Lignin manipulations in pine Corresponding author

Plant Physiology Preview. Published on October 29, 2008, as DOI:10.1104/pp.108.125765 Wagner et al.

Running title: Lignin manipulations in pine

Corresponding author: Armin Wagner Scion 49 Sala Street Rotorua, New Zealand Phone: +64 7 343 5449 Fax: +64 7 343 5444 Email: [email protected]

Research area: Biochemical Processes and Macromolecular Structures – Associate Editor John Ohlrogge

Page 1

28/10/2008

Copyright 2008 by the American Society of Plant Biologists

Wagner et al.

Lignin manipulations in the coniferous gymnosperm Pinus radiata Armin Wagner1∗, Lloyd Donaldson1, Hoon Kim2, Lorelle Phillips1, Heather Flint1, Diane Steward1, Kirk Torr1, Gerald Koch3, Uwe Schmitt3, John Ralph2 1

Scion, Private Bag 3020, Rotorua, New Zealand

2

Department of Biochemistry, and the Great Lake Bioenergy Research Center, University of

Wisconsin, Madison, Wisconsin 53706, USA 3

Federal Research Centre for Forestry and Forest Products, Leuschnerstr. 91, 21031 Hamburg,

Germany

Keywords: Pinus radiata, lignin, 4-coumarate-CoA ligase, RNAi

Page 2

28/10/2008

Wagner et al.

Footnotes: This work was partially funded by grants C04X0207 and C04X0703 from the New Zealand Foundation for Research, Science and Technology. We gratefully acknowledge additional funding through the DOE Energy Biosciences program (#DE-AI02-00ER15067 to JR). NMR experiments on the Bruker DMX-500 cryoprobe system made use of the National Magnetic Resonance Facility at UW-Madison (www.nmrfam.wisc.edu).

∗

Corresponding author: Armin Wagner Scion 49 Sala Street Rotorua, New Zealand Phone: +64 7 343 5449 Fax: +64 7 343 5444 Email: [email protected]

Page 3

28/10/2008

Wagner et al.

ABSTRACT Severe suppression of 4-Coumarate-CoA ligase (4CL) in the coniferous gymnosperm Pinus radiata substantially impacted plant phenotype and resulted in dwarfed plants with a ‘bonsai-tree-like’ appearance. Microscopic analyses of stem sections from two-year-old plants revealed substantial morphological changes in both wood and bark tissues. This included the formation of weakly lignified tracheids that displayed signs of collapse and the development of circumferential bands of axial parenchyma. Acetyl bromide-soluble lignin assays and proton NMR studies revealed lignin reductions between 36-50% in the most severely affected transgenic plants. 2D-NMR and PyrolysisGC/MS studies indicated that lignin reductions were mainly due to depletion of guaiacyl but not phydroxyphenyl lignin. 4CL silencing also caused modifications in the lignin interunit linkage distribution including elevated β-aryl ether (β–O–4-unit) and spirodienone (β–1) levels, accompanied by lower phenylcoumaran (β–5), resinol (β–β), and dibenzodioxocin (5–5/β–O–4) levels. A sharp depletion in the level of saturated (dihydroconiferyl alcohol) endgroups was also observed. Severe suppression of 4CL also affected carbohydrate metabolism. Most obvious was an up to ~2-fold increase in galactose content in wood from transgenic plants due to increased compression wood formation. The molecular, anatomical and analytical data verified that the isolated 4CL clone is associated with lignin biosynthesis and illustrated that 4CL silencing leads to complex, often surprising, physiological and morphological changes in P. radiata.

Page 4

28/10/2008

Wagner et al.

INTRODUCTION Lignin is a heterogeneous cell wall polymer derived primarily from hydroxycinnamyl alcohols via combinatorial radical coupling reactions (Ralph et al., 2004). Typically, it makes up 20-30% of the cell wall material in woody species and therefore comprises a significant proportion of plant biomass. Deposition of lignin is of significance for vascular plants as it reinforces plant cell walls, facilitates water transport, provides compressive strength to conducting tissues and acts as a mechanical barrier to pathogens (reviewed in Boudet, 2007). A substantial amount of scientific data has been produced in recent years that describes the impact lignin manipulations can have on plant performance in woody angiosperms (reviewed in Boerjan et al., 2003; Halpin, 2004; Chiang, 2006; Higuchi, 2006; Boudet, 2007; Rastogi and Dwivedi, 2008). In recent years, poplar has emerged as a model angiosperm tree species for the investigation of wood-related topics, including lignification. For gymnosperms, no such model tree has been identified and the impact of lignin perturbations on plant performance is still largely unexplored, despite the significant ecological and economic importance of gymnosperm species such as pine trees. Although prior reports describing the metabolic effects of lignin modifications on Pinus radiata D. Don tracheary elements have been published (Möller et al., 2005a; Wagner et al., 2007), the first report on lignin modifications in whole conifer plants was published only very recently (Wadenbäck et al., 2008). Coniferous gymnosperms such as pines differ significantly on anatomical, physiological and biochemical levels from arborescent angiosperms such as poplar. Wood anatomy differs greatly between these groups of tree species (Fig. 1). Pine wood appears less complex and lacks vessel elements, the specialized water-conducting cells found in angiosperm wood. Water conduction and structural support in pine is accomplished via tracheids, which make up the largest component of the wood structure. In addition, lignin composition in pine trees is different from that of angiosperms and other vascular species including Selaginella, in that it does not contain syringyl units (reviewed in Harris, 2005). Lignin content and composition in pine is also substantially modified during physiological processes such as compression wood formation (Timell, 1982; Nanayakkara et al., 2005). This type of wood is associated with gravitropism in pine (Timell, 1982) and is not formed in arborescent angiosperm species, which instead create tension wood in response to gravitropic stimuli (Hejnowìcz, 1997). These profound differences between tree species such as poplar and pine make it scientifically attractive to explore how lignin manipulations impact plant performance and wood formation in coniferous gymnosperms. Page 5

28/10/2008

Wagner et al.

4-Coumarate-CoA ligase (4CL) is an enzyme functioning early in the general phenylpropanoid pathway by producing the monolignol precursor p-coumaroyl-CoA (Fig. 2). This metabolite is also a precursor for the production of secondary plant metabolites such as stilbenes and flavonoids (reviewed in Boudet, 2007). These multiple functions might explain why 4CL is encoded by a gene family in both angiosperm and gymnosperm species (Lee and Douglas, 1996; Allina et al., 1998; Hu et al., 1998; Harding et al., 2002; Kumar and Ellis, 2003; Costa et al., 2005; Friedmann et al., 2007; Koutaniemi et al., 2007). 4CL silencing in angiosperm species such as Nicotiana tabacum L., Arabidopsis thaliana (L.) Heynh. and Populus tremuloides Michx. caused lignin reductions in the range of 25-45% (Kajita et al., 1996; Kajita et al., 1997; Lee et al., 1997; Hu et al., 1999; Li et al., 2003). However, the impacts of these manipulations on lignin composition varied. 4CL silencing in N. tabacum preferentially depleted syringyl (S) lignin units, which are prominent in wood fibres (Kajita et al., 1997). 4CL silencing in A. thaliana depleted only guaiacyl (G) lignin units, which are enriched in vessel elements (Lee et al., 1997), whereas silencing of 4CL in P. tremuloides had no impact on the S/Gratio (Hu et al., 1999). An increase in the S/G-ratio in P. tremuloides was only recorded when 4CL silencing was combined with the overexpression of coniferaldehyde 5-hydroxylase, previously known as ferulate 5-hydroxylase (Li et al., 2003). These differences in lignin composition could be the consequence of silencing 4CL isoforms with different substrate preferences, or they could reflect the inadequacies or limitations of analytical procedures used for lignin analysis (reviewed in Halpin, 2004). In pine species such as Pinus taeda L., 4CL expression is stimulated during compression wood formation (Zhang and Chiang, 1997), which implies that elevated 4CL activity is required for increased lignin production. Compression wood in pine has a higher lignin content than normal wood and contains substantial amounts of p-hydroxyphenyl (H) lignin units (Timell, 1982; Nanayakkara et al., 2005). 4CL expression in a P. taeda tissue culture system capable of producing monolignols and extracellular lignin is stimulated by supplying monolignol precursors such as Lphenylalanine (Anterola et al., 2002). Expression of 4CL in P. taeda is also subject to feedback inhibition and its activity is down-regulated by products of the flavonoid and lignin pathways (Voo et al., 1995). In our ongoing efforts to better understand the physiological role of lignin in coniferous gymnosperms, we investigated how 4CL silencing affects plant phenotype, wood anatomy and chemical wood composition in the conifer species P. radiata.

Page 6

28/10/2008

Wagner et al.

RESULTS Clone isolation and generation of transgenic material A 1917 bp fragment of a P. radiata 4CL clone (GenBank: EU616501) containing the entire open reading frame was isolated from a xylem-derived cDNA library using the PCR-based approach described in Materials and Methods. The deduced amino acid sequence of the isolated clone was 99.4% identical to its putative Pinus taeda ortholog (GenBank: PTU12013; Voo et al., 1995; Fig. S1) and 91.8% identical to the lignin-related Picea abies (L.) H. Karst. 4CL clone Pa4CL3 (EMBL: AM170561; Koutaniemi et al., 2007). Quantitative RT-PCR experiments revealed that the expression of the isolated P. radiata 4CL clone substantially increased in concert with other ligninrelated genes during tracheary element development (data not shown), which is consistent with a coordinated transcriptional regulation of lignin-related genes in P. radiata (Wagner et al., 2007). The promoter of the lignin-related P. radiata cinnamyl alcohol dehydrogenase (CAD) gene was used in the 4CL RNAi construct (Fig. S1) based on its preferential expression in developing xylem (Wagner and Walter, 2004). This was in keeping with the intention of limiting phenotypic alterations to wood-forming tissue. Transformation of embryogenic P. radiata tissue with the 4CL RNAi construct resulted in the generation of 16 transgenic lines. Unfortunately, an unusually high percentage (25%) of the generated transgenic lines died during the late stages of embryo maturation. Twelve transgenic lines were regenerated into plants and grown for a period of two years under contained, controlled conditions in a greenhouse prior to analysis. Ten of the twelve transgenic lines displayed an essentially wild-type phenotype and the other two transgenic lines were dwarfed. Three transgenic lines (AW42-13 and AW42-14 and AW42-17) displayed reduced lignin levels in pyrolysis-GC/MS experiments and quantitative acetyl bromide lignin assays and were therefore selected for further studies. Molecular and anatomical characterization of 4CL transgenics Quantitative RT-PCR experiments revealed that transgenic lines AW42-13, AW42-14 and AW4217 contained substantially reduced 4CL steady state mRNA pools in developing xylem, which represented 5%, 8% and 21% of the 4CL message of wild-type plants grown under the same conditions, respectively. The two lines that showed substantial phenotypic abnormalities, AW42-13 and AW42-14, were characterized by dwarfing and the absence of a straight, dominant leader that is otherwise typical for wild-type P. radiata plants (Fig. 1C). Line AW42-17 displayed a wild-type phenotype (data not

Page 7

28/10/2008

Wagner et al.

shown). Branches on AW42-13 and AW42-14 appeared more variable in form compared to those of wild-type plants, which added to the ‘bonsai-tree-like’ appearance of these transgenic lines (Fig. 1C). Wood from stem and branch material of AW42-13 and AW42-14 plants, but not that of AW4217, was darker in color compared to wood from control trees, which indicated substantial changes in wood anatomy and chemistry (Fig. 1D). Microscopic investigations revealed substantial changes in the anatomy of the stems formed in AW42-13 and AW42-14 (Figs. 3-5). Stem sections from AW42-17 were indistinguishable from those of wild-type plants (data not shown). Stem sections from AW42-13 and AW42-14 had a higher proportion of bark relative to wood (40-60% vs. 24% in the control), which was most evident in the most severely suppressed line AW42-13 (Fig. 3C). Wood from AW42-13 and AW42-14 also contained circumferential bands of axial parenchyma (Figs. 3B, 4G and H). These axial parenchyma cells were mostly unlignified, but weakly lignified cells occasionally occurred within this tissue (Figs. 4G and H). Axial parenchyma tissue was similar in appearance to the cells surrounding resin canals in normal P. radiata wood (Bamber, 1972). However, the virtual absence of resin canals in those tissues indicated that this tissue differs from the traumatic bands of resin canals that are formed as a response to injury in conifers (Nagy et al., 2000; Martin et al., 2002). Stem segments of AW42-13 and AW42-14 also contained elevated levels of compounds, potentially flavonoids or tannin-like compounds, in both wood and bark tissues, which formed dark-colored complexes with FeCl3 (Fig. 3B). Confocal fluorescence microscopy was used to visualize the degree of lignification of wood tissue using the lignin stains basic fuchsin and berberine sulfate (Fig. 4). Both staining techniques delivered comparable results. Normal and compression wood tissues in line AW42-17 were indistinguishable from control material (data not shown). However, transgenic lines AW42-13 and AW42-14 showed regions of reduced levels of lignification. The compound middle lamella and the outer part of the secondary wall were lignified to at least a moderate extent, but the inner secondary wall was either unlignified or weakly lignified (Fig. 4). Affected tracheids were in clusters or radial files interspersed with apparently normal tracheids and tracheids with varying levels of decreased lignification (Fig. 4B). Tracheids adjacent to resin canals and wood rays exhibited increased fluorescence when stained with basic fuchsin or berberine sulfate (Figs. 4B, C, E and F), and similar variability in the staining pattern was also observed with Wiesner reagent (Fig. 5). Tracheids severely affected by lignin depletion showed signs of collapse (Figs. 4I, 6A) and a lack of cell adhesion, which was most obvious in TEM-micrographs (Fig. 6A). UV-micrographs indicated that in these tracheids, lignification was severely reduced in all regions of the cell wall with only the Page 8

28/10/2008

Wagner et al.

middle lamella and S1 layers showing moderate levels of lignification (Fig. 7).

Biochemical changes in woody tissue of 4CL transgenics Extracted wood samples from non-transgenic controls and transgenic lines AW42-13, AW42-14, AW42-17 were analyzed using pyrolysis-GC/MS to generate a chemical fingerprint of their cell wall composition. The pyrograms of controls and transgenic lines displayed a number of characteristic differences. These are most easily visualized by comparing control material with the most severely suppressed line AW42-13 (Fig. 8). Most obvious were the decreased signals for vanillin, coniferaldehyde, coniferyl alcohol and dihydroconiferyl alcohol in transgenic material (Fig. 8, Table I). Many of the signals reduced in transgenic lines, including those mentioned above, represented derivatives of G-type lignin. Pyrolysis products diagnostic for H-type lignin were not reduced in transgenic lines. The H/G-ratio in transgenic lines with severe phenotypes, such as AW42-13 and AW42-14, was consequently up to 3-fold higher than in wild-type controls. Transgenic line AW4217 displayed a virtually unchanged H/G-ratio, most likely due to its weak phenotype. Quantitative acetyl bromide-soluble lignin (ABSL) measurements were used to verify the trends in lignin content observed in pyrolysis-GC/MS experiments. These experiments revealed that lignin content in AW42-13, AW42-14 and AW42-17 was decreased on average by 36%, 28% and 8% relative to control plants (Table II). ABSL content in the ten control plants analyzed in this study varied between 26.0 and 30.9% (w/w). Lignin content in the control plants was at least four standard deviations higher than that in the dwarfed transgenic lines AW42-13 and AW42-14 (Table II). Parallel ABSL and Klason measurements were performed in a subset of five control plants, which produced virtually identical results. The average lignin content was 28.0 ± 1.6% (w/w) for Klason lignin and 28.1 ± 1.6% (w/w) for ABSL. The maximum difference in lignin content for a given plant was 0.8% (w/w). These results demonstrate that the ABSL data generated in this study can be compared to other published data, which are based on Klason lignin. 4CL silencing in P. radiata not only affected lignin content and composition, but also the polysaccharide composition in wood of AW42-13 and AW42-14. Most obvious was the increase in galactose released from ground wood, which most likely originated from galactan, since the mannose content in those transgenics was inconsistent with an increase in galactoglucomannan, the second major source of galactose in pine wood (Table II). Slight alterations in arabinose and xylose content were also observed.

Compositional and structural changes in lignin of 4CL transgenics Page 9

28/10/2008

Wagner et al.

1D NMR spectroscopy and 2D

13

C–1H correlation (HSQC) NMR studies with the most severely

affected transgenic line, AW42-13, confirmed the compositional changes observed in the pyrolysisGC/MS experiments. Evident in all spectra, but most easily illustrated in the 1D proton NMR spectra of the acetylated cell wall material, was the approximately two-fold reduction in lignin content in AW42-13 (Fig. S2). More accurate quantification was not possible as proton resonances from certain H-units were obscured by the residual non-deuterated NMR solvent (CHCl3). Similar trends were also observed in 2D spectra, which were adjusted to match cellulose levels (Figs. S4S6). Spectra derived from AW42-13 displayed significant reductions in lignin contours relative to those from cellulose (Figs. S4-S6). The lignin monomer compositions were determined via volume integration of contours in the HSQC spectra and were measured as described previously (Wagner et al., 2007), except that an adiabatic pulse variant of the HSQC experiment was used to improve quantification (see Materials and Methods). The H/G-ratio was >4-fold higher in AW42-13 compared to the control (Table III) and therefore similar to H/G-ratios found in pine compression wood (Nanayakkara et al., 2005). This relative increase in H-lignin in AW42-13 was most easily visualized when the guaiacyl-2 C/H correlations were set to be approximately equivalent (Fig. S3). This trend could also be observed in Figure S6, which was adjusted to match cellulose levels. Here, AW42-13 displayed substantially depleted G-lignin but essentially unchanged H-lignin levels. As anticipated from the increased Hcontribution to the lignin, the methoxyl:aromatic ratio, measured by integrating the methoxyl contour vs. the G2 and H2/6 aromatic contours, was approximately 6% lower in AW42-13 as compared to the wild-type control. Lignin structural changes are best described by comparing interunit and end-unit profiles in HSQC spectra. Table III lists relative quantification data from integrating the correlations from the various lignin units, as previously described (Wagner et al., 2007). The units measured are shown in Figure 9, which displays partial HSQC spectra (sidechain region only) of cellulolytic enzyme lignins (CELs) from AW42-13 and a control sample. The yield of CEL lignins in AW42-13 was 19% (w/w), which compared to 28% (w/w) for the control. Note that the contour levels used to display the two spectra were chosen to highlight the lignin structural similarities and differences and therefore do not reflect the fact that the transgenic had a lower total lignin content. The β-ether Aα contour levels were set to be approximately equivalent. β–Ether A, and spirodienone S units were elevated in AW42-13 at the expense of phenylcoumaran B, resinol C, and dibenzodioxocin D units (Fig. 9, Table III). Also notable was the substantial depletion in the level of reduced (dihydroconiferyl alcohol, X5) endgroups, as determined by the Hα/Cα and Hβ/Cβ correlations at Page 10

28/10/2008

Wagner et al.

2.60/31.7 and 1.90/30.3 ppm (not shown, but see Ralph et al., 1999).

DISCUSSION Effect of 4CL silencing on plant anatomy and physiology NMR data indicate that severe (95%) suppression of 4CL can lead to a ~50% reduction in lignin content in pine plants (Figure S2). This demonstrates that 4CL has a key role in the biosynthesis of monolignols in softwood species such as P. radiata. The same is true for hardwood species such as P. tremuloides, where similar reductions in lignin content were recorded in 4CL silencing experiments (Hu et al., 1999). However, transgenic aspen retained a wild-type-like appearance despite these substantial lignin depletions (Hu et al., 1999; Li et al., 2003), which was clearly not the case in this study. Only moderate lignin reductions of approximately 8% could be tolerated without apparent effect on plant phenotype in pine. The more substantial lignin reductions measured in AW42-13 and AW42-14 severely affected plant phenotype, including bark and wood anatomy (Figs. 1, 3-7). The collapse of water-conducting elements when lignin production is experimentally suppressed appears to be a significant factor contributing to growth retardation in tree species (Leplé et al., 2007; this study). Water-conducting tracheids comprise the primary cell type in pine wood (Fig. 1A). Consequently, lignin manipulations targeting wood formation in pine will almost inevitably affect lignification of tracheids, which has the potential to compromise their anatomical integrity and thereby, their function (Figs. 4I, 6A). In contrast, substantial lignin reductions were achieved in aspen without causing the collapse of water-conducting vessel elements (Hu et al., 1999, Li et al., 2003). It thus appears that phenotype formation in hardwood species might depend to some extent on whether lignin manipulations primarily affect conducting or structural elements in developing xylem. Such discrimination is impossible in softwood species such as pine, since tracheids combine both water-conducting and structural functions, which may effectively restrict the potential for lignin reductions in pine species. Physiological, as well as anatomical, differences between hardwoods and softwoods are also likely to contribute to the drastically different 4CL silencing phenotypes observed in aspen and pine. Unlike hardwoods, lignification plays an important role in gravitropism in conifers. Compression wood, which contains a high lignin content, forms on the lower side of branch and stem material in conifers in response to gravitropic stimuli (Timell, 1982). In contrast, the corresponding gravitropic response in hardwoods is the deposition of tension wood, which is rich in cellulose, not lignin Page 11

28/10/2008

Wagner et al.

(Hejnowìcz, 1997). The 4CL silencing phenotypes we observe thus appear to be indicative of the more crucial role lignin biosynthesis plays in growth and development in softwoods relative to hardwoods. The elevated galactose levels in severely 4CL-silenced transgenic pine plants (Table II) might also be linked to the gravitropic response. High galactose levels are, as mentioned earlier, most likely due to increased galactan levels in the transgenic plants. Increased galactan content was discernable in AW42-13 in 2D-NMR experiments, but could not be quantified as the most distinct correlation for galactan partially overlapped with that from cellulose and xylan. Galactan is closely associated with compression wood formation and therefore the gravitropic response in conifers (Jiang & Timell 1972; Nanayakkara et al., 2005). 4CL-silencing experiments in tracheary element (TE)-forming P. radiata callus cultures did not lead to a similar increase in galactose content, despite reductions in lignin content of up to 60% (Wagner et al., unpublished results). This demonstrates that increased galactan production is not an obligatory consequence of 4CL silencing in P. radiata, but rather a possible gravitropic response in structurally weakened plants due to lignin reduction. The physiological role of galactan in pine compression wood is currently unresolved. However, the ‘bonsai-tree-like’ phenotype of transgenic lines such as AW42-13 (Fig. 1C) might suggest that both elevated galactan and lignin levels are integral to the gravitropic response in pine. Wood and bark tissues of AW42-13 and AW42-14 contained elevated levels of metabolites or polymers, likely flavonoids or derivatives of flavonoids such as condensed tannins, that form darkcolored complexes with FeCl3 (Fig. 3). In particular, tannins containing pyrogallol units readily form complexes with FeCl3 (Sungur and Uzar, 2008), and condensed tannins containing pyrogallol groups have been identified in pine previously (Ku and Mun, 2007). The presence of increased levels of flavonoids or flavonoid derivatives in transgenic pine plants would not be surprising since elevated flavonoid production is quite common when silencing genes early in the monolignol pathway (Chen et al., 2006; Besseau et al., 2007). Such a perturbation can be the consequence of a redirection of metabolites or indicative of a stress response. The biosynthesis of flavonoids, condensed tannins and lignin in pine requires 4CL activity. If the dark-colored complexes represent flavonoids or condensed tannins then this would suggests that 4CL activity is still present in those tissues. 4CL in pine, as in angiosperms, is encoded by multiple genes (Friedmann et al., 2007; Koutaniemi et al., 2007) and 4CL genes participating in different phenylpropanoid-derived pathways have been identified (Kumar and Ellis, 2003). Thus, the production of flavonoids or condensed tannins in axial parenchyma and bark could depend on a member of the 4CL gene family in pine, which is different enough from the targeted lignin-related 4CL gene to not be affected by the RNAi Page 12

28/10/2008

Wagner et al.

construct. Severe lignin reductions in pine not only affected the biochemical composition of wood and plant growth but also bark and wood formation itself (Fig. 3C), which was unexpected. The increased bark formation in transgenic plants might be indicative of a redirection of carbon flux from xylem to phloem formation. Similarly, the generation of axial parenchyma in woody tissue (Fig. 4) was surprising and further studies are required to understand the mechanisms leading to the formation of this tissue.

Effect of 4CL silencing on lignin composition and structure In addition to significantly reducing lignin levels, 4CL silencing also affected lignin composition in P. radiata. A substantial reduction of G-units compared to H-units was observed in NMR and pyrolysis-GC/MS spectra in affected transgenic plants, which resulted in H/G-ratios similar to mild pine compression wood (Nanayakkara et al., 2005). It is conceivable that restricting monolignol biosynthesis in P. radiata primarily affects G-units simply because this type of lignin represents the vast majority (~98%) of lignin in normal pine wood. However, the phenotype of transgenic plants might also have contributed to the observed shift in the H/G-ratio. Leaning stems trigger compression wood formation in wild-type plants which is known to contain high levels of H-type lignin (Timell, 1982; Nanayakkara et al., 2005). 4CL-silencing certainly compromised normal compression wood formation in transgenic lines by limiting monolignol supply. However, transgenics with a ‘bonsai-tree-like’ appearance might have produced an H/G-ratio which is more consistent with compression than normal wood, due to their tilted stems. Changes in lignin composition also cause structural changes in the lignin polymer in hardwood species (reviewed in Ralph et al., 2004) and this study was consistent with earlier findings in that regard (Figs. 9, S2-S6, Table III). Reduction in G-type lignin resulted in lower levels of phenylcoumarans B, resinols C, and dibenzodioxocins D. H-units can form such structures but in different distributions, and the correlations may be shifted, especially for dibenzodioxocins (Ralph et al., 2006). These reductions were compensated by an apparent increase in the fraction of β-ethers A and spirodienones S (from β–O–4- and β–1-coupling). One possible explanation for this change in interunit distribution in AW42-13 might be associated with a reduced monomer supply. Restricting monomer supply results in fewer monomer-monomer reactions (e.g. β–β-coupling to generate units C) and enhances monomer-polymer cross-coupling in a linear manner, which favours the generation of β-ether units A. This fits the Syrjänen and Brunow (2000) model that limiting monomer diffusion enhances cross-coupling and polymer extension. Page 13

28/10/2008

Wagner et al.

Also notable, particularly from the reduced Cα/Hα and Cβ/Hβ correlations (not shown), is the substantial reduction in the level of reduced (dihydroconiferyl alcohol, X5) endgroups, which was also observed in pyrolysis-GC/MS experiments (Fig. 8). Such groups are derived from dihydroconiferyl alcohol monomers that are incorporated into lignin (Ralph et al., 1997; Sederoff et al., 1999; Ralph et al., 1999). Dihydroconiferyl alcohol itself is likely to be a derivative of coniferaldehyde in pine (Savidge and Forster, 2001; Kasahara et al., 2006). 4CL silencing in P. radiata preferentially affected G-type lignin (Figs. S4, S6) and thus probably the biosynthesis of coniferaldehyde. Limiting coniferaldehyde biosynthesis in pine also restricted the biosynthesis of both coniferyl alcohol and dihydroconiferyl alcohol (Fig. 2).

Phenotypic non-uniformity in transgenic plants Lack of phenotypic uniformity in gene silencing experiments in plants is a fairly common phenomenon. This phenotypic inconsistency, also sometimes referred to as ‘patchiness’, has been reported for hardwood species previously (Baucher et al., 1996; Tsai et al., 1998; Meyermans et al., 2000; Pilate et al., 2002; Leplé et al., 2007). This study revealed that ‘patchiness’ in gene silencing experiments can also occur in softwood species based on the observation that lignin reductions in tracheids were far from uniform in transgenic plants (Figs. 4B, 5B). The reason for this lack of phenotypic uniformity is currently unclear, but it could be associated with the nature of the RNAi process. RNAi in plants is based on both cell-autonomous and non-cell-autonomous processes (Shimamura et al., 2007), which might allow for differential responses to occur at the cellular level. RNAi can also be affected by developmental processes in pine (Wagner et al., 2005, 2007). These and other factors might therefore affect the phenotype at the cellular level in wood. The observation that phenotypic differences occur at the cellular level in silencing experiments might have implications for biotechnological applications, especially in situations where phenotypic uniformity is a crucial performance criterion. Based on the observation that tracheids adjacent to resin canals and wood rays were less severely affected by 4CL silencing than those more distant from those tissues (Figs. 4B, C, E and F) some phenotypic variation might be explained by the production of phenylpropanoids in these nonlignifying tissues. Resin canals and wood rays in different pine species produce extractives, some of which are derivatives of ferulic acid (Harborne, 1980). A multifunctional pine O-methyltransferase (AEOMT), which is capable of producing ferulate in vitro (Li et al., 1997), is strongly expressed in wood rays and resin canals in P. radiata (Wagner and Walter, 2004). It is conceivable that phenylpropanoids produced in wood rays and resin canals can be incorporated into the cell wall of Page 14

28/10/2008

Wagner et al.

tracheids adjacent to those tissues, thereby mitigating the impact of 4CL-suppression in those cells. The incorporation of ferulate into lignin of angiosperm species such as N. tabacum and P. tremula x P. alba has recently been demonstrated (Dauwe et al., 2007; Leplé et al., 2007; Ralph et al., 2008).

CONCLUSIONS Severe suppression of 4CL in P. radiata plants resulted in some expected phenotypic changes, which includes a reduction in lignin content and changes in lignin composition, but also in a number of more surprising phenotypic effects. Some of these effects, such as changes in the wood/bark ratio, may be associated with altered metabolic flux of phenylpropanoids. Decreased wood formation may also reflect a certain dependence of xylogenesis in pine on adequate supply of ‘building blocks’ such as lignin precursors, and increased bark production may be the consequence of restricted xylem formation. Other phenotypes, such as the generation of axial parenchyma in wood and changes in carbohydrate metabolism, likely have explanations originating from other aspects of the physiology of the species. In any case, these pleiotropic phenotypes imply a degree of physiological complexity in pine which is currently not well understood. Parallel testing of lignin-related genes in plants and the pine TE system can help to identify whole plant changes, as opposed to merely cellular phenotypic changes, such as the elevated production of galactose observed in this study. Finally, our results highlight the fact that lignin modifications in pine plants result in metabolic and physiological changes in pine that could not have been predicted from similar experiments in hardwood species. Our findings provide an early indication that lignin biosynthesis might play a more essential role in conifer development and physiology than it does in arborescent angiosperm species. Clearly, many more studies will be required to fully understand this role in gymnosperms.

Page 15

28/10/2008

Wagner et al.

MATERIALS AND METHODS Clone Isolation, Construct Design and Transformation A 1917 bp PCR fragment of a P. radiata 4CL cDNA clone was isolated from a xylem-derived cDNA library using primer pair 4CLfwd1 5′-CATTCAATTCTTCCCACTGCAGG and 4CLrev1 5′CAAGAGTGTAGGGCGTTGACAATC, which were designed by using pre-existing sequence information from P. taeda 4CL clone PTU12013 (Voo et al., 1995). The amplified PCR fragment of the P. radiata 4CL cDNA clone was cloned into pGEM-T Easy (Promega, Madison, USA) and sequenced. A central 1383 bp EcoRI fragment spanning approximately 85% of the protein-coding region of the 4CL clone was subsequently inserted in sense and antisense orientation into a derivative of pAHC25 (Christensen et al., 1992), which contained the P. radiata CAD promoter (Wagner and Walter, 2004) instead of the Zea mays Ubi1 promoter. The resulting plasmid containing the final 4CL RNAi construct was named pAW42 (Fig. S1). Embryogenic P. radiata cultures were co-transformed with pAW42 and pAW16 (Wagner et al., 2007) as described earlier (Walter et al., 1998). The expression of the targeted 4CL clone in developing tracheary elements and differentiating xylem of transgenic and control plants was monitored by quantitative RT-PCR as described previously (Cato et al., 2006) using primers 4CLfwd 5′-TGCAGAGTAAGCGCCCTATAA and 4CLrev 5′-GTAGGGCGTTGACAATCCAT.

Microscopic Analyses Stem segments of two-year-old plants including bark, phloem, cambium and xylem were fixed and stored in formalin aceto-alcohol (FAA). Transverse sections 60 μm in thickness were prepared using a sledge microtome. Sections for light microscopy were stained with phloroglucinol/HCl (for lignin), or with FeCl3 (for tannin-like material) and examined using a Leica MZ12.5 stereomicroscope. The proportion of wood to bark in stained stem sections was measured by digital image analysis by comparison of the relative areas. Sections prepared for confocal fluorescence microscopy were stained with acriflavin (0.0025%, 5 min), basic fuchsin (0.001%, 5 min) or berberine sulfate (0.01%, 5 min) and mounted in glycerol, or immersion oil after drying as described earlier (Donaldson and Bond, 2005). For transmission electron microscopy, small blocks of xylem 2x2x3 mm were prepared, dehydrated in an acetone series and embedded in Spurr resin (Spurr, 1969). Transverse sections were prepared using a diamond knife at either 90 nm or 120 nm thickness, transferred to copper grids and stained with potassium permanganate (1% in 1% sodium citrate). Sections were Page 16

28/10/2008

Wagner et al.

examined using a JEOL 6700F field emission scanning electron microscope equipped with a transmission detector at 30 kV. Sections for UV-micro-spectrophotometry were prepared as described earlier (Möller et al., 2005b).

Quantitative Lignin Measurements Acetyl bromide-soluble lignin (ABSL) assays were carried out essentially as described in Wagner et al., (2007) with the exception that powdered, freeze dried stem material was extracted with 4:1 ethanol:water (40 ml g-1) and 2:1 chloroform:methanol (40 ml g-1) according to Hatfield et al. (1999) prior to analysis. Acid-insoluble Klason lignin in extracted (see above) wood samples was determined by the method of Effland (1977). Acid-soluble lignin was determined as described by Dence (1992).

Quantification of Neutral Sugars The neutral sugar content in stem material from two-year-old transgenic plants and nontransformed controls was determined as described (Pettersen et al., 1991).

Pyrolysis-GC/MS Pyrolysis-GC/MS was essentially carried out as described in Möller et al., (2003) with the exception that powdered and freeze-dried stem material was extracted as described in Hatfield et al. (1999) prior to pyrolysis experiments. Pyrolysis products were separated on a Zebron ZBWAXplus column (30 m, 0.25 mm I.D., 0.25 μm film thickness; Phenomenex, Torrance, CA, USA), which produces superior signals for polysaccharide- and flavonoid-derived pyrolysis products. Pyrolysis products were identified by using mass spectra of lignin and polysaccharidederived pyrolysis products (Faix et al., 1990, 1991a, 1991b; Ralph & Hatfield, 1991).

NMR Spectroscopy Preparation of whole-cell-wall and cellulolytic enzyme lignin (CEL) samples for NMR was as described previously (Lu et al., 2003; Wagner et al., 2007), as were the NMR methods, with the exception that soft-180-adiabatic-pulse variants of the HSQC experiments (Kupče et al., 2007) were used (Bruker pulse program hsqcetgpsisp.2). Such experiments are less sensitive to differences in 1bond 13C–1H coupling constants and the response over the entire spectral range is more uniform, suggesting that improved quantification should result.

Page 17

28/10/2008

Wagner et al.

SUPPLEMENTAL MATERIAL Supplemental Data S1. Alignment of the Pr4CL coding region with putative orthologs from other conifer species and schematic diagrams of constructs used in this study. Supplemental Data S2. Proton NMR spectra of acetylated whole-cell-wall preparations from a wild-type control and transgenic line AW42-13. Supplemental Data S3. Partial short-range 13C–1H (HSQC) spectra (aromatic regions) of acetylated whole-cell-wall preparations from a wild-type control and transgenic line AW42-13. Supplemental Data S4. Overlaid partial short-range 13C–1H (HSQC) correlation spectra (aromatic and aliphatic regions) of acetylated whole-cell-wall preparations from a wild-type control and transgenic line AW42-13. Supplemental Data S5. Overlaid partial short-range 13C–1H (HSQC) correlation spectra (aliphatic region detail) of acetylated whole-cell-wall preparations from a wild-type control and transgenic line AW42-13. Supplemental Data S6. Overlaid partial short-range 13C–1H (HSQC) correlation spectra (aromatic region detail) of acetylated whole-cell-wall preparations from a wild-type control and transgenic line AW42-13. ACKNOWLEDGEMENTS We would like to thank Barbara Geddes, Cathie Reeves, John Smith and Susan van der Maas for technical assistance and Elspeth MacRae and Tim Strabala for critical reading of this manuscript.

Page 18

28/10/2008

Wagner et al.

LITERATURE CITED Allina SM, Pri-Hadash A, Theilmann DA, Ellis BE, Douglas CJ (1998) 4-Coumarate:coenzyme A ligase in hybrid poplar. Plant Physiol 116: 743-754 Anterola AM, Jeon J-H, Davin LB, Lewis NG (2002) Transcriptional control of monolignol biosynthesis in Pinus taeda: Factors affecting monolignol ratios and carbon allocation in phenylpropanoid metabolism. J Biol Chem 21: 18272-18280 Bamber RK (1972). Properties of the cell walls of the resin canal tissue of the sapwood and heartwood of Pinus lambertiana Dougl. and P. radiata D. Don. J Inst Wood Sci 6: 32-35 Baucher M, Chabbert B, Pilate G, Van Doorsselaere J, Tollier M-T, Monties B, Van Montagu M, Inzé D

-

Petit Conil M, Cornu D,

, Jouanin L, Boerjan W (1996) Red xylem and higher

lignin extractability by down-regulating a cinnamyl alcohol dehydrogenase in poplar. Plant Physiol 112: 1479-1490 Boerjan W, Ralph J, Baucher M (2003) Lignin Biosynthesis. Annu Rev Plant Biol 54: 519-546 Boudet AM (2007) Evolution and current status of research in phenolic compounds. Phytochemistry 68: 2722-2735 Cato S, McMillan L, Donaldson L, Richardson T, Echt C, Gardner R (2006) Wood formation from the base to the crown in Pinus radiata: Gradients of tracheid wall thickness, wood density, radial growth rate and gene expression. Plant Mol Biol 60: 565-581 Chen F, Reddy MSS, Temple S, Jackson L, Shadle G, Dixon RA (2006) Multi-site modulation of monolignol biosynthesis suggests new routes for formation of syringyl lignin and wall-bound ferulic acid in alfalfa (Medicago sativa L.). Plant J 48: 113-124 Christensen AH, Sharrock RA, Quail PH (1992) Z. mays polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol Biol 18: 675-689 Costa MA, Bedgar DL, Moinuddin SGA, Kim K-W, Cardenas CL, Cochrane FC, Shockey JM, Helms GL, Amakura Y, Takahashi H, Milhollan JK, Davin LB, Browse J, Lewis NG (2005) Characterization in vitro and in vivo of the putative multigene 4-coumarate:CoA ligase network in Arabidopsis: syringyl lignin and sinapate/sinapyl alcohol derivative formation. Phytochem 66: 2072-2091 Chiang VL (2006) Monolignol biosynthesis and genetic engineering of lignin in trees, a review. Environ Chem Lett 4:143-146 Dauwe R, Morreel K, Goeminne G, Gielen B, Rohde A, Van Beeumen J, Ralph J, Boudet APage 19

28/10/2008

Wagner et al.

M, Kopka J, Rochange SF, Halpin C, Messens E, Boerjan W (2007) Molecular phenotyping of lignin-modified tobacco reveals associated changes in cell-wall metabolism, primary metabolism, stress metabolism and photorespiration. Plant J 52: 263-285 Dence CW (1992) The determination of lignin. In SY Lina, CW Dence, eds, Methods in lignin chemistry. Springer Press, Berlin, Germany, pp 33-61 Donaldson L, Bond J (2005) Fluorescence microscopy of wood. Scion, Rotorua, New Zealand. (CD ROM) Effland MJ (1977) Modified procedure to determine acid-insoluble lignin in wood and pulp. Tappi 60: 143-144 Faix O, Meier D, Fortmann I (1990) Thermal degradation products of wood. Holz als Roh- und Werkstoff 48: 281-285 Faix O, Fortmann I, Bremer J, Meier D (1991a) Thermal degradation products of wood. Holz als Roh- und Werkstoff 49: 213-219 Faix O, Fortmann I, Bremer J, Meier D (1991b) Thermal degradation products of wood. Holz als Roh- und Werkstoff 49: 299-304 Friedmann M, Ralph SG, Aeschliman D, Zhuang J, Ritland K, Ellis BE, Bohlmann J, Douglas CJ (2007) Microarray gene expression profiling of developmental transitions in Sitka spruce (Picea sitchensis) apical shoots. J Exp Bot 58: 593-614 Halpin C (2004) Re-designing lignin for industry and agriculture. Biotechnol Genet Eng 1: 229-245 Harborne JB (1980) Plant phenolics. In EA Bell, BV Charlwood, eds, Secondary plant products. Springer Press, Berlin, Germany, pp 329-395 Harding SA, Leshkevich J, Chiang VL, Tsai C-J (2002) Differential substrate inhibition couples kinetically distinct 4-Coumarate:coenzyme A ligases with spatially distinct metabolic roles in quaking aspen. Plant Physiol 128: 428-438 Harris PJ (2005) Diversity in plant cell walls. In RJ Henry, ed, Plant diversity and evolution: genotypic and phenotypic variation in higher plants. CAB International Publishing, Wallingford, Oxon, UK, pp 201-227 Hatfield RD, Grabber J, Ralph J, Brei K (1999) Using the acetyl bromide assay to determine lignin concentrations in herbaceous plants: same cautionary notes. J Agric Food Chem 47: 628-632 Hejnowìcz Z

(1997) Graviresponses in herbs and trees: A major role for the redistribution of tissue

and growth stresses. Planta 203: S136-S146 Higuchi T (2006) Look back over the studies of lignin biochemistry. J Wood Sci 52: 2-8 Page 20

28/10/2008

Wagner et al.

Hu W-J, Kawaoka A, Tsai C-J, Lung J, Osakabe K, Ebinuma H, Chiang VL (1998) Compartmentalized expression of two structurally and functionally distinct 4-coumarate:CoA ligase genes in aspen (Populus tremuloides). PNAS 95: 5407-5412 Hu W-J, Harding SA, Lung J, Popko J, Ralph J, Stokke DD, Tsai C-J, Chiang VL (1999) Repression of lignin biosynthesis promotes cellulose accumulation and growth in transgenic trees. Nature Biotech 17: 808-812. Jiang KS, Timell TE (1972) Polysaccharides in compression wood of tamarack (Larix laricina). Svensk Papperstidning 75: 592-594. Kajita S, Katayama Y, Omori S (1996) Alterations in the biosynthesis of lignin in transgenic plants with chimeric genes for 4-coumarate:coenzyme A ligase. Plant Cell Physiol 37: 957965 Kajita S, Hishiyama S, Tomimura Y, Katayama Y, Omori S (1997) Structural characterization of modified lignin in transgenic tobacco plants in which the activity of 4-coumarate:coenzyme A ligase is depressed. Plant Physiol 114: 871-879 Kasahara H, Jiao Y, Bedgar DL, Kim S-J, Patten AM, Xia Z-Q, Davin LB, Lewis NG (2006) Pinus taeda phenylpropenal double-bond reductase: Purification, cDNA cloning, heterologous expression in Escherichia coli, and subcellular localization in P. taeda. Phytochemistry 67: 1765-1780 Koutaniemi S, Warinowski T, Kärönen A, Alatalo E, Fossdal CG, Saranpää P, Lookso T, Fagerstedt KV, Simola LK, Paulin L, Rudd S, Teeri TH (2007) Expression profiling of the lignin biosynthetic pathway in Norway spruce using EST sequencing and real-time RT-PCR. Plant Mol Biol 65: 311-328 Ku CS, Mun SP (2007) Characterization of proanthocyanidins in hot water extract isolated from Pinus radiata bark. Wood Sci Technol 41: 235-247 Kumar A, Ellis BE (2003) 4-Coumarate:CoA ligase gene family in Rubens idaeus: cDNA structures, evolution, and expression. Plant Mol Biol 31: 327-340 Kupče E, Freeman R (2007) Compensated adiabatic inversion pulses: Broadband INEPT and HSQC. J Magn Reson 187: 258-265 Lee D, Douglas CJ (1996) Two divergent members of a tobacco 4-Coumarate:coenzyme A ligase (4CL) gene family. Plant Physiol 112: 193-205 Lee D, Meyer K, Chapple C, Douglas CJ (1997) Antisense suppression of 4-coumarate:coenzyme A ligase activity in Arabidopsis leads to altered lignin subunit composition. Plant Cell 9: 1985-1998 Page 21

28/10/2008

Wagner et al.

Leplé J-C, Dauwe R, Morreel K, Storme V, Lapierrre V, Naumann A, Kang K-Y, Kim H, Ruel K, Lefèbvre A, Joseleau J-P, Grima-Pettenati J, De Rycke R, Andersson-Gunnerås S, Erban A, Fehrle I, Petit-Conil M, Kopka J, Polle A, Messens E, Sundberg B, Mansfield SD, Ralph J, Pilate G, Boerjan W (2007) Down-regulation of cinnamylcoenzyme A reductase in poplar: multiple-level phenotyping reveals effects on cell wall polymer metabolism and structure. Plant Cell 19: 3669-3691 Li L, Popko JL, Zhang X-H, Osakabe K, Tsai CJ, Joshi CP, Chiang VL (1997) A novel multifunctional o-methyltransferase implicated in a dual methylation pathway associated with lignin biosynthesis in loblolly pine. PNAS 94: 5461-5466 Li L, Zhou Y, Cheng X, Sun J, Marita JM, Ralph J, Chiang VL (2003) Combinatorial modification of multiple lignin traits in trees through multigene cotransformation. PNAS 100: 4939-4944 Lu F, Ralph J (2003) Non-degradative dissolution and acetylation of ball-milled plant cell walls: high-resolution solution-state NMR. Plant J 35: 535-544 Martin D, Tholl D, Gershonzon J, Bohlmann J (2002) Methyl jasmonate induces traumatic resin ducts, terpenoid resin biosynthesis and terpenoid accumulation in developing xylem of Norway spruce stems. Plant Physiol 129: 1003-1018 Meyermans H, Morreel K, Lapierre C, Pollet B, De Bruyn A, Busson R, Herdewijn P, Devreese B, Van Beeumen J, Marita JM, Ralph J, Chen C, Burggraeve B, Van Montagu M, Messens E, Boerjan W (2000) Modifications in lignin and accumulation of phenolic glucosides

in

poplar

xylem

upon

down-regulation

of

caffeoyl-coenzyme

A

o-

methyltransferase, an enzyme involved in lignin biosynthesis. J Biol Chem 275: 36899-36909 Möller R, McDonald AG, Walter C, Harris PJ (2003) Cell differentiation, secondary cell-wall formation and transformation of callus tissue of Pinus radiata D. Don. Planta 217: 736-747 Möller R, Steward D, Phillips L, Heather F, Wagner A (2005a) Gene silencing of Cinnamyl Alcohol Dehydrogenase in Pinus radiata callus cultures. Plant Physiol Biochem 43: 10611066 Möller R, Koch G, Nanayakkara B, Schmitt U (2005b) Lignification in cell cultures of Pinus radiata: activities of enzymes and lignin topochemistry. Tree Physiol 26: 201-210 Nagy NE, Franceshii VR, Solheim H, Krekling T, Christiansen E (2000) Wound-induced traumatic resin duct development in stems of Norway spruce (Pinaceae): anatomy and cytochemical traits. Am J Bot 87: 302-313 Page 22

28/10/2008

Wagner et al.

Nanayakkara B, Manley-Harris M, Suckling ID, Donaldson LA (2005) Chemical characterisation of compression wood in Pinus radiata. Proceedings of the 59th Annual Appita Conference, New Zealand, pp 585-592 O'Malley DM, Porter S, Sederoff RR (1992) Purification, characterization, and cloning of cinnamyl alcohol dehydrogenase in loblolly pine (Pinus taeda L.). Plant Physiol 98:1364-1371 Pettersen RC, Schwandt VH (1991) Wood sugar analysis by anion chromatography. J Wood Chem Tech 11: 495-501 Rastogi S, Dwivedi UN (2008) Manipulation of lignin in plants with special reference to Omethyltransferase. Plant Science 174: 264-277 -

Pilate G, Guiney E, Holt K, Petit Conil M, Lapierre C, Leplé J

-C, Pollet B, Mila I, Webster

EA, Marstorp HG, Hopkins DW, Jouanin L, Boerjan W, Schuch W, Cornu D, Halpin C (2002) Field and pulping performances of transgenic trees with altered lignification. Nat Biotechnol 20: 607-612 Ralph J, Hatfield RD (1991) Pyrolysis-GC/MS characterization of forage materials. J Agric Food Chem 39: 1426-1437 Ralph J, MacKay JJ, Hatfield RD, O’Malley DM, Whetten RW, Sederoff RR (1997) Abnormal lignin in a loblolly pine mutant. Science 277: 235-239 Ralph J, Kim H, Peng J, Lu F (1999) Arylpropane-1,3-diols in lignins from normal and CADdeficient pines. Org Lett 1: 323-326 Ralph J, Lundquist K, Brunow G, Lu F, Kim H, Schatz PF, Marita JM, Hatfield RD, Ralph SA, Christensen JH (2004) Lignins: Natural polymers from oxidative coupling of 4hydroxyphenyl-propanoids. Phytochem Reviews 3: 29-60 Ralph J, Akiyama T, Kim H, Lu F, Schatz PF, Marita JM, Ralph SA, Reddy MSS, Chen F, Dixon RA (2006) Effects of coumarate-3-hydroxylase downregulation on lignin structure. J Biol Chem 281: 8843-8853 Ralph J, Kim H, Lu F, Grabber JH, Boerjan W, Leplé J-C, Berrio Sierra J, Mir Derikvand M, Jouanin L, Lapierre C (2008) Identification of the structure and origin of a thioacidolysis marker compound for ferulic acid incorporation into angiosperm lignins (and an indicator for cinnamoyl-CoA reductase deficiency). Plant J 53: 368-379 Savidge RA, Forster H (2001) Coniferyl alcohol metabolism in conifers - II. Coniferyl alcohol and dihydroconiferyl alcohol biosynthesis. Phytochem 57: 1095-1103 Sederoff RR, MacKay JJ, Ralph J, Hatfield RD (1999) Unexpected variation in lignin. Curr Opin

Page 23

28/10/2008

Wagner et al.

Plant Biol 2: 145-152 Shimamura K, Oka S-I, Shimotori Y, Ohmori T, Kodama H (2007) Generation of secondary small interfering RNA in cell-autonomous and non-cell autonomous RNA silencing in tobacco. Plant Mol Biol 63: 803-813 Spurr AR (1969) A low-viscosity epoxy resin embedding medium for electron microscopy. J Ultra Mol Struct R 26: 31-43 Sungur S, Uzar A (2008) Investigation of complexes tannic acid and myricetin with Fe(III). Spectrochimica Acta - Part A: Molecular and Biomolecular Spectroscopy 69: 225-229 Syrjänen K, Brunow G (2000) Regioselectivity in lignin biosynthesis. The influence of dimerization and cross-coupling. J Chem Soc Perkin Trans 1: 183-187 Timell TE (1982) Recent progress in the chemistry and topochemistry of compression wood. Wood Sci Technol 16: 83-122 Tsai C-J, Popko JL, Mielke MR, Hu W-J, Podila GK, Chiang VL (1998) Suppression of Omethyltransferase gene by homologous sense transgene in quaking aspen causes red-brown wood phenotypes Plant Physiol 117: 101-112 Voo KS, Whetten RW, O’Malley DM, Sederoff RR (1995) 4-coumarate: coenzyme A ligase from loblolly pine xylem. Plant Physiol 108: 85-97 Wadenbäck J, von Arnold S, Egertsdotter U, Walter MH, Grima-Pettenati J, Goffner D, Gellerstedt G, Gullion T, Clapham D (2008) Lignin biosynthesis in transgenic Norway spruce plants harbouring an antisense construct for cinnamoyl CoA reductase (CCR) Transgenic Res 17: 379-392 Wagner A, Walter C (2004) Promoters studies in conifers. In C Walter, M Carson, eds, Plantation Forest Biotechnology for the 21st century. Research Signpost, Kerala, India, pp 231-240 Wagner A, Phillips L, Narayan RD, Moody JM, Geddes B (2005) Gene silencing studies in the gymnosperm species Pinus radiata. Plant Cell Rep 24: 95-102 Wagner A, Ralph J, Akiyama T, Flint H, Phillips L, Torr K, Nanayakkara N, Te Kiri L (2007) Exploring lignification in conifers by silencing hydroxycinnamoyl-CoA: shikimate hydroxycinnamoyltransferase in Pinus radiata. PNAS 104: 11856-11861 Walter C, Grace LJ, Wagner A, White DWR, Walden AR, Donaldson SS, Hinton H, Gardner RC, Smith DR (1998) Stable transformation and regeneration of transgenic plants of Pinus radiata D. Don. Plant Cell Rep 17: 460-468 Zhang X-H, Chiang VL (1997) Molecular cloning of 4-coumarate:coenzyme a ligase in loblolly pine and the roles of this enzyme in the biosynthesis of lignin in compression wood. Plant Page 24

28/10/2008

Wagner et al.

Physiol 113: 65-74

Page 25

28/10/2008

Wagner et al.

FIGURE LEGENDS Figure 1. Confocal fluorescence images of P. radiata (A) and Populus tremoloides (B) stem sections highlighting anatomical differences between both wood types. T: tracheid; RC: resin canal; R: wood ray; V: vessel element; F: wood fiber. Field of view 500 x 500 µm; Phenotypic differences between P. radiata 4CL-RNAi line AW42-13 (left plant) and a wild-type control (right plant) (C); Color of debarked stem segments from AW42-13 (left image) and a wild-type control (right image) (D).

Figure 2. Biosynthesis of lignin-related phenylpropanoids in pine starting from p-coumarate. 4CL:

4-coumarate-CoA

ligase;

HCT:

p-hydroxycinnamoyl-CoA

shikimate

hydroxycinnamoyltransferase; C3H: p-coumarate 3-hydroxylase; CCoAOMT: caffeoyl-CoA Omethyltransferase; CCR: cinnamoyl-CoA reductase; CAD: cinnamyl alcohol dehydrogenase; PPDBR: phenylpropenal double-bond reductase; ? : unknown.

Figure 3. Images of P. radiata stem segments from a wild-type control (left images), and 4CLRNAi lines AW42-14 (middle images) and AW42-13 (right images). Unstained images of cut stems (A); Stem sections stained with FeCl3 showing tannins as black stained areas (B); Stem sections stained with phloroglucinol/HCl showing lignified tissue stained red (C). Scale bar = 1 cm.

Figure 4. Confocal fluorescence images of P. radiata stem sections from a wild-type control, and 4CL-RNAi lines AW42-13 and AW42-14. Wild-type control stained with basic fuchsin (A) or berberine sulfate (D) indicating uniformly lignified tracheids and an unlignified resin canal (RC). 4CL-RNAi line AW42-13 stained with basic fuchsin (C and G) or berberine sulfate (H) showing variable lignification of tracheids (C) and bands of axial parenchyma (AP) (G and H). 4CL-RNAi line AW42-14 stained with basic fuchsin (B) or berberine sulfate (E and F) showing variable lignification. 4CL-RNAi line AW42-13 (I) stained with acriflavin showing collapsed tracheids. The unlignified inner S2 layer of the tracheid walls is contrasted in orange compared to the green or yellow color of lignified cell walls (I). A-H, Field of view 500 x 500 µm; I, Field of view 159 x 159 µm.

Figure 5. Images of P. radiata stem sections from a wild-type control (A), and 4CL-RNAi line Page 26

28/10/2008

Wagner et al.

AW42-14 (B and C), treated with Wiesner reagent showing uniform lignification in the wild-type and variable lignification in the transgenic material. Scale bar = 135 μm. Figure 6. Transmission electron micrograph of P. radiata stem sections from 4CL-RNAi line AW42-13 stained with potassium permanganate showing collapsed tracheids with poorly lignified cell walls (A) and a wild-type control showing normal tracheids (B). Scalebars = 4 µm (A) and 10 µm (B).

Figure 7. UV-micrograph of stem sections from line AW42-13 showing partially collapsed tracheids (top image) and a wild-type control (bottom image) scanned at a wavelength of 280 nm at a resolution of 0.25 μm2. The transgenic line displayed substantial reductions in UV absorption in all layers of the cell wall compared to the control.

Figure 8. Pyrogram (total ion chromatogram) of powdered and extracted P. radiata stem material from 4CL-RNAi line pAW42-13 (A) and a wild-type control (B). Signals 1-35 refer to the following pyrolysis products. 1: (3H) furan-2-one; 2: dihydro-methyl-furanone (isomer); 3: dihydro-methyl-furanone (isomer); 4: 2-hydroxy-1-methyl-1-cyclopentene-3-one; 5: guaiacol; 6: 4-hydroxy-5,6-dihydro-(2H)-pyran-2-one; 7: 4-methyl-guaiacol; 8: phenol; 9: 4-ethyl-guaiacol; 10: dimethyl-phenol; 11: eugenol; 12: 4-vinyl-guaiacol; 13: 4-hydroxy-3-methyl-(5H)-furanone; 14: unknown; 15: cis-isoeugenol; 16: trans-isoeugenol; 17: 5-hydroxymethyl-2-furaldehyde; 18: vanillin; 19: 1,5-anhydro-arabinofuranose; 20: homovanillin; 21: acetoguaiacone; 22: 3-methylcatechol; 23: catechol; 24: unknown; 25: 4-methyl-catechol; 26: unknown; 27: 1,5-anhydro-β-Dxylofuranose;

28: dihydroconiferyl alcohol;

29: 1,6-anhydro-α-D-galactopyranose;

30:

coniferaldehyde; 31: 1,6-anhydro-β-D-mannopyranose; 32: unknown; 33: trans-coniferyl alcohol; 34: unknown; 35: 1,6-anhydro-β-D-glucopyranose. A series of signals diagnostic for guaiacyl-lignin (16, 18, 28, 30 and 33) were substantially reduced in pAW42-13 compared to the wild-type control.

Figure 9. Partial short-range

13

C–1H (HSQC) spectra (sidechain regions) of acetylated

cellulolytic enzyme lignins isolated from (A) the wild-type control and (B) 4CL-deficient line AW42-13. 4CL-deficiency and the incorporation of relatively higher levels of p-coumaryl alcohol into the lignin, produces changes in the distribution of interunit linkage types. Volume integrals and semi-quantitative data are given in Table III. Interunit type designations A-D, S, and X1 (and Page 27

28/10/2008

Wagner et al.

X5, not shown in this Figure) follow conventions established previously (Boerjan et al., 2003; Ralph et al., 2004; Ralph et al., 2006; Wagner et al., 2007).

Page 28

28/10/2008

Wagner et al.

TABLES Table I. Signal surface area for selected pyrolysis products from wood samples of a wild-type control and transgenic lines AW42-13, AW42-14 and AW42-17 Sample

vanillin m/z 151 a

coniferaldehyde

coniferyl alcohol

dihydroconiferyl alcohol

m/z 178

m/z 180

m/z 182

Control

124095 ± 16815

80492 ± 3221

77034 ± 13245

20996 ± 907

AW42-13

59872 ± 19773

33668 ± 8989

21769 ± 5559

6130 ± 2083

AW42-14

70685 ± 18741

36926 ± 2273

31018 ± 1909

10339 ± 636

AW42-17

105888 ± 11993

71687 ± 8747

58164 ± 4372

15891 ± 3803

a

All values represent the average and standard deviation of at least three independent measurements.

Page 29

28/10/2008

Wagner et al.

Table II. Acetyl bromide-soluble lignin (% w/w) and neutral sugar content (% w/w) in wood of a wild-type control and transgenic lines AW42-13, AW42-14 and AW42-17 Sample

ABSL

Arabinose

Galactose

Glucose

Xylose

Mannose

lignin Control

28.8 ± 1.4a

2.0 ± 0.1

2.4 ± 0.3

39.0 ± 1.0

8.3 ± 0.3

10.6 ± 0.5

AW42-13

18.5 ± 1.9

2.9 ± 0.1

5.2 ± 0.1

40.2 ± 0.6

5.7 ± 0.1

8.0 ± 0.1

AW42-14

20.7 ± 1.7

2.7 ± 0.1

4.3 ± 0.1

40.2 ± 0.8

7.8 ± 0.2

10.8 ± 0.4

AW42-17

26.6 ± 0.1

2.5 ± 0.1

2.7 ± 0.1

38.6 ± 0.6

8.0 ± 0.1

10.9 ± 0.1

a

This value represents the average and standard deviation of ten independent measurements; all other

values represent the average and standard deviation of at least two independent measurements.

Page 30

28/10/2008

Wagner et al.

Table III. NMR-derived p-hydroxyphenyl/guaiacyl (H/G) data and interunit linkage data for lignin from a wild-type control and transgenic line AW42-13 Sample

%H

%G

H/G

%A

%B

%C

%D

%S

%X5

Control

3.4

96.6

0.03

76

15

5.2

3.6

0.1

3.1

AW42-13

13.5

86.5

0.16

82

12

3.6

2.3

0.6

1.3

H = p-hydroxyphenyl; G = guaiacyl; A = β–O–4 (β-aryl ether); B = β–5 (phenylcoumaran); C = β–β (resinol); D = β–O-4/5–5 (dibenzodioxocin) S = β–1 (spirodienone); X5 = dihydroconiferyl alcohol endgroup (see Fig. 9 for structures, except X5, the hydrogenated (double-bond-saturated) analog of X1, is not shown and is not visible in the plotted region of these spectra). Note: H/G values were determined from the solubilized whole cell wall fraction; interunit linkage distribution was determined from polysaccharidase-treated walls (CEL fraction).

Page 31

28/10/2008