Linkage disequilibrium studies in multiple endocrine neoplasia type 1 ...

Hum Genet (1997) 100 : 657–665

© Springer-Verlag 1997

O R I G I N A L I N V E S T I G AT I O N

The European Consortium on MEN1

Linkage disequilibrium studies in multiple endocrine neoplasia type 1 (MEN1)

Received: 1 April 1997 / Accepted: 25 June 1997

Group 1 J. H. D. Bassett · A. A. J. Pannett · S. A. Forbes · R. V. Thakker (Y) MRC Molecular Endocrinology Group, MRC Clinical Sciences Centre, Royal Postgraduate Medical School, Hammersmith Hospital, Du Cane Road, London, W12 0NN, UK Tel.: +44-181-383-3014; Fax: +44-181-383-8306 e-mail: [email protected] M. McCarthy Unit of Metabolic Medicine, Imperial College School of Medicine, St. Mary’s Hospital, Norfolk Place, London, W2 1PG, UK A. P. Read Department of Medical Genetics, University of Manchester, St. Mary’s Hospital, Hathersage Road, Manchester M13 0JH, UK Group 2 B. T. Teh · C. Larsson Department of Molecular Medicine, Endocrine Tumour Unit, CMM, Karolinska Hospital, L8: 01, S-171 76 Stockholm, Sweden S. Kytölä · J. Leisti Department of Clinical Genetics, Oulu University Hospital, Kajaanitie 50, FIN 90220 Oulu, Finland P. Salmela Department of Internal Medicine, Oulu University Hospital, Kajaanitie 50, FIN 90220 Oulu, Finland Group 3 G. Weber Department of Molecular Medicine, Clinical Genetics Unit, CMM, Karolinska Hospital, L8: 02, S-171 76 Stockholm, Sweden

Abstract Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant disorder characterised by tumours of the parathyroids, pancreas and anterior pituitary. The MEN1 gene has been localised to a 2-Mb region of chromosome 11q13 by meiotic mapping studies in MEN1 families. Such studies may have a limited resolution of approximately 1 cM (i.e. 1 Mb) and we have therefore investigated 96 MEN1 families (40 British, 17 French, 12 Finnish, 7 Swedish, 7 Dutch, 7 North American, 2 Australian, 1 New Zealand, 1 German, 1 Spanish and 1 Danish) for linkage disequilibrium, in order to facilitate a finer mapping resolution. We have utilised five microsatellite DNA sequence polymorphisms from the candidate region and have accurately determined their allele sizes, which ranged from 161 bp to 272 bp. The heterozygosity and number of alleles (given in brackets), respectively, at the loci were: D11S1883 (76%, 11), D11S457 (55%, 5), PYGM (94%, 18), D11S1783 (10%, 4) and D11S449 (87%, 16). Allelic association was assessed by Chi-square 2 × n contingency tables, by Fisher exact 2 × n contingency tables and by a likelihood-based approach. The results of haplotype analysis revealed 91 different af-

H. K. Ploos van Amstel Clinical Genetics Centre, Utrecht University Hospital, H04-312, PO Box 05500, Heidelberglaan 100, 3508 GA Utrecht, The Netherlands C. J. M. Lips Department of Internal Medicine, Utrecht University Hospital, H04-312, PO Box 05500, Heidelberglaan 100, 3508 GA Utrecht, The Netherlands

Group 4 S. Giraud · C. X. Zhang · A. Calender Service de Génétique, Pavillon E, Hôpital Edouard Herriot, Place d’Arsonval, F-69437 Lyon cedex 03, France

Group 6 K. Kas · W. J. M. Van De Ven Laboratory for Molecular Oncology, Centre for Human Genetics, K U Leuven, Herestraat 49, B-3000 Leuven, Belgium

Group 5 J. W. M. Höppener Department of Pathology, Utrecht University Hospital, H04-312, PO Box 05500, Heidelberglaan 100, 3508 GA Utrecht, The Netherlands

Group 7 P. Gaudray LGMCH, CNRS URA 1462, Faculté de Médecine, Avenue de Valombrose, F-06107 Nice, France

658

fected haplotypes in the 96 families, an identical affected haplotype being observed in no more than two families. These results indicate the absence of an ancestral affected haplotype. Significant linkage disequilibrium (P < 0.005) could be established amongst the microsatellite loci but not between the loci and MEN1 in either the total population or in any of the geographical sub-populations. The absence of linkage disequilibrium between MEN1 and the polymorphic loci is probably the result of the occurrence of multiple different disease-causing mutations in MEN1.

Introduction Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant disorder that is characterised by the combined occurrence of tumours of the parathyroids, pancreatic islet cells and anterior pituitary gland (Thakker and Ponder 1988). The gene causing MEN1 has been mapped to chromosome 11q13 (Larsson et al. 1988; Thakker et al. 1989; Bale et al. 1989; Teh et al. 1994) and a minimum candidate region of approximately 2 Mb flanked centromerically by D11S1883 and telomerically by D11S449 (Fig. 1) has been defined (European Consortium on MEN1 1996). A number of candidate genes, viz. ZFM1, PLCβ3, CAPN1, FAU and FKBP2 (Lloyd et al. 1997; Weber et al. 1997; Pang et al. 1996; Kas et al. 1993; Grimmond et al.

1995), from this gene-rich region (Pook et al. 1996; Craig and Bickmore 1994) have been excluded as being the MEN1 gene and a further narrowing of the MEN1 critical region would facilitate these investigations and the identification of the MEN1 gene. However, recombination mapping studies in families rarely provide a resolution greater than a few centiMorgans (cM) and a method with a finer mapping resolution is required to help narrow the region. Linkage disequilibrium analysis may provide such an approach (Weeks and Lathrop 1995); this method has been successfully used in the further localisation of cystic fibrosis (Kerem et al. 1989), diastrophic dysplasia (Hastbacka et al. 1992, 1994), Batten’s disease (Lerner et al. 1994), polycystic kidney disease (Snarey et al. 1994), Wilson’s disease (Bowcock et al. 1994), haemochromatosis (Raha-Chowdhury et al. 1995) and infantile-onset spinocerebellar ataxia (Nikali et al. 1995). Linkage disequilibrium, which is the non-random association of alleles at linked loci, is based on the assumption that affected chromosomes are derived from a single ancestral chromosome carrying a disease mutation and will therefore demonstrate a similar haplotype in the close proximity of the disease gene; the size of the region showing disequilibrium will depend upon the number of generations since the mutation originally occurred and the recombination rate of the region. Thus, linkage disequilibrium analysis may facilitate the identification of additional recombinants and thereby potentially provide for an increased mapping resolution. A study of MEN1 families of Northern European origin from an isolated Newfoundland population has indicated the occurrence of an ancestral, or founder, MEN1 mutation (Petty et al. 1994) and we have therefore investigated this further by an analysis of 96 MEN1 families of Northern European origin.

Patients and methods Patients and families

Fig. 1 Schematic representation of chromosome 11 showing the location and physical distances between loci in 11q13 and their relationship to MEN1 (European Consortium on MEN1 1996). MEN1 is located within an approximately 2-Mb region flanked by D11S1883 centromerically and D11S449 telomerically, a region that also contains the three additional microsatellite polymorphic loci D11S457, PYGM(caga) and D11S1783

The clinical details of the MEN1 families have been previously reported (Trump et al. 1996; European Consortium on MEN1 1996) and only kindreds that contained a minimal nuclear family structure of either an affected parent, an unaffected parent and an affected child, or a minimum of two affected members where the affected haplotype could be unequivocally established were included. The study consisted of 96 MEN1 families (208 affected and 72 unaffected members): 40 were British (86 affected and 31 unaffected members); 17 were French (38 affected and 9 unaffected members); 12 were Finnish (25 affected and 7 unaffected members); 7 were Swedish (15 affected and 5 unaffected members); 7 were Dutch (14 affected and 7 unaffected members); 7 were North American (18 affected and 7 unaffected members); 2 were Australian (4 affected and 2 unaffected members); 1 was from New Zealand (2 affected members and 1 unaffected member); 1 was German (2 affected members and 1 unaffected member); 1 was Spanish (2 affected members and 1 unaffected member); and 1 was Danish (2 affected members and 1 unaffected member). DNA analysis Leucocyte DNA was extracted (Thakker et al. 1989) and used in polymerase chain reaction (PCR) amplification (Pang et al 1996)

Annealing temperature (° C)

56 60 64 62 56

Reverse primer

TGGTTTCGGATCTCTTCTTCA CTAGTTGTTATCAAGATCATACC GCTGTCAGGTAGCAACTGAC GATGAGACGGACTTGCG GGCGACATAGTGAGATCCTGT TTCAGTAACAGGAGACAAAAGG GTGACAAAGCAAGACTCCCTC CTAGCAGAGTCCACCTACTG GTGTGGTGGTGGGCAC GGTGAAAAAACACACTTGTCTG 76 55 94 10 87 (CA)n (CA)n (CA)n(GA)n (CA)n (CCTT)n 252-272 176-184 161-197 270-276 175-255 D11S1883 D11S457 PYGM D11S1783 D11S449

11 5 18 4 16

Tandem repeat Allele size (bp)

Number of alleles

of the five polymorphic microsatellites, D11S1883, D11S457, PYGM(caga), D11S1783 and D11S449, utilising primers and conditions shown in Table 1. Fluorescent labelling of the PCR products was performed by either incorporation of UTPs (R6G, R110 or Tamra; Applied Biosystems) during the PCR or by using a forward primer 5′-end-labelled with a TET, HEX or FAM phosphoramidite (Oswel) as described by Pritchard et al. (1995). Internal lane size standard markers (GenescanTM 350-ROX ABI or GenescanTM 500-TAMRA ABI) were added to the PCR products of each individual and the polymorphisms were detected by using a semiautomated gel system (ABI 377 sequencer). The alleles were defined by using the GenescanTM Analysis (2.0.2; Applied Biosystems) and GenotyperTM (1.1; Applied Biosystems) programs. All data were verified manually from the marker-specific chromatograms. Haplotypes of affected and unaffected chromosomes were constructed by using the genotypes from the family members and the reported locus order 11cen-D11S1883-D11S457-PYGMD11S1783-D11S449-11qter (European Consortium on MEN1 1996) Statistical analysis Allele association between MEN1 and the microsatellite polymorphisms was assessed by four methods, which included Chi-square 2 × n contingency tables (Snarey et al. 1994), Fisher exact 2 × n contingency tables (Agresti 1992; Bowcock et al. 1994) and the single and multiple locus likelihood-based approaches, with the computer programs DISLAMB and DISMULT, respectively (Terwilliger 1995; Nikali et al. 1995; Raha-Chowdury et al. 1995). In these analyses, the control allele frequencies were obtained from those observed in the unaffected spouse and the non-transmitted allele of the affected parent. The analyses were performed separately for each population subgroup and also with all the families of Northern European origin combined. The large number of alleles at each locus made it unfeasible to assess for linkage disequilibrium between the microsatellite loci themselves by these methods; this was therefore assessed by STATXACT program (Cytel Corporation, Cambridge, Mass., USA) utilising a Monte Carlo estimate of the exact P-value. The P-values were calculated separately for each population subgroup that was of a large enough size (> 10 families) and for the total Northern European group of families using n × n contingency tables of the allele frequencies at paired loci.

Results and discussion

Locus

Table 1 Details of microsatellite polymorphisms

Heterozygosity (%)

Forward primer

659

The five microsatellite polymorphisms were found to have allele sizes ranging from 161 bp to 276 bp and the heterozygosity (%) and number of alleles for each of the loci D11S1883, D11S457, PYGM, D11S1783 and D11S449, in the 96 MEN1 families, were 76% and 11, 55% and 5, 94% and 18, 10% and 4, and 87% and 16, respectively (Table 1). D11S1783 was not highly informative (heterozygosity < 50%) and was excluded from further linkage disequilibrium analysis. The assessment of allele association amongst the remaining polymorphic loci revealed that significant linkage disequilibrium was present (Table 2) in the population sub-groups that contained more than 10 families and in the total Northern European group, which contained 96 families. The results also suggested that the populations were sufficiently stable, as opposed to rapidly expanding or growing, to facilitate the detection of linkage disequilibrium (Slatkin 1994). In addition, a simulated test for allelic association in the 11 informative families from the Finnish population, which is of a recent (80–100 generations) origin (Hastbacka et al.

660 Table 2 Likelihood ratio test for linkage disequilibrium between the polymorphic loci, using the Monte Carlo estimate of the exact P-value

Population (n = families)

Loci

P-value

P-value 99% Confidence interval

Northern European (n = 96)

D11S1883 / D11S457 D11S1883 / PYGM D11S1883 / D11S449 D11S457 / PYGM D11S457 / D11S449 PYGM / D11S449

0.4828 0.0210 0.4807 0.0000 0.9766 0.0338

0.4737–0.4919 0.0184–0.0236 0.4716–0.4899 0.0000–0.0002 0.9738–0.9794 0.0305–0.0371

British (n = 40)


0.5454 0.0041 0.0028 0.0034 0.9955 0.1945

0.5363–0.5544 0.0029–0.0053 0.0020–0.0035 0.0025–0.0042 0.9943–0.9968 0.1873–0.2017

French (n = 17)


0.1954 0.4823 0.8158 0.0144 0.2288 0.1640

0.1882–0.2026 0.4694–0.4952 0.8087–0.8228 0.0126–0.0162 0.2226–0.2351 0.1573–0.1707

Finnish (n = 12)


0.2801 0.2011 0.8234 0.8083 0.2114 0.0014

0.2736–0.2883 0.1938–0.2084 0.8164–0.8303 0.8011–0.8155 0.2040–0.2189 0.0009–0.0019

Fig. 2 Haplotype analysis in two pairs of unrelated Finnish families (Finnish families 2 and 3, and families 10 and 12), two North American families (25/95 and 8/96), two families of Dutch origin (Dutch family 4 and 4/89) one of whom resides in South Africa, and one French and British family (40 and 13/96). The genotypes for each individual are shown in the locus order D11S1883D11S457-PYGM-D11S449. The affected (A) and unaffected (U) haplotypes are indicated for each individual and the affected hap-

lotype is also outlined by the box. N/A indicates that the individual was not available for analysis. Identical affected haplotypes were observed in the two Finnish families 2 and 3, the other two Finnish families 10 and 12, the two North American families 25/95 and 8/96, the two families 4 and 4/89 of Dutch origin, the French family 40 and British family 13/96. In addition, 12 pairs of identical haplotypes were identified in the 256 unaffected chromosomes (data not shown)

661 Table 3 Distribution of alleles on MEN1 affected (A) and unaffected (U) chromosomes (N.E. Northern European origin) Allele Total:

D11S1883

D11S457

PYGM

D11S449

A

U

A

U

A

U

A

U

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

25 12 31 7 3 4 1 0 2 1 0

55 43 68 13 5 7 7 6 11 5 1

1 26 54 6 1

2 69 130 20 0

2 1 0 6 2 9 9 15 16 6 3 10 4 5 2 1 0 0 1

7 2 1 19 11 23 34 29 37 22 17 13 9 5 4 1 2 0 1

3 12 18 18 14 14 5 2 0 0 0 0 0 0 0 4 1 0 0 0 0

9 22 46 26 37 37 31 8 0 0 0 0 0 1 3 2 2 1 1 2 1

Total

86

221

88

221

92

237

91

229

British:

A

U

A

U

A

U

A

U

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

10 6 11 3 1 4 0 0 0 0 0

22 19 28 9 1 4 4 2 6 2 1

1 13 20 2 0

1 26 59 9 0

0 1 0 3 1 1 5 7 7 2 1 4 1 2 1 0 0 0 1

5 2 1 10 3 8 14 11 22 11 1 4 2 2 1 1 1 0 1

0 3 11 8 6 9 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0

1 12 23 11 17 22 9 4 0 0 0 0 0 0 1 1 1 0 0 1 0

Total

35

98

36

95

37

100

40

103

A

U

A

U

A

U

A

U

5 3 4 2 0 0 0

6 8 14 1 3 0 1

0 3 13 0 0

0 9 28 2 0

0 0 0 1 0 6 0

1 0 0 1 2 4 9

1 2 3 3 4 1 1

4 2 6 5 5 2 7

French: 1 2 3 4 5 6 7

Allele

D11S1883

D11S457

PYGM

D11S449

Swedish:

A

U

A

U

A

U

A

U

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

2 1 4 0 0 0 0 0 0 0 0

4 5 5 2 0 0 0 1 0 0 0

0 1 5 1 0

0 4 8 5 0

0 0 0 0 1 1 3 1 0 0 0 0 1 0 0 0 0 0 0

0 0 0 2 3 4 0 5 0 2 0 0 1 0 0 0 0 0 0

0 1 1 0 0 1 0 2 0 0 0 0 0 0 0 1 1 0 0 0 0

1 3 2 2 2 2 2 2 0 0 0 0 0 0 0 1 0 0 0 0 0

Total

7

17

7

17

7

17

7

17

Dutch:

A

U

A

U

A

U

A

U

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

4 0 1 1 0 0 0 0 0 0 0

3 3 7 1 1 0 1 0 2 0 0

0 3 4 0 0

1 10 6 3 0

0 0 0 0 0 0 1 0 0 2 0 0 0 3 0 1 0 0 0

0 0 0 2 2 2 3 1 3 1 2 2 1 1 0 0 0 0 0

0 0 1 2 1 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0

0 1 3 0 4 3 2 1 0 0 0 0 0 0 1 0 0 1 0 0 0

Total

6

18

7

20

7

20

6

16

N American: A

U

A

U

A

U

A

U

9 2 5 0 0 1 0

0 1 5 0 1

0 8 10 0 0

1 0 0 2 0 0 0

0 0 0 1 0 3 4

0 1 1 3 1 1 0

0 1 3 3 2 3 6

1 2 3 4 5 6 7

1 1 3 1 0 0 1

662 Table 3 (continued) Allele

D11S1883

D11S457

French:

A

U

8 9 10 11 12 13 14 15 16 17 18 19 20 21

0 2 1 0

3 0 1 0

17

37

16

Finnish: A

U

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

3 1 4 0 2 0 0 0 0 0 0

10

Total

Total

A

U

PYGM

D11S449

Allele

D11S1883

D11S457

PYGM

D11S449

A

A

U

A

U

0 3 0 0 1 0 0 0

4 2 1 2 0 0 1 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0

A

U

A

U

N. American: A

U

2 3 2 1 1 0 0 1 0 0 0 0

4 4 3 5 5 4 0 0 0 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0

1 0 0 0 0 0 1 1 0 1 0 1 0 0

8 9 10 11 12 13 14 15 16 17 18 19 20 21

0 0 0 0

0 1 0 0

39

17

42

15

36

Total

7

18

7

18

7

18

7

18

A

U

A

U

A

U

Other N.E.:

A

U

A

U

A

U

A

U

8 5 6 0 0 0 0 0 1 1 0

0 4 6 1 0

0 8 12 1 0

1 0 0 0 0 1 0 3 3 0 0 1 2 0 0 0 0 0 0

0 0 0 2 0 1 3 2 3 2 5 1 1 1 2 0 0 0 0

2 3 1 2 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0

3 2 9 3 1 2 4 0 0 0 0 0 0 0 0 0 0 0 0 1 0

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

0 0 4 0 0 0 0 0 0 0 0

3 1 3 0 0 2 1 0 1 1 0

0 1 1 2 0

0 4 7 0 0

0 0 0 0 0 0 0 2 0 0 1 3 0 0 0 0 0 0 0

1 0 0 1 1 1 1 2 3 2 2 1 0 0 1 0 1 0 0

0 3 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

0 1 0 2 6 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1

21

11

21

11

23

11

25

Total

4

12

4

11

6

17

5

14

1992; de la Chapelle 1993), revealed that significant linkage disequilibrium would be detected between MEN1 and PYGM by the single locus likelihood-ratio test (P < 0.001, DISLAMB) and by the Fisher exact test (P = 0.001) if 8 out of the 11 affected chromosomes or 10 out of the 11 affected chromosomes, respectively, shared one PYGM allele. Thus, these results indicated that the number of families in our study was adequate to enable the detection of this degree of linkage disequilibrium if it were present. Within the 96 MEN1 families, an examination of the haplotypes obtained with the four polymorphic loci, D11S1883, D11S457, PYGM and D11S449, revealed 91 different affected haplotypes; identical affected haplotypes were observed in only five pairs of MEN1 families

U

(Fig. 2). However, the frequency of such identical haplotypes did not exceed a value of 2 amongst the 96 affected MEN1 haplotypes and, in addition, the frequency of identical pairs of unaffected (i.e. control) haplotypes was 12 in 256 such haplotypes analysed. Thus, these results indicated an absence of an ancestral MEN1-affected haplotype. An examination of the distribution of alleles obtained with each of the four polymorphic loci in the population sub-groups and the total 96 MEN1 families (Table 3) revealed no significant difference between those observed on the affected and unaffected chromosome. This suggested a lack of allelic association, which was further assessed by Chi-square 2 × n contingency tables, by Fisher exact 2 × n contingency tables, by a single locus likeli-

663 Table 4 Linkage disequilibrium analysis between MEN1 and four polymorphic loci. λ expresses the proportion of excess of a certain allele in the chromosome carrying the disease allele and –2ln(LR)

is interpreted conservatively as 0.5 × Chi square (1 df); N/A data were not calculated as the contingency tables required were too large for computer analysis λa

2×n table χ2

χ2 P value

Fisher’s exact test P value

–2ln Multipoint (likeli- LOD scoreb hood ratio)b

0.5 0.5 0.5 0.492

0.000 0.000 0.000 0.005

8.308 0.988 14.001 15.883

0.599 0.912 0.667 0.390

N/A 0.845 N/A N/A

0.000 0.000 0.000 0.000

0.000 0.000 0.000 0.000

0.000 0.000 0.000 0.000

0.5 0.5 0.5 0.5

0.000 0.000 0.000 0.000

8.808 1.842 11.022 0.850

0.551 0.606 0.808 0.811

0.557 0.542 N/A 0.695

0.000 0.000 0.000 0.000

0.000 0.000 0.000 0.000

43 37 39 42 36

0.000 0.000 1.153 0.000

0.5 0.5 0.141 0.5

0.000 0.000 0.283 0.000

11.410 1.053 16.027 5.536

0.180 0.590 0.140 0.902

0.191 0.869 0.092 0.885

0.000 0.000 0.692 0.000

0.000 0.000 0.150 0.000

12 10 11 11 11

25 21 24 23 25

0.000 0.000 0.000 0.000

0.5 0.5 0.496 0.5

0.000 0.000 0.110 0.000

6.219 0.231 14.048 5.367

0.285 0.891 0.230 0.615

0.329 1.000 0.139 0.581

0.000 0.000 0.000 0.000

0.000 0.000 0.000 0.000

Swedish D11S1883 D11S457 PYGM D11S449

7 7 7 7 7

17 17 17 17 17

0.000 0.000 0.870 0.000

0.5 0.5 0.175 0.5

0.000 0.000 0.379 0.000

2.756 1.201 10.044 6.656

0.599 0.549 0.123 0.673

0.811 0.597 0.157 0.875

0.000 0.786 0.000 0.000

0.000 0.171 0.000 0.000

Dutch D11S1883 D11S457 PYGM D11S449

7 6 7 7 6

20 18 20 20 16

0.893 0.002 0.806 0.012

0.172 0.484 0.185 0.456

0.533 0.065 0.389 0.084

7.524 2.486 15.718 14.185

0.275 0.478 0.152 0.116

0.293 0.679 0.215 0.126

1.637 0.502 0.329 0.000

0.356 0.109 0.071 0.000

N. American D11S1883 D11S457 PYGM D11S449

7 7 7 7 7

18 18 18 18 18

0.000 0.496 0.111 0.000

0.5 0.241 0.339 0.5

0.000 0.594 0.247 0.000

7.928 4.056 15.740 2.789

0.243 0.132 0.072 0.835

0.185 0.142 0.039 0.928

0.000 0.176 0.071 0.000

0.000 0.221 0.015 0.000

Other N. European D11S1883 D11S457 PYGM D11S449

6 4 4 6 5

17 12 11 17 14

3.936 0.040 0.007 0.737

0.024 0.420 0.468 0.195

1.00 0.222 0.106 0.5

8.654 5.746 12.277 10.117

0.334 0.040 0.489 0.233

0.368 0.075 0.725 0.273

5.290 4.805 4.758 4.767

1.285 1.043 1.033 1.037

Locus

Affected Unaffected Likelihood P valuea chromosomes chromosomes ratio testa χ2

Total D11S1883 D11S457 PYGM D11S449

96 86 88 92 91

254 221 221 237 229

0.000 0.000 0.000 0.000

British D11S1883 D11S457 PYGM D11S449

40 35 36 37 40

117 98 92 100 103

French D11S1883 D11S457 PYGM D11S449

17 17 16 17 15

Finnish D11S1883 D11S457 PYGM D11S449

a Calculated b Calculated

using the DISLAMB program using the DISMULT program (Terwillinger 1995)

hood-ratio test using the DISLAMB program (Terwilliger 1995) and by a multilocus test using the DISMULT program (Terwilliger 1995). Each geographical sub-population of MEN1 families was analysed separately and the total population of 96 MEN1 families of Northern European origin was also examined (Table 4). Significant link-

age disequilibrium (P < 0.005) could not be established between the four loci D11S1883, D11S457, PYGM and D11S449 and MEN1 in either the total population or in any of the sub-populations. Indeed, the best associations (P = 0.024 and P = 0.039) were observed between D11S1883 and MEN1, and PYGM and MEN1, in the

664

mixed Northern European kindreds and the North American kindreds, respectively. The absence of linkage disequilibrium in the MEN1 families may be a result of (1) an insufficient density of polymorphic markers and a high recombination rate involving the critical 2-Mb region, (2) a very ancient founder mutation, thereby, limiting the area of linkage disequilibrium, (3) an insufficient number of families from an isolated population, (4) an unusually high degree of mutability (Hastbacka et al. 1992) in the microsatellite polymorphic loci or (5) the occurrence of multiple different disease-causing mutations in MEN1. However, a high recombination rate is not supported by the relative paucity of recombinants observed in this region (Pang et al. 1996; European Consortium on MEN1 1996) and the absence of any linkage disequilibrium in the Finnish kindreds suggests that a very ancient founder effect is an unlikely explanation, as the Finnish population is only 80–100 generations old (approximately 2000 years; Hastbacka et al. 1992; de la Chapelle 1993). In addition, our simulated analysis of the Finnish families indicates that an insufficient number of families from an isolated population is an unlikely explanation; the absence of an ancestral haplotype or a higher frequency of MEN1 in the Finnish population also argues against this as a likely explanation for the absence of linkage disequilibrium. Similarly, a high degree of instability of these polymorphic loci has not been observed (Pang et al. 1996; European Consortium on MEN1 1996) and is an unlikely explanation for the lack of linkage disequilibrium. Thus, the remaining possibility of the occurrence of multiple different disease-causing mutations in MEN1 appears to be the most likely explanation and is supported by the recent identification of mutations in the MEN1 gene, which is associated with different heterozygous inactivating mutations in MEN1 families (Chandrasekharappa et al. 1997; European Consortium on MEN1 1997). Acknowledgements We are grateful to the Medical Research Council (MRC), UK, for support (J.H.D.B., A.A.J.P., S.A.F., R.V.T.). J.H.D.B. is an MRC Clinical Training Fellow.

References Agresti A (1992) A survey of exact inference for contingency tables. Stat Sci 7:131–177 Bale SJ, Bale AE, Stewart K, Dachowski L, McBride OW, Glaser T, Green JE, et al (1989) Linkage analysis of multiple endocrine neoplasia type 1 with INT2 and other markers on chromosome 11. Genomics 4:320–322 Bowcock AM, Tomfohrde J, Weissenbach J, Bonne Tamir B, St. George Hyslop P, Giagheddu M, Cavalli Sforza LL, Farrer LA (1994) Refining the position of Wilson disease by linkage disequilibrium with polymorphic microsatellites. Am J Hum Genet 54:79–87 Chandrasekharappa SC, Guru SC, Manickam P, Olufemi S, Collins FS, Emmert-Buck MR, Debelenko LV, Zhuang Z, Lubensky IA, Liotta LA, Crabtree JS, Wang Y, Roe BA, Weisemann J, Boguski MS, Agarwal SK, Kester MB, Kim YS, Heppner C, Dong Q, Spiegel AM, Burns AL, Marx SJ (1997) Positional cloning of the gene for multiple endocrine neoplasia-type 1. Science 276:404–407

Chapelle A de la (1993) Disease gene mapping in isolated human populations: the example of Finland. J Med Genet 30:857–865 Craig JM, Bickmore WA (1994) The distribution of CpG islands in mammalian chromosomes. Nat Genet 7:376–382 The European Consortium on MEN1 (1996) Definition of the minimal MEN1 candidate area based on a 5 Mb integrated map of proximal 11q13. Genomics 37:354–365 The European Consortium on MEN1 (1997) Identification of the multiple endocrine neoplasia type 1 (MEN1) gene. Hum Mol Genet 6 : 1177–1183 Grimmond S, Weber G, Larsson C, Walters M, Teh B, Shepherd J, Nordenskjold M, Hayward N (1995) Exclusion of the 13-kDa rapamycin binding protein gene (FKBP2) as a candidate gene for multiple endocrine neoplasia type 1. Hum Genet 95:455– 458 Hastbacka J, Chapelle A de la, Kaitila I, Sistonen P, Weaver A, Lander E (1992) Linkage disequilibrium mapping in isolated founder populations: diastrophic dysplasia in Finland. Nat Genet 2:204–211 Hastbacka J, Chapelle A de la, Mahtani MM, Sistonen P, Clines G, Reeves-Daly MP, Daly M, Hamilton BA, et al (1994) The diastrophic dysplasia gene encodes a novel sulfate transporter: positional cloning by fine-structure linkage disequilibrium mapping. Cell 72:971–983 Kas K, Weber G, Merregaert J, Michiels L, Sandelin K, Skogseid B, Thompson N, Nordenskjold M, Larsson C, Friedman E (1993) Exclusion of FAU as the multiple endocrine neoplasia type 1 (MEN1) gene. Hum Mol Genet 2:349–353 Kerem B, Rommens JM, Buchanan JA, Markiewicz D, Cox TK, Chakravarti A, et al (1989) Identification of the cystic fibrosis gene: genetic analysis. Science 245:1073–1080 Larsson C, Skogseid B, Oberg K, Nakamura Y, Nordenskjold M (1988) Multiple endocrine neoplasia type 1 gene maps to chromosome 11 and is lost in insulinoma. Nature 332:85–87 Lerner TJ, Boustany RM, MacCormack K, Gleitsman J, Schlumpf K, Breakefield XO, Gusella JF, Haines JL (1994) Linkage disequilibrium between the juvenile neuronal ceroid lipofuscinosis gene and marker loci on chromosome 16p12.1. Am J Hum Genet 54:88–94 Lloyd SE, Pang JT, Pearce SHS, Leigh SEA, Thakker RV (1997) Exclusion of ZFM1 as a candidate for multiple endocrine neoplasia type 1. Hum Genet 99:585–589 Nikali K, Suomalainen A, Terwilliger J, Koskinen T, Weissenbach J, Peltonen L (1995) Random search for shared chromosomal regions in four affected individuals: the assignment of a new hereditary ataxia locus. Am J Hum Genet 56:1088–1095 Pang JT, Lloyd SE, Wooding C, Farren B, Pottinger B, Harding B, Leigh SEA, Pook MA, Benham FJ, Gillett GT, Taggart RT, Thakker RV (1996) Genetic mapping studies of 40 loci and 23 cosmids in the chromosome 11p13-11q13, and exclusion of µcalpain as the multiple endocrine neoplasia type 1 gene. Hum Genet 97:732–741 Petty EM, Green JS, Marx SJ, Taggart RT, Farid N, Bale AE (1994) Mapping the gene for hereditary hyperparathyroidism and prolactinoma (MEN1Burin) to chromosome 11q: evidence for a founder effect in patients from Newfoundland. Am J Hum Genet 54:1060–1066 Pritchard LE, Kawaguchi Y, Reed PW, Copeman JB, Davies JL, Barnett AH, Bain SC, Todd JA (1995) Analysis of the CD3 gene region and type 1 diabetes: application of fluorescencebased technology to linkage disequilibrium mapping. Hum Mol Genet 4:197–202 Pook MA, Thakrar R., Pottinger B, Harding B, Porteous D, Heyningen V van, Cowell J, Jones C, Povey S, Davies KE, Thakker RV (1996). EagI and NotI linking clones from human chromosomes 11 and Xp. Hum Genet 97:742–749 Raha Chowdhury R, Bowen DJ, Stone C, Pointon JJ, Terwilliger JD, Shearman JD, Robson KJ, Bomford A, Worwood M (1995) New polymorphic microsatellite markers place the haemochromatosis gene telomeric to D6S105. Hum Mol Genet 4:1869– 1874

665 Slatkin M (1994) Linkage disequilibrium in growing and stable populations. Genetics 137:331–336 Snarey A, Thomas S, Schneider MC, Pound SE, Barton N, Wright AF, Somlo S, Germino GG, Harris PC, Reeders ST, et al (1994) Linkage disequilibrium in the region of the autosomal dominant polycystic kidney disease gene (PKD1). Am J Hum Genet 55:365–371 Teh BT, Hii SI, David R, Parameswaran V, Grimmond S, Walters MK, Tan TT, Nancarrow DJ, Chan SP, Mennon J, et al (1994) Multiple endocrine neoplasia type 1 (MEN1) in two Asian families. Hum Genet 94:468–472 Terwilliger JD (1995) A powerful likelihood method for the analysis of linkage disequilibrium between trait loci and one or more polymorphic marker loci. Am J Hum Genet 56:777–787 Thakker RV, Ponder BA (1988) Multiple endocrine neoplasia. Baillieres Clin Endocrinol Metab 2:1031–1067

Thakker RV, Bouloux P, Wooding C, Chotai K, Broad PM, Spurr NK, Besser GM, O’Riordan JL (1989) Association of parathyroid tumors in multiple endocrine neoplasia type 1 with loss of alleles on chromosome 11. N Engl J Med 321:218–224 Trump D, Farren B, Wooding C, Pang JT, Besser GM, Buchanan KD, Edwards CR, et al (1996) Clinical studies of multiple endocrine neoplasia type 1 (MEN1). Q J Med 89:653–669 Weber G, Grimmond S, Lagercrautz, Friedman E, Phelan C, Carson E, Hayward N, et al (1997) Exclusion of the phosphoinositol-specific phospholipase Cb3 (PLCb3) gene as a candidate for multiple endocrine neoplasia type 1 (MEN1). Hum Genet 99:130–132 Weeks DE, Lathrop GM (1995) Polygenic disease: methods for mapping complex disease traits. Trends Genet 11:513–519