels are relatively low in heterozygous K14.MYC2 epidermis, approximately 5% of MYC2 levels in the epidermis of ML.MYC2 mice6, normal mechanisms maintaining homeostasis may be able to minimize the effects of deregulated cMyc expression, thus leading to only a gradual depletion of stem cells. In addition, the mild hyperplasia caused by c-Myc expression in transit amplifying cells prevents thinning of the epidermis, which would be expected to occur with gradual stem cell depletion. However, in response to injury, repair mechanisms would induce stem cell division. As K14.MYC2 keratinocytes are unable to migrate into the wounded area, we speculate that persistent renewal signals, coupled with the elevated levels of c-Myc, would lead to the acceleration of stem cell depletion. Our observations may also provide an explanation for the depletion of epithelial stem cells in the small intestine of Tcf4 knockout mice. c-Myc is a known target of the β-catenin/TCF signaling pathway. In the absence of β-catenin, Tcf4 is able to bind to the Myc promoter and repress transcription2. Although c-Myc expression was not examined in the Tcf4 knockout1, we suspect that c-Myc levels are elevated in the intestinal epithelial stem cells, thus leading to the depletion of stem cells. We have demonstrated that constitutive expression of c-Myc in epidermal stem cells causes their depletion. In an independent study, Arnold and Watt have taken a different transgenic approach that allows the regulated activation of c-Myc in epidermal stem cells, and arrived at similar conclusions21. The identification of c-Myc as a regulator of epidermal stem cell maintenance may help to develop a strategy for the manipulation of stem cell expansion and preservation.

Methods Generation of K14.MYC2 transgenic mice. We made the K14.MYC2 construct by subcloning the cDNA of human MYC with a 5′ NotI restriction site and a 3′ ClaI restriction site into the pSL1190 vector containing a nature genetics • volume 28 • june 2001

letter

Fig. 5 c-Myc represses transcription of β1 integrin. RPA analysis revealed a 55% decrease in β1 integrin mRNA levels in K14.MYC2 transgenic skin as compared to wildtype skin. Cyclophilin was used as the control.

generic intron. We subcloned both the MYC cDNA and generic intron into a human keratin 14 vector containing the human growth hormone (hGH) polyadenylation (poly-A) signal22. The human keratin 14 vector directs expression to the outer root sheet of the hair follicle and the basal layer of the interfollicular epidermis, including stem cells7. The MYC cDNA used will generate only the full length mRNA of MYC2 (beginning at the second AUG start site). The K14.MYC2 construct was sequenced to confirm wildtype sequence. We microinjected the purified construct into single cell mouse embryos obtained from matings of ICR females with FVB males, and placed the embryos into the oviduct of pseudopregnant females. We identified K14.MYC2 transgenic pups by PCR analysis of isolated tail DNA using specific oligonucleotides to the K14.MYC2 construct. RNA analysis. We isolated total RNA from the adult back skin using RNAzol (Tel-Test). RT-PCR was performed using an internal human MYC2 primer (5′–GCATACATCCTGTCCGTC–3′) and a primer in the hGH poly-A region of the transgene (5′–CACTGGAGTGGCAACTCC–3′), generating a product of approximately 250 bp. Primers to the 18S subunit cDNA (Ambion), generating a product of 488 bp, were used as an internal control. Integrin RNAse Protection Assays (RPA) were performed using the RPAII kit (Ambion). The integrin β1 probe was generated using primers (5′–TGTTCAGTGCAGAGCCTTCA–3′) and (5′–CCTCATACT TCGGATTGACC–3′) yielding a PCR product of about 400 bp. Cyclophilin was used as the control. The intensity of the protected bands was quantitated using the QuantiScan program (Biosoft). BrdU labeling analysis and label-retaining cell analysis. Short-term labeling period: Adult K14.MYC2 and wildtype littermates were injected (i.p.) with BrdU (Sigma) at 250 mg/kg in 0.9% NaCl and sacrificed 1 hour later. Label-retaining cell analysis (short term chase period): Tenday-old pups were injected with 20 µl of 12.5 mg/ml BrdU every 12 hours for a total of 4 injections. Eleven K14.MYC2 mice and 4 ML.MYC2 mice, together with the same number of non-transgenic littermates were included in the label-retaining cell analysis. Skin sections were collected at 30 days from 8 K14.MYC2 mice and 8 non-transgenic controls, and from 4 ML.MYC2 mice and 3 non-transgenic controls. Long term chase period: Skin sections from 3 K14.MYC2 mice and 3 non-transgenic controls were collected 75 days after the last injection (same injection schedule as for short term chase) and fixed as described previously23. All skin samples were collected before the onset of spontaneous erosions. BrdU uptake was detected using fluorescein isothiocyanate-conjugated mAb to BrdU (Becton Dickenson). Skin sections were also counterstained with guinea pig antiserum to mouse K14, which was visualized with biotinylated anti-guinea pig IgG (Vector Laboratories) and StreptavidinTexas Red (GIBCO). BrdU labeled cells were counted from three tissue sections from each mouse skin. Contiguous fields (5 to 8 fields under a 20X lens) were counted from each tissue section.

167


letter b

a

of 50% CM, were allowed to rapidly adhere to Collagen IV (Becton Dickinson) coated 6-well plates for 10 minutes. Plates were thoroughly washed with PBS to remove cells, which did not adhere to the plate. Adherent cells were fed every 2 to 3 days with 50% CM. After 30 days colonies were photographed, stained with crystal violet and counted.


Wound-healing analysis. Four 3-mm punch biopsies (Miltex) were generated in the middle of the back of 7-week-old K14.MYC2 and wildtype littermates. Wounds were excised and fixed in either 10% NBF for H&E staining or ethanol for BrdU and integrin analysis.

c

d Acknowledgments

e

f

We would like to thank C.V. Dang for providing the human MYC cDNA and M. Rosenberg for providing the K14 vector. We would like to thank J. Bickenbach and M. Aumailley for experimental suggestions and interpretations, and P. Koch, S. Wojcik, C. Caulin, and M. Schneider for technical suggestions and comments on the manuscript. We also thank I. Arnold and F. Watt for communicating results prior to publication. This work was supported by National Institutes of Health Grants AR62228, CA52607, and HD25479 awarded to D.R. Roop, and CA79998 awarded to X.J. Wang. R.L. Waikel was supported by a Molecular Oncology Training Grant CA09197. Received 22 January; accepted 30 March 2001. 1. 2.

Fig. 6 K14.MYC2 epidermis exhibits a reduction in the number of stem cells. Stem cells were identified using long term label-retaining analysis. Ten-day-old K14.MYC2 and ML.MYC2 pups and their non-transgenic littermates (wildtype) were injected with 4 doses of BrdU to label all mitotic cells. Skins were collected 30 days and 75 days after injection. K14.MYC2 epidermis exhibits a 50% and 75% reduction in the number of label-retaining cells in the epidermis at 30 days (n=8) and 75 days (n=3), respectively (a,b). These data were determined to be statistically significant using T-Test analysis. Whereas ML.MYC2 epidermis (n=4) exhibits a similar number of label-retaining cells as non-transgenic littermates (n=3) at 30 days (a). Wildtype epidermis exhibits label-retaining cells in both the epidermis and dermis (c). However, label-retaining cells are only apparent in the dermis of K14.MYC2 skin, and rarely seen in the epidermis (d). The counterstain is K14 (red). Co-localization of BrdU and K14 appears yellow. A rapid attachment assay was also used to compare the number of stem cells present in K14.MYC2 transgenic epidermis. K14.MYC2 keratinocytes formed 50% less colonies as compared to wildtype keratinocytes. K14.MYC2 colonies were small and irregularly shaped (e), while wildtype colonies were typically large with smooth edges (f).

3. 4.

5.

6.

7. 8. 9. 10. 11. 12.

Histological analysis and immunofluorescence. Skin sections for histological analysis were collected and fixed in 10% formalin-neutral buffer (NBF). Samples were then embedded in paraffin, sectioned and stained with hematoxylin and eosin (H&E). Skin samples for immunofluorescence were fixed in the same manner as the BrdU samples. Deparaffinized sections were incubated with a guinea pig antibody against K14 and a rat monoclonal antibody to β1 integrin (MAB1997, Chemicon). K14 was visualized with FITC-rabbit antiguinea pig (Zymed; Fig. 4a,b) or with biotinylated goat anti-guinea pig IgG and Streptavidin-Texas Red (Fig. 4c,d). β1 integrin was visualized with biotinylated goat anti-rat (PharMingen) and Streptavidin-Texas Red (Fig. 4a,b) or, alternatively, with FITC-rabbit anti-rat (Zymed; Fig. 4c,d). We carried out Oil Red O staining on frozen sections from 8-week-old adult skin24. Cell culture and in vitro scrape assay. Primary keratinocytes were prepared from pups less than 24 hours old as previously described25 and grown in 50% fibroblast conditioned medium supplemented with 0.05 mM Ca2+ (50% CM). Both wildtype and K14.MYC2 primary keratinocytes were plated on 6well plates coated with fibronectin (Becton Dickinson). Cells were allowed to adhere for 12 hours, washed with PBS, and treated with mitomycin C (8 µg/ml) in culture media for 2 hours to eliminate proliferation. Cells were washed with PBS and a 1 mm scrape was placed through the middle of the cultures with a yellow pipette tip (Fisher). Cells were fed with 50% CM.

13.

14.

15. 16. 17

18. 19. 20.

21. 22.

23.

24.

Colony-forming assay. We isolated primary keratinocytes from the ears of 8-week-old mice as previously described18. 2.5×105 keratinocytes in 0.5 ml

168

25.

Korinek, V. et al. Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4. Nature Genet. 19, 379–383 (1998). He, T.C., Sparks, A.B., Rago, C., Hermeking, H., Zawel, L., da Costa, L.T., Morin, P.J., Vogelstein, B. & Kinzler, K.W. Identification of c-MYC as a target of the APC pathway. Science. 281, 1509–1512 (1998). Gandarillas, A. & Watt, F.M. c-Myc promotes differentiation of human epidermal stem cells. Genes Dev. 11, 2869–2882 (1997). Jones, P.H. & Watt, F.M. Separation of human epidermal stem cells from transient amplifying cells on the basis of differences in integrin function and expression. Cell 73, 713–724 (1993). Amati, B. & Land, H. Myc-Max-Mad: a transcription factor network controlling cell cycle progression, differentiation and death. Curr. Opin. Genet. Dev. 4, 102–108 (1994). Waikel, R.L., Wang, X.J. & Roop, D.R. Targeted expression of c-Myc in the epidermis alters normal proliferation, differentiation and UV-B induced apoptosis. Oncogene 18, 4870–4878 (1999). Arin, M., Longley, M., Wang, X. & Roop, D.R. Focal activation of a mutant allele defines the role of stem cells in mosaic skin disorders. J. Cell Biol. 152, 645–50 (2001). Clark, R.A. et al. Fibronectin and fibrin provide a provisional matrix for epidermal cell migration during wound re-epithelialization. J. Invest. Dermatol. 79, 264–269 (1982). Kim, J.P. et al. Mechanism of human keratinocyte migration on fibronectin: unique roles of RGD site and integrins. J. Cell. Physiol. 151, 443–450 (1992). Georges-Labouesse E. et al. Absence of integrin α6 leads to epidermolysis bullosa and neonatal death in mice. Nature Genet. 13, 370–373 (1996). Guo, M., Toda, K. & Grinnell, F. Activation of human keratinocyte migration on type I collagen and fibronectin. J. Cell. Sci. 96, 197–205 (1990). Tani, H., Morris, R.J. & Kaur, P. Enrichment for murine keratinocyte stem cells based on cell surface phenotype. Proc. Natl. Acad. Sci. USA 97, 10960–10965 (2000). Barr, L.F., Campbell, S.E., Bochner, B.S. & Dang, C.V. Association of the decreased expression of α3β1 integrin with the altered cell: environmental interactions and enhanced soft agar cloning ability of c-Myc-overexpressing small cell lung cancer cells. Cancer Res. 58, 5537–5545 (1998). Judware, R. & Culp, L.A. Concomitant down-regulation of expression of integrin subunits by N-Myc in human neuroblastoma cells: differential regulation of α2, α3 and β1. Oncogene. 14, 1341–1350 (1997). Watt, F.M. & Hogan, B.L. Out of Eden: stem cells and their niches. Science. 287, 1427–1430 (2000). Mackenzie, I.C. & Bickenbach, J.R. Label-retaining keratinocytes and Langerhans cells in mouse epithelia. Cell. Tissue. Res. 242, 551–556 (1985). Potten, C.S., Wichmann, H.E., Loeffler, M., Dobek, K. & Major, D. Evidence for discrete cell kinetic subpopulations in mouse epidermis based on mathematical analysis. Cell. Tissue Kinet. 15, 305–329 (1982). Bickenbach, J.R. & Chism, E. Selection and extended growth of murine epidermal stem cells in culture. Exp. Cell. Res. 244, 184–195 (1998). Watt, F. Epidermal stem cells: markers, patterning and the control of stem cell fate. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 353, 831–837 (1998). Biro, S., Fu, Y.M., Yu, Z.X. & Epstein, S.E. Inhibitory effects of antisense oligodeoxynucleotides targeting c-Myc mRNA on smooth muscle cell proliferation and migration. Proc. Natl. Acad. Sci. USA. 90, 654–658 (1993). Arnold, I. & Watt, F.M. c-Myc activation in transgenic mouse epidermis results in mobilization of stem cells and differentiation of their progeny. Curr. Biol. (in press). Berton, T.R. et al. Characterization of an inducible, epidermal-specific knockout system: differential expression of lacZ in different Cre reporter mouse strains. Genesis 26, 160–161 (2000). Wang, X.J., Greenhalgh, D.A., Lu, X.R., Bickenbach, J.R. & Roop, D.R. TGFα and v-fos cooperation in transgenic mouse epidermis induces aberrant keratinocyte differentiation and stable, autonomous papillomas. Oncogene. 10, 279–289 (1995). Wang, N.D. et al. Impaired energy homeostasis in C/EBP alpha knockout mice. Science. 269, 1108–1112 (1995). Stanley, J.R. & Yuspa, S.H. Specific epidermal protein markers are modulated during calcium-induced terminal differentiation. J. Cell. Biol. 96, 1809–1814 (1983).
