light-chain gene - Europe PMC

Proc. Natl. Acad. Sci. USA Vol. 83, pp. 2195-2199, April 1986 Immunology

Cloning and sequence determination of a human rheumatoid factor light-chain gene (human hybridoma/idiotypes/chronic lymphatic leukemia)

FRANK R. JIRIK*, JOE SORGE*, SHERMAN FONG*, JoY G. HEITZMANNt, JOHN G. CURD*, POJEN P. CHEN*, ROBERT GOLDFIEN*, AND DENNIS A. CARSON* *Department of Basic and Clinical Research, Scripps Clinic and Research Foundation, 10666 North Torrey Pines Road, La Jolla, CA 92037; and tDevelopmental Biology Laboratory, The Salk Institute, P.O. Box 85800, San Diego, CA 92138

Communicated by J. Edwin Seegmiller, November 25, 1985

ABSTRACT The contribution of germ-line variable regions to autoantibody formation in humans is poorly understood. To study the gene structure of a human autoantibody, chronic lymphatic leukemia (CLL) cells from a patient with an IgM anti-IgG (rheumatoid factor, RF) paraprotein were utilized. The rearranged immunoglobulin gene encoding the K light chain for the RF was cloned, and the nucleic acid sequence of its variable region was determined. As demonstrated by Southern blot analysis using a Kjoining-region probe, the CLL cells, stable CLL-WIL2-729-HF2 RF-secreting hybridomas, and the cloned light-chain gene all had an identical restriction fragment containing the rearranged light-chain gene. The CLL RF light chains reacted weakly with an antipeptide antibody against a primary structure-dependent idiotype present on the light chains of the majority of IgM RF paraproteins. The nucleotide and predicted amino acid sequences of the CLL light-chain gene place it in the K Im variable-region subgroup, and a comparison to known RF paraproteins reveals marked homology to the light-chain amino acid sequence of the IgM RF paraprotein Pom. Both Pom and the CLL light chain appear to identify a second K Ill gene or gene group that is able to encode RF paraprotein light chains.

ently physiologic mechanism goes awry in autoimmune diseases is not clear. Information concerning the genes encoding IgM RF or other human autoantibodies is entirely lacking. To analyze the genetic basis for RF synthesis in normal and autoimmune states requires both clonal sources of RF-producing cells and specific gene probes. In this study, the malignant B lymphocytes from a patient with chronic lymphatic leukemia (CLL), and an associated IgM RF cryoglobulin, were used to clone and sequence a rearranged autoantibody light-chain gene and to generate IgM RF-secreting hybridomas.

MATERIALS AND METHODS Lymphocyte Isolation and B-Cell Hybridization. Peripheral blood lymphocytes (>85% malignant cells) were obtained, prior to antineoplastic drug therapy, from a 74-year-old woman with CLL associated with ulcerating cutaneous vasculitis ofthe lower extremities and with a monoclonal IgM cryoglobulin, with RF activity. The CLL cells were either used immediately or cryopreserved in liquid nitrogen. The CLL cells were fused with the hypoxanthine phosphoribosyltransferase (HPRT)-deficient WIL2-729-HF2 lymphoblastoid B-cell line as described (16, 17), except that the CLL cells were not stimulated in vitro. The WIL2-729-HF2 cells were provided by R. Lundak, formerly at University of California, Riverside. In brief, 1.7 x 107 washed CLL cells were fused with 4.4 x 107 WIL2-729-HF2 cells (fusion ratio 1:2.5) and were plated at either 1.75 x 105 or 2.5 x 105 cells per well in microwell trays containing murine peritoneal macrophage feeder layers. Control wells contained nonfused CLL cells, WIL2-729-HF2 cells, or mixtures of these cells. Hypoxanthine/aminopterin/thymidine (HAT) selective medium was added to all wells. Two to three weeks after fusion, supernatants were harvested from control and fusion wells and tested for Ig and IgM RF secretion by enzyme-linked immunosorbent assay (ELISA) as described (18). RF-positive wells were then expanded, subcloned by limiting dilution, and retested for RF activity. Anti-Idiotype Antibodies. The synthesis of multiple synthetic peptides corresponding to the individual CDR structures in the light and heavy chains of different IgM RF paraproteins and the preparation of antipeptide antibodies has been described in detail (13). The most important peptide, PSL2, corresponds to the second CDR and adjacent framework of the monoclonal IgM RF Sie K chain (19) and has the structure Tyr-Gly-Ala-Ser-Ser-Arg-Ala-Thr-Gly-Ile-Pro-Asp-Arg-(Cys). Cysteine was added to the C terminus to facilitate chemical coupling to the carrier protein, keyhole limpet

High titers of IgM anti-IgG autoantibodies (rheumatoid factor, RF) are highly characteristic of rheumatoid arthritis, Sjogren syndrome, and certain other autoimmune diseases (1). In both humans and mice, IgM RF synthesis regularly accompanies secondary immune responses to foreign antigens (2-4). Passive transfer of immune complexes and primed T cells into mice triggers transient IgM RF production (5, 6). It has been proposed that IgM RF autoantibodies amplify IgG antibody avidity, thus promoting the clearance of circulating immune complexes (7). Monoclonal human IgM paraproteins from patients with Waldenstrom macroglobulinemia frequently have anti-IgG autoantibody activity (8, 9). The amino acid sequences of isolated RF light chains from unrelated patients are remarkably alike (10, 11). These RF autoantibodies often share crossreactive idiotypes (CRI) which were detected originally with rabbit antisera against intact immunoglobulin (12). Antibodies against synthetic peptides, corresponding to individual complementarity-determining regions (CDR) on RF heavy and light chains, have localized a major CRI to the second CDR of the K light chains (13, 14). These data have been interpreted to indicate that a conserved gene or gene family encodes many RF light chains. Conceivably, RF genes have been conserved in evolution as a result of the autoantibody's beneficial role in immune responses against environmentally important pathogens (15). How this appar-

Abbreviations: CDR, complementarity-determining region(s); CLL, chronic lymphatic leukemia; CRI, crossreactive idiotype(s); FR, framework region(s); J, joining; RF, rheumatoid factor(s); V, variable; kb, kilobase(s).

The publication costs of this article were defrayed in part by page charge

payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

2195

2196

Immunology: Jirik et al.

hemocyanin (KLH), as described (20). Antipeptide antibodies were raised by immunizing rabbits with peptide-KLH conjugates emulsified in Freund's complete adjuvant. Protein Purification and Immunoblotting. Serum IgM RF was purified by repeated cryoprecipitation, followed by chromatography over Sephadex G-200 in 0.1 M acetic acid. The purified IgM RF was analyzed with the multiple antipeptide antibodies by immunoblotting (21). Approximately 10 ,ug of purified IgM RF in 20 ,ul of phosphate buffer with 0.01% 2-mercaptoethanol was separated by electrophoresis in a 10% polyacrylamide slab gel containing 0.1% sodium dodecyl sulfate. The protein bands were transferred onto nitrocellulose paper and probed with the antipeptide antibodies, followed by 125I-labeled protein A (18). Cloning of the Light-Chain Gene. CLL cell DNA was partially digested with Mbo I (New England Biolabs). Fragments 10-20 kilobases (kb) long, obtained by sucrose density centrifugation, were ligated with bacteriophage T4 DNA ligase (New England Biolabs) to the BamHI sites of the phage EMBL3 (22). Ligated DNA was incorporated into X phage heads using a high-efficiency in vitro packaging system (Vector Cloning Systems, San Diego, CA). Escherichia coli Q359 served as the host. By use of standard techniques (23), recombinants were screened with a 12-kb, [a-32P]dCTP (New England Nuclear)-labeled, human genomic K joining (JK)region probe obtained from P. Leder (Department of Genetics, Harvard Medical School) (24). Phage clones hybridizing to this probe were isolated and mapped using restriction endonucleases. Appropriate DNA fragments were isolated by agarose or acrylamide gel electrophoresis and subcloned in the plasmid pUC13 (25). Southern Blotting and DNA Sequencing. DNA blotting was done as previously described (26) except that GeneScreen Plus (New England Nuclear) membrane was used, and washes were carried out with 2 x standard saline citrate (1 x SSC is 0.15 M sodium chloride/0.015 M sodium citrate) and with 0.1x SSC/0.1% NaDodSO4 at room temperature and 60°C, respectively. The probes were a 1.8-kb Sac I subfragment, spanning the J regions from the human genomic JK fragment described above (24), and a human K variable (VK)-region cDNA (NG9), kindly provided by D. Bentley (Fred Hutchinson Cancer Research Center, Seattle, WA) (27). After restriction mapping, fragments were isolated and subcloned in pUC13. The nucleotide sequence was determined by the technique of Maxam and Gilbert (28). Both strands of the subclones were labeled either with polynucleotide kinase (New England Biolabs), or with the large fragment of DNA polymerase (New England Biolabs), or with terminal deoxynucleotidyltransferase (Bethesda Research Laboratories) as described (28). 2',3'-Dideoxyadenosine 5'-[a-32P]triphosphate (Amersham) was used in the terminal deoxynucleotidyltransferase labeling procedure.

RESULTS Generation and Characterization of IgM RF-Secreting Hybridomas. IgM and IgM RF were released into the supernatants of the parental CLL cell cultures. The production of antibody was inhibited by supplementation of the culture medium with cycloheximide (100 ,ug/ml). The CLL cells were fused with WIL2-729-HF2 human lymphoblastoid cells, and hybridomas were selected in medium containing hypoxanthine, aminopterin, and thymidine (HAT). After 2 weeks, no viable cells remained in control cultures containing either nonfused parental cells or mixtures of both parental cell types; growth of HAT-resistant hybridomas was observed in 10% of the wells in which fused cells were plated. Hybridomas secreting IgM RF were identified by ELISA and were subcloned over murine peritoneal

Proc. Natl. Acad. Sci. USA 83 (1986) macrophage feeder layers. Autoantibody-secreting hybridomas have remained stable during 8 months growth in vitro. In dense cultures the IgM RF concentration is -416 ,ug/ml and is cycloheximide-inhibitable. CLL hybridomas stably secreting IgM RF were recovered at a frequency of 10-6. Reactivity of IgM RF with Anti-Idiotype Antibodies. The K light chains of the purified IgM RF from the CLL cells were probed by immunoblotting with different anti-idiotype antibodies that have been described in detail (13). Only the anti-PSL2 reagent recognized the CLL protein (Fig. 1). The anti-PSL2 rabbit antibody, prepared by immunization with a synthetic peptide, recognizes a predominant CRI on the light chains of IgM RF paraproteins (14). The reagent reacted weakly with the CLL RF light chain and with the light chain of monoclonal IgM RF Pom (19). Pom differs from the PSL2-associated sequence by two amino acids. The antiPSL2 antibody bound more weakly to the CLL RF and Pom light chains than to IgM RF Sie, which contains the prototype PSL2 sequence (Fig. 1). The anti-PSL2 did not react at all with IgM RF Lay, which differs from the PSL2-defined sequence by five amino acid residues (19). Cloning of CLL RF Light-Chain Gene. Approximately 2 x 106 recombinant phage plaques were screened with the human genomic JK-region probe. Four positive clones were isolated (K1-4). Following digestion with Sac I and Pvu II, clone K1 showed a unique fragment that hybridized with both the JK and NG9 VK probes. The other three phage clones contained the appropriately sized restriction fragments corresponding to the germ-line J region and hybridized only with the JK probe. To ascertain whether the restriction fragment of phage clone K1 contained the same size rearranged VK gene as the IgM RF-secreting CLL cells and CLL hybridomas, DNA from those two sources was digested with Sac I. DNA blotting of both the CLL cells and the CLL hybridomas revealed a restriction fragment corresponding to the single CLL K light-chain gene rearrangement (Fig. 2). The Sac I digest restriction fragment in phage clone K1 was the same size. The 1.8-kb band corresponds to the germ-line JK region, and the 5.5-kb band to the JK rearrangements in WIL2-729HF2. DNA Sequence and Comparison to Other K Subgroup-III Genes. The nucleic acid sequence of the rearranged CLL

F

...

:

u-m-9. anti-human Ig

anti-PSL2

FIG. 1. Immunoblot analysis of the reactivity of the CLL light chain with anti-PSL2 antiserum. Approximately 20 ,ug of each paraprotein was fractionated by NaDodSO4/10% PAGE. After transfer to nitrocellulose paper, the samples were treated, respectively, with anti-human Ig (Left) and anti-PSL2 (Right) antisera, followed by '251-labeled protein A. The blots were exposed to Kodak XAR film for 8 hr. Positions of A and y heavy chains and of light chains (L) are indicated.

Immunology: Jirik et al.

Proc. Natl. Acad. Sci. USA 83 (1986)

30A and the junctional codon 96, the sequence is -92% homologous to three published K III gene sequences of unknown specificity. These include two germ-line K V-region genes [Vg and Vh (29)] and one rearranged gene [NG9 (27)] that exhibit -93% homology at the nucleotide level. The majority of codon differences among these three V-region genes and the CLL V-region gene are single nucleotide changes. These are conservative in =40% of the codons and lead to amino acid substitutions in =60% of the codons. Taking into account the variation in length of the different CDR and framework regions (FR), CDR3 has the highest proportion of base pair (and amino acid) differences, not including the junctional codon at position 96. The CLL and Vg sequences both lack the additional codon

la '0

0-o

04 .n

0._

I-5 "I

I

-

5

in CDR1 that is -18

SacI

SacI

.JJKi

CK

JK probe

1 kb FIG. 2. Southern blot of DNA from the CLL cells, CLL hybrids, WIL2-729-HF2 cells, and the phage (K1) containing the cloned light-chain gene. The DNA was cut with Sac I and probed with the 1.8-kb JK Sac I fragment. Molecular size markers are shown at right. The 2.5-kb mark indicates the position of the rearranged gene. In the diagram below the autoradiograms, J-region segments J1-J5 and the constant (CK) region are shown in black.

light-chain V region is shown in Fig. 3. Included are the leader sequence, intron, V region, and J region. Excluding codon -272 SacI

2197

seen

in the amino acid

sequence

of many

K

III chains. The absence of codon 30A (29) and the presence of the codon for alanine in position 9 places the CLL light chain (and Vg) in the K IIIa "sub-subgroup" (11). A comparison of the leader peptide (L and L') nucleic acid sequences of Vg, Vh, and CLL V regions reveals 95% homology. Similarly, the intron regions reveal extensive homology. In the third CDR of the CLL gene, codon 96 (CCG, proline) has probably been formed by union of J- and V-regionflanking nucleotides. From position 97 to 109 the complete Ji-region sequence (24) is present. Comparison of CLL Light-Chain Amino Acid Sequence with Other Monoclonal RE. The predicted amino acid sequence of the CLL RF light chain is shown in Fig. 4. The partial amino acid sequence of the purified RF light chain as determined by Edman degradation (30) is identical through residue 30. A comparison of the CLL V-region sequence to a proposed RF K III light-chain prototype sequence (14), excluding the additional residue in CDR1 and the junctionally diverse residue 96, reveals 14 amino acid differences (i.e., 85% homology). The CDR1 of the CLL light chain lacks the extra I

L

GAGCTCTGGGGAGGAACTGCTCAGTTAGGACCCAGACGGAACCATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCC

CLL Vg

-

-

Vh -183

CAGGTGAGGGGAATATGAGGTGGTTTTGCACATCAGTGAAAACTCCTGCCACCTCTGCTCAGCAAGAAATATAATTAAAATTCAATGTA -T ------T--------------------A--Vg--------C--------Vh ------------- C --------------------------------------------------------------~~~~~ -94 ,IL CLL GATCAACAATTTTGGCTCTCCTTAAAGACAGTGGGTTTGATTTTGATTACATGAGTGCATTTCTGTTTTGTTTCCAATTTCAGATACCA Vg T------------------A--C---------T--------C---------------------------A------------------CLL

Vh

-------------------

A--C--------CT--------C-A -------------------------A--------C-TG ------

FRI Pst4 1 CTGGCGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGT

-5

CLL Vg Vh NG9 HK101 CLL

Vg Vh NG9

-----------C--A-----T--- T----A---------------------T----------------------------CA-A- -T--A-----A---------C-------T--------T-------------------------------A-----T---T---------------G----------T--------------------------------------------------T--T-A------- CA---GT_--A--C_---T----A--A-T--TC----G--G_--G-GAT-T--C--CCA ------C 85 CDRI I KpnI I FR2 I CDR2

GTTAGT( )AACAACTTAGCCTGGTACCAGCAAAAACCTGGCCAGCCTCCCAGGCTCCTCATTTATGGTGCATCCACCAGGGCCACTGG -----C( )-G-T----------------A--G------------G----------------C----A--------A----

.CAGC-G-T-----A-------T-----G------------G-G--------------C------------------------A-

-----CAGC-G-T-------------------G------------G----------------C--------TA---G-----------HK101 A----C( )-G-TGG___________-T-____G-___A-AGA-AG-C--T-A-TC_---GG--C_----C-____ GTTT-CAA-G--174 PStI FR3 CLL TATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGGCTGCAGTCTGAAGATTTTGCAGTTTATT

Vg

C--------------------------------------C-------------------C--AG--C--------------------C---C-C----C--------------------NG9 C-------A -----------------C------------C--- G--C ----------------G---HK101 GG---T-A --------C--------A -----------T--------------------C------C------------AC----ii 263 I CDR3 I I I CLL ACTGTCAGCAGTATAATAATTGGCCTCCGTGGACGTTCGGCCAGGGGACCAGGGTGGAAATCAAACGTGAGTAGAATTTACAGTTTGCT Vg -----------CG--GC--C-----Vh -----------G--C----C-TA--NG9 --------------GG-----CA-AG HK101 ----C--A----------G--AC--FIG. 3. DNA sequence comparison of the CLL light-chain, Vg, Vh, and NG9 VK III genes and a VK I gene, HK101 (27). The FR, CDR, J region, and leader (L and L') regions are indicated. Nucleotide identity is shown with dashes. As has been proposed (29), the codon for the extra amino acid in CDR1 has been placed at position 30A (absence indicated by parentheses). Codon 96 immediately follows CDR3.

Vhi

2198


Immunology: Jirik et al. FR1 23

1

FR2 CDR1 * 49 34 RASQSVSSSYLA WYQQKPGQAPRLLIY -------N---- ---------------

RF K III Sie

EIVLTQSPGTLSLSPGERATLSC

CLL

---M----A---V------------M----V---V----------

-------

NN--

--------P------

Pom

-----I-N----

------SGS------

Lay

D-QM----SS--V-V-D-V-IT-

Q---N-- A--N

-------L--K----

----------------------

CDR3 FR3 CDR2 95 88 56 50 RF K III GASSRAT GIPDRFSGSGSGTDFTLTISRLEPEDFAVYYC QQYGSSP Sie-----c- ------------------------D------- ---------T-----T---

---A---------E--------QS--------

---NNW-

Pom

---A---------E------S-QS--------

---NNW-

Lay

---T-EA

-V-S------------F---S-Q-E-I-T---

---NNW-

CLL

FIG. 4. Amino acid sequence comparison between the CLL light-chain predicted sequence and the paraproteins Sie and Pom (K III) and Lay (K I), and a proposed prototype RF K III light-chain sequence. Based on nucleic acid sequence data (29), the additional amino acid in CDR1 (designated by *) has been placed in position 30A. Standard one-letter amino acid abbreviations are used.

amino acid at position 30A and has asparagine at residues 31 and 32. Among all K III light chains sequenced to date, the CLL RF light-chain amino acid sequence is most homologous (91%) with the light chain of the IgM RF Pom (Fig. 4). The CLL RF and Pom have 10 amino acids in common that are not found in other RF paraproteins, and they share identical sequences in CDR3 and CDR2.

DISCUSSION Autoimmune phenomena, particularly hemolytic anemia, are

known to occur in CLL (31). However, the high-level secretion of monoclonal immunoglobulin autoantibodies is more typical of W4ldenstr6m macroglobulinemia. These two diseases probably'represent the neoplastic transformation of B lymphocytes at different stages of development. The remarkable prevalence of RF autoantibodies among monoclonal IgM paraproteins may relate to the origin of particular neoplastic B-cell clones. CLL cells, which appear to arise from a subset of surface immunoglobulin-bearing immature cells, frequently express a T-cell-associated surface antigen, designated T1 (32). The murine homolog of this antigen (Ly-1) has been reported to identify a B-cell subset that secretes predominantly IgM autoantibodies and is particularly abundant among peritoneal lymphocytes (33). Immunoglobulin secretion by malignant human B lymphocytes can be maintained and even enhanced by fusion with an appropriate lymphoblastoid or plasma cell line (34-36). The B-cell hybridomas derived by fusion of the CLL cells with the WIL2-729-HF2 lymphoblastoid cell line have continued to secrete IgM RF during 8 months continuous passage in tissue culture under nonselective conditions. It would be of interest to determine the frequency of autoantibody production by hybridomas derived from cells from nonsecreting human B-cell malignancies bearing the T1 marker. To probe the primary structure of the isolated IgM RF, the light and heavy chains were reacted with several different anti-idiotype antibodies. These antibodies were made against synthetic peptides corresponding to individual CDR of RF paraproteins of known amino acid sequence (13). They recognize idiotypic antigens that are mainly determined by primary structure, although secondary structure may account for minor differences. The anti-PSL2 antibody, which distinguishes sequences in the second CDR of many monoclonal IgM RF (14), appeared to react weakly with the light chains of the CLL paraprotein and with those of another monoclonal IgM RF, designated Pom. The Pom sequence differs from PSL2 by two amino acid residues (13). This result suggested that the monoclonal light chains from the CLL

cells also diverged from the PSL2 prototype sequence by about two residues. The rearranged K light-chain V-region gene from the CLL cells was cloned, and its complete nucleotide sequence was determined. We are certain that the RF VK gene has been cloned, since Southern blotting identified a single rearranged gene with the same restriction fragment size as in the CLL cells and the RF-secreting CLL hybridomas. Moreover, the amino acid sequence of the isolated K chain has been determined through position 30 and is identical to the deduced sequence of the cloned VK-region gene. The predicted amino acid sequence of the CLL K chain and the known K-chain sequence of the monoclonal IgM RF Pom (19) display many similarities. Notably, the sequences in the PSL2-defined second CDR are identical, as suggested by the antipeptide antibody studies. The third CDR of the two autoantibodies is the same. A comparison of the CLL light-chain DNA sequence to the sequences of two germ-line VK III genes of unknown specificity (29) reveals not only regions of homology (Fig. 3) but also differences suggestive of a distinct germ-line V-region origin for the leukemiaassociated K chain. This suggestion is strengthened by the finding that many of the novel codons in the CLL VK gene correspond to amino acid residues in the Pom sequence. It is improbable that the amino acid sequences of the CLL and Pom K chains would both differ identically in 10 amino acids from other reported K III sequences (Fig. 4). Rather, the Pom and CLL K chains probably originate from a separate family of germ-line VK genes, despite differing substantially in the first CDR. The monoclonal IgM RF studied to date have derived from abnormal or frankly malignant B lymphocytes or plasma cells. Such cells may not encounter the selection pressures that accompany antigen-driven immune responses (37, 38). Hence, the relative lack of sequence diversity among the Ig RF paraproteins is not entirely unexpected. In the future, a combination of defined antipeptide antibodies, oligonucleotide probes, and RF-secreting hybridomas should permit one to trace the genetic origin and diversification of the immunoglobulin genes used in autoantibody production in rheumatoid arthritis and other autoimmune disease states. We thank Dr. P. Leder and Dr. D. L. Bentley for supplying the cloned genes. The assistance of Ms. M. Lewis and Ms. C. Carter is gratefully acknowledged. This research was supported in part by National Institutes of Health Grants AM25443, AGO4100, AM35218, AM07144, RR00833, CA36448, and CA36310. F.R.J. is a Fellow of the Medical Research Council of Canada. P.P.C. is a Senior

Immunology: Jirik et al. Investigator of the Arthritis Foundation. This is publication 4062 BCR from the Research Institute of Scripps Clinic, La Jolla, CA. 1. Carson, D. A. (1985) in Textbook of Rheumatology, eds. Kelley, W. N., Harris, E. D., Ruddy, S. & Sledge, C. B. (Saunders, Philadelphia), pp. 664-679. 2. Welch, M. J., Fong, S., Vaughan, J. H. & Carson, D. A. (1983) Clin. Exp. Immunol. 51, 299-304. 3. Nemazee, D. A. & Sato, V. L. (1983) J. Exp. Med. 158, 529-545. 4. Coulie, P. & Van Snick, J. (1983) Eur. J. Immunol. 13, 895-899. 5. Coulie, P. G. & Van Snick, J. (1985) J. Exp. Med. 161, 88-97. 6. Nemazee, D. A. (1985) J. Exp. Med. 161, 242-256. 7. Van Snick, J. L., Van Roost, E., Markowetz, B., Cambiaso, C. L. & Masson, P. L. (1978) Eur. J. Immunol. 8, 279-285. 8. Metzger, H. (1969) Am. J. Med. 47, 837-844. 9. Preud'homme, J. L. & Seligmann, M. (1972) Proc. Natl. Acad. Sci. USA 69, 2132-2135. 10. Andrews, D. W. & Capra, J. D. (1981) Biochemistry 20, 5816-5822. 11. Ledford, D. K., Goni, F., Pizzolato, M., Franklin, E. C., Solomon, A. & Frangione, B. (1983) J. Immunol. 131, 1322-1325. 12. Kunkel, H. G., Agnello, V., Joslin, F. G., Winchester, R. J. & Capra, J. D. (1973) J. Exp. Med. 137, 331-342. 13. Chen, P. P., Fong, S., Normansell, D., Houghten, R. A., Karras, J. G., Vaughan, J. H. & Carson, D. A. (1984) J. Exp. Med. 159, 1502-1511. 14. Chen, P. P., Goni, F., Fong, S., Jirik, F., Vaughan, J. H., Frangione, B. & Carson, D. A. (1985) J. Immunol. 134, 3281-3285. 15. Clarkson, A. B., Jr., & Mellow, G. H. (1981) Science 214, 186-188. 16. Heitzmann, J. G. & Cohn, M. (1983) Mol. Biol. Med. 1, 235-243. 17. Heitzmann, J. G. & Cohn, M. (1983) in Monoclonal Antibodies and Cancer, eds. Boss, B., Langman, R., Trowbridge, I. & Dulbecco, R. (Academic, Orlando, FL) pp. 157-162. 18. Chen, P. P., Houghten, R. A., Fong, S., Rhodes, G. H., Gilbertson, T. A., Vaughan, J. H., Lerner, R. A. & Carson, D. A. (1984) Proc. Natl. Acad. Sci. USA 81, 1784-1788.


2199

19. Kabat, E. A., Wu, T. T., Bilofsky, H., Reid-Miller, M. & Perry, H. (1983) Sequences of Proteins of Immunologic Interest (U.S. Dept. of Health and Human Services, Washington,

DC).

20. Liu, F. T., Zinnecker, M., Hamaoka, T. & Katz, D. H. (1979) Biochemistry 18, 690-697. 21. Towbin, H., Staehelin, T. & Gordon, J. (1979) Proc. Nati. Acad. Sci. USA 76, 4350-4354. 22. Frischauf, A. M., Lehrach, H., Poustka, A. & Murray, N. (1983) J. Mol. Biol. 170, 827-842. 23. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). 24. Hieter, P. A., Maizel, J. V., Jr., & Leder, P. (1982) J. Biol. Chem. 257, 1516-1522. 25. Vieira, J. & Messing, J. (1982) Gene 19, 259-268. 26. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517. 27. Bentley, D. L. (1984) Nature (London) 307, 77-80. 28. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol. 65, 499-560. 29. Pech, M. & Zachau, H. G. (1984) Nucleic Acids Res. 12, 9229-9236. 30. Hunkapiller, M. W. & Hood, L, E. (1983) Science 219, 650-659. 31. Rundles, R. W. (1983) in Hematology, eds. Williams, W. J., Buetler, E., Erslev, A. J. & Lichtman, M. A. (McGraw-Hill, New York), pp. 981-998. 32. Anderson, K. C., Bates, M. P., Slaughenhoupt, B. L., Pinkus, G. S., Schlossman, S. F. & Nadler, L. M. (1984) Blood 63, 1424-1433. 33. Hayakawa, K., Hardy, R. R., Honda, M., Herzenberg, L. A., Steinberg, A. D. & Herzenberg, L. A. (1984) Proc. NatI. Acad. Sci. USA 81, 2494. 34. Levy, R. & Dilley, J. (1978) Proc. Natl. Acad. Sci. USA 75, 2411-2415. 35. Croce, C. M., Linnenbach, A., Hall, W., Steplewski, Z. & Koprowski, H. (1980) Nature (London) 288, 488-489. 36. Carson, D. A. & Freimark, B. (1986) Adv. Immunol. in press. 37. McKean, D., Huppi, K., Bell, M., Staudt, L., Gerhard, W. & Weigert, M. (1984) Proc. Natl. Acad. Sci. USA 81, 3180-3184. 38. Manser, T., Near, R. I. & Gefter, M. L. (1985) Immunol. Today 6, 94-101.