Immunogenetics (2002) 54:599–603 DOI 10.1007/s00251-002-0501-5
B R I E F C O M M U N I C AT I O N
Jeffrey B. Smith · David J. Wadleigh · Yu-Rong Xia Rebecca A. Mar · Harvey R. Herschman Aldons J. Lusis
Cloning and genomic localization of the murine LPS-induced CXC chemokine (LIX) gene, Scyb5 Received: 28 May 2002 / Revised: 19 August 2002 / Published online: 1 October 2002 © Springer-Verlag 2002
Abstract LPS-induced CXC chemokine (LIX) is a murine chemokine similar to two human chemokines, ENA-78 (CXCL5) and GCP-2 (CXCL6). To clarify the relationship of LIX to human ENA-78 and GCP-2, we cloned and mapped the LIX gene. The organization of the LIX gene (Scyb5) is similar to those of the human ENA-78 (SCYB5) and GCP-2 (SCYB6) genes. The intron-exon boundaries of the three genes are exactly conserved, and the introns have similar sizes. The first 100 bp of the 5′ flanking regions are highly similar, with conserved NF-κB and GATA sites in identical positions in all three genes. Further 5′, the Lix flanking region sequence diverges from those of ENA-78 and GCP-2, which remain highly similar for 350 bp preceding the start sites. Using a (C57BL/6 J × Mus spretus) F1 × C57BL/6J backcross panel, Lix was mapped to a locus near D5Ucla5 at 49.0 cM on Chromosome (Chr) 5. Mapping with the T31 radiation hybrid panel placed Lix between D5Mit360 and D5Mit6. Physical maps of the CXC chemokine clusters on murine Chr 5 and human Chr 21 were constructed using the Celera mouse genome database and the public human genome database. The sequence and mapping data suggest that the human J.B. Smith (✉) Pediatrics/Neonatology B2–325, MDCC, David Geffen School of Medicine and Mattel Children’s Hospital at UCLA, 10833 Le Conte Avenue, Los Angeles, CA 90095–1752, USA e-mail:
[email protected] Tel.: +1-310-2067632, Fax: +1-310-2670154 D.J. Wadleigh · H.R. Herschman Biological Chemistry, David Geffen School of Medicine at UCLA, University of California, Los Angeles, CA 90095, USA Y.-R. Xia · R.A. Mar · A.J. Lusis Human Genetics, David Geffen School of Medicine at UCLA, University of California, Los Angeles, CA 90095, USA H.R. Herschman Molecular and Medical Pharmacology, and Molecular Biology Institute, David Geffen School of Medicine at UCLA, University of California, Los Angeles, CA 90095, USA
ENA78-PBP-PF4 and GCP2-ψPBP-PF4V1 loci arose from an evolutionarily recent duplication of an ancestral locus related to the murine Lix-Pbp-Pf4 locus. Keywords Chemokines · Scyb5 · SCYB6 · Mouse · Human The chemokines are a large family of cytokines with diverse roles in leukocyte trafficking and other processes (Luster 1998; Mackay 2001; Zlotnik and Yoshie 2000). Based on the spacing and number of conserved cysteines, they are divided into four subfamilies, designated CXC, CC, CX3C, and C. The CXC chemokines contain one residue (X) between the first two conserved cysteines. An important subset of CXC chemokines contains glutamateleucine-arginine (ELR) immediately preceding the first conserved cysteine. The ELR+CXC chemokines are chemotactic for neutrophils. In humans, seven ELR+CXC chemokines have been described: MGSA/GRO-α, GROβ, GRO-γ, ENA-78, GCP-2, IL-8, and NAP-2 (Table 1). NAP-2 is a processed form of the product of the platelet basic protein gene (PBP). The seven ELR+CXC chemokines are clustered on Chr 21q12–13. This region also contains several CXC chemokines lacking the ELR motif, including platelet factor 4 and the interferon-inducible chemokines MIG, IP10, and I-TAC (Table 1). All seven of the human ELR+CXC chemokines induce neutrophil chemotaxis via the chemokine receptor CXCR2. In addition, IL-8 and GCP-2, but not the other ELR+CXC chemokines, activate the receptor CXCR1, which is also expressed on neutrophils (Baggiolini et al. 1994, 1997; Wuyts et al. 1997). It is not known whether individual neutrophil-chemoattractant chemokines have distinct functions in vivo. Studies of ELR+CXC chemokines in animal models may help to elucidate the roles of specific chemokines. However, the relevance of animal models for understanding human chemokines depends, in part, on the extent to which their structures and functions have been conserved in evolution. Unfortunately, evolutionary relationships among mouse and human
600 Table 1 Selected murine and human CXC chemokines. The first column indicates the proposed systematic chemokine designation (Zlotnik and Yoshie 2000). Approved gene symbols are in italics. Murine chemokines CXCL1 CXCL2 CXCL3 CXCL4 CXCL5 CXCL6 CXCL7 CXCL8 CXCL9 CXCL10 CXCL11 CXCL15
Absence of a mouse or human chemokine is indicated by a minus sign (see text) Human chemokines
Growth related oncogene-1 or KC, Scyb1
Growth related oncogene(GRO)-α or melanocyte growth stimulating activity (MGSA)-α, SCYB1 Macrophage inflammatory protein–2, Scyb2 GRO-β/MGSA-β, SCYB2 – GRO-γ/MGSA-γ, SCYB3 Platelet factor 4, Pf4 Platelet factor 4 (PF4), SCYB4 LPS-induced CXC chemokine (LIX), Scyb5 Epithelial cell-derived neutrophil activating peptide-78 (ENA-78), SCYB5 – Granulocyte chemotactic protein-2 (GCP–2), SCYB6 Platelet basic protein (Pbp), Scyb7 Neutrophil activating peptide-2 (NAP-2), derived from platelet basic protein (PBP), SCYB7 – Interleukin-8 (IL-8), SCYB8 Monokine induced by gamma-interferon (Mig), Scyb9 Monokine induced by gamma-interferon (MIG), SCYB9 Interferon-inducible protein 10 (Ip10), Scyb10 Interferon-inducible protein 10 (IP10), SCYB10 Interferon-inducible T cell α chemoattractant (Itac), Scyb11 Interferon-inducible T cell α chemoattractant (I-TAC or ITAC), Scyb11 Lungkine, Scyb15 –
ELR+CXC chemokines are not straightforward (Nomiyama et al. 2001; Smith et al. 1997). In mice, only four neutrophil chemoattractant ELR+CXC chemokines have been identified: KC, MIP-2, LIX, and lungkine (Ohneda et al. 2000; Rossi et al. 1999) (Table 1). The murine platelet basic protein gene has been cloned (Zhang et al. 2001), but it has not yet been determined whether murine PBP is processed to a neutrophil-chemoattractant form similar to human NAP-2. No chemokine corresponding to human IL-8 has been identified in mice, and no chemokine corresponding to murine lungkine has been identified in humans (Nomiyama et al. 2001). Murine KC and MIP-2 are related as a group to the three human MGSA/GRO genes, but Kc and Mip-2 have greater sequence similarity to each other than to any of the three highly similar human GRO genes (Hughes and Yeager 1999). LIX, whose cDNA was cloned as an LPS-induced glucocorticoid-attenuated response gene (Smith and Herschman 1995) has also been referred to as murine GCP-2 (Wuyts et al. 1996). However, the degree of similarity between the LIX and human GCP-2 proteins is not significantly greater than the similarity between LIX and human ENA-78. A comparison of the human ENA78 and GCP2 sequences suggested that these genes may be the result of an evolutionarily recent duplication (Rovai et al. 1997; Smith et al. 1997). To attempt to clarify the relationship of LIX to human ENA-78 and GCP-2, we cloned and mapped the gene encoding murine LIX. A 129 Sv murine genomic library (Stratagene) was screened using α32P-labeled probes containing base pairs 32–425 and 930–1115 of the Lix cDNA (GenBank accession no. U27267). A 13 kb phage insert hybridizing with both probes contained the complete gene. The sequence of a 2.4 kb segment containing 879 bp of 5′-flanking region and the complete coding region was submitted to the DDBJ/EMBL/GenBank databases, and is available under accession number
AY100019. The transcribed portions of the gene are identical to the Lix cDNA (cloned from Swiss Webster mice) except for two single nucleotide differences within the signal peptide coding region in exon 1. These sequence differences presumably represent strain polymorphisms. The Lix gene has four exons and three introns, the sizes of which are similar to those of human ENA78 and GCP2 (Fig. 1a). While intron sequences in ENA78 and GCP2 are highly conserved (Rovai et al. 1997), the Lix introns do not have significant similarity to the introns of either human gene (not shown). However, the positions and nucleotides at the exon-intron boundaries of the three genes are exactly conserved (not shown). For the first 100 bp, the 5′-flanking regions of LIX, ENA78, and GCP2 are highly similar (Fig. 1b). This region contains conserved NF-κB and GATA sites in identical positions in all three genes. Similarity between the Lix 5′-flanking region and those of ENA78 and GCP2 remains detectable for the next 100 bp, and is then lost (Fig. 1b). However, the GCP2 and ENA78 5′-flanking regions remain highly similar for 350 bp from the start sites (Rovai et al. 1997). A truncated LINE1 retrotransposon sequence extends upstream from that point of the GCP2 5′-flanking region, but not the ENA78 5′-flanking region (Rovai et al. 1997). The corresponding portion of the Lix 5′-flanking region does not contain a retrotransposon sequence. Genetic mapping of Lix was performed by hybridizing Southern blots of DNA from 67 progeny derived from a [(C57BL/6 J × Mus spretus) F1 x C57BL/6 J] interspecific backcross (Warden et al. 1993) with an α-32P-labeled fragment of the Lix 3′-untranslated region. The 390 bp fragment was obtained by digesting the LIX/Garg-8 plasmid (Smith and Herschman 1995) with AccI and XhoI. Linkage analysis placed the Lix gene near D5Ucla5 at 49.0 cM on Chr 5 (Fig. 2a). In contrast, a previous linkage analysis indicated that Lix was at a site indistinguishable from Mig and Ip10 at 53.0 cM, about 2.2 cM distal to Gro1 and Mip2 (Modi et al. 1998).
601
Fig. 1a, b Genomic organization of the murine Lix gene in comparison with the human ENA78 and GCP2 genes. a Intron-exon structures. The number of nucleotides in the 5′-untranslated regions (white boxes) and coding regions (black boxes) of exons 1–4 are indicated above each gene. The initial portions of the 3′-untranslated regions are indicated by dashed lines. The number of nucleotides in each intron is in italics below the gene. b Alignment of the first 200 bp of the 5′ flanking regions. Nucleotides in Lix and GCP2 identical to those in ENA78 at the same position are indicated by dots. Consensus binding sites identical in the three genes, or common to ENA78 and GCP2 but not Lix, are indicated by boxes
Because of the difference between our linkage results and those of Modi et al. (1998), we proceeded to map Lix with the T31 radiation hybrid panel, using Lix primers GACCCCAGTGAAGAGAAGAAAGG and CACACCCAAGAAACAACAGTAAAAG. The amplification conditions were as described (Widney et al. 2000). All data were submitted to the Jackson Laboratory Mouse Radiation Hybrid Database (http://www.jax.org/ resources/documents/cmdata/). The radiation hybrid analysis placed Lix near Mip 2 and about 21 cRay proximal to Itac (Fig. 2b). In agreement with our linkage results, this suggests that Lix is not close to Mig and Ip10, which are tightly linked to Itac (Erdel et al. 2001). The recent availability of the Celera mouse genome sequence allowed us to compare the linkage and radiation hybrid mapping results with a precise physical map determined by BLAST searching the Celera database with known murine CXC chemokine cDNAs. In agreement with the radiation hybrid data, (Fig. 2b) Lix is located between the D5Mit272 and D5Mit205 markers. All the ELR+CXC chemokines are contained within a 140 kb subcluster between the α-fetoprotein gene (Afp) and D5Mit360 (Fig. 3a). Consistent with our linkage and radiation hybrid data, Lix is the most proximal member of this subcluster, starting at chromosome position 86,332,563 bp.
Fig. 2a, b Genetic and radiation hybrid mapping of Lix (Scyb5) to mouse Chr 5. a Genetic mapping. The chromosome is drawn to scale with the centromere at the top. For each pair of loci, the ratios of the number of recombinants to the total number of informative mice and the recombination frequencies ± standard errors (in centiMorgans, cM) are indicated to the left of the chromosome. Loci are linked with lod scores greater than 5.6. Distances of previously mapped loci, in cM from the centromere, are in parentheses. UCLA markers were reported previously (Warden et al. 1993) or are unpublished data. References for other linked loci can be obtained from the Mouse Genome Database (http://www.informatics.jax.org/). b Radiation hybrid mapping. Distances between markers (in cRay) are shown to the left of the chromosome. The scale for the lower part of the figure (thin line) is compressed twofold compared to the upper part. Note: The Scyb1 results did not fit well with the rest of the data, and were not used in calculating the distances
Fig. 3a, b Physical maps of murine and human CXC chemokines. a Murine Chr 5 from D5Mit272 proximally to D5Mit205 distally, based on the Celera mouse genome assembly. Only the Scyb genes and selected additional loci are shown. Afp α-fetoprotein. b Human Chr 21 from AFP (α-fetoprotein) proximally through SCYB9 distally, from the public human genome project data. The murine and human maps are drawn to the same two scales. Distances are in kb, measured from the centromeric end of each gene. The direction of transcription of each gene is shown by an arrowhead. The murine Lix-Pbp-Pf4 locus is indicated by an asterisk. The duplicated human ENA78-PBP-PF4 and GCP2-ΨPBP-PF4V1 loci are indicated by double asterisks
602
Lix is closely linked to Pbp and Pf4, which start 9 and 13 kb from the Lix start site, respectively, as recently described by Zhang et al. (2001). Mig, Ip10, and Itac are clustered in a 40 kb locus located 1.4 Mb telomeric to the subcluster containing the ELR+CXC chemokines, confirming the close linkage and head-to-tail gene order of the Mig-Ip10-Itac locus recently determined by fiberfluorescence in situ hybridization (Erdel et al. 2001). The Celera physical map data are in agreement with the gene order of the murine ELR+CXC chemokines indicated by a previous analysis of BAC clones (Nomiyama et al. 2001), but provide for the first time the precise spacing of the genes. For comparison with the mouse map, a physical map of the human ELR+CXC chemokine cluster on Chr 21 was constructed using the public human genome project data (Fig. 3b). The CXC chemokine genes shown were located within a finished contig (GenBank accession no. NT_006216.7) covering 1.45 Mb of continuous sequence. As in the mouse, the chemokine cluster is located distal to the α-fetoprotein gene (AFP), and falls in two subclusters (Fig. 3b). The proximal subcluster contains all the ELR+CXC chemokines, plus PBP and PF4. In the human genome, this group begins with SCYB8/IL8, which has no murine counterpart, and extends over 526 kb, a much larger region than the 140 kb mouse subcluster. The three closely-related human GRO genes are widely separated within this region. ENA78 is closely linked to PBP and PF4 in a locus highly similar to the murine Lix-Pbp-Pf4 locus, as recently described (Zhang et al. 2001). While the Lix-Pbp-Pf4 locus is unique in the mouse, the human genome contains a second, highly similar locus containing GCP2, ψPBP, and PF4V/ PF4alt. The ψPBP and PF4V1 genes are closely related to PBP and PF4. The orientation and spacing within the GCP2-ψPBP-PF4V1 locus is nearly identical to those of murine Lix-Pbp-Pf4 and human ENA78-PBP-PF4 (Fig. 3a,b). As in the murine genome, MIG is located 1.3 Mb distal to the proximal CXC chemokine cluster. MIG is at the end of NT_006216.7, and the assembly does not contain IP10 or ITAC. However, other work has shown that MIG, IP10, and ITAC are closely linked, with the same relative orientation and similar spacing as the mouse locus (Erdel et al. 2001; Lee and Farber 1996; O’Donovan et al. 1999). The physical map constructed from the public human genome data (Fig. 3b) clarifies the gene order of the chemokines in this region and provides the precise spacing of the genes. The gene orders suggested in previous mapping studies have varied significantly. O’Donovan et al. (1999) identified IL8 as the most proximal member of the ELR+CXC chemokine subcluster, in agreement with the human genome data, but placed ENA78 and GCP2 together within a 25 kb fragment. In the human genome data (Fig. 3b) the ENA78 and GCP2 start sites are separated by 228 kb. In contrast, the study of Nomiyama et al. (2001) placed IL8 distal to all the other ELR+CXC chemokines, and also suggested that the ELR+CXC che-
mokine subcluster contained two large direct repeats consisting of GRO2-GRO3-ENA78-PBP-PF4 and ψGRO-GRO1-GCP2-ψPBP-PF4V1. (ψGRO is a GROrelated pseudogene). This suggestion is not supported by the locations of the GRO genes in the human genome assembly data (Fig. 3b). Instead, the human GRO genes appear to have been subjected to duplication and translocation events separate from those that produced the duplicated ENA78-PBP-PF4 and GCP2-ψPBP-PF4V1 loci. The similarities of the sequences and spacing of the murine Lix-Pbp-Pf4 and human ENA78-PBP-PF4 loci, and the similarities of duplicated human PBP-PF4 and ψPBP/PF4V1 loci have been reported previously (Zhang et al. 2001). Our study is the first to note the close physical linkage of GCP2 to ψPBP-SCYB4V1 as part of the duplicated locus. To date, Homo sapiens is the only species in which duplication of the SCY5/PBP/PF4 locus has been described. The absence of a duplicated Scy5/Pbp/Pf4 locus in the mouse is supported by Southern blot analyses (Zhang et al. 2001; J.B. Smith, unpublished data) as well as the genome assembly data. Future sequencing of the CXC chemokine clusters in other primates should provide further information about the evolutionary timing of this event. In summary, we cloned and mapped the murine Lix/Scyb5 gene, and constructed precise physical maps of the murine and human ELR+CXC chemokine clusters using genome sequence data. Sequence comparisons of Lix with human ENA78 and GCP2 confirm that ENA78 and GCP2 are more closely related to each other than to Lix in non-coding as well as coding regions. The physical maps provide new data that define the gene order and precise spacing of the murine and human CXC chemokines, and provide additional support for the concept that multiple duplication, loss, and translocation events involving the ELR+CXC chemokine region have occurred at different times during mammalian evolution. Taken together, the sequence and mapping data suggest that the human ENA78-PBP-PF4 and GCP2-ψPBP-PF4V1 loci arose from an evolutionarily recent duplication of an ancestral locus corresponding to murine Lix-Pbp-Pf4. Acknowledgements This work was conducted in compliance with the current laws of the United States, and was supported, in part, by National Institutes of Health grants HL57008 (to J.B.S.), HL30568 (to A.J.L.) and the Laubisch Fund, UCLA (to A.J.L.).
References Baggiolini M, Dewald B, Moser B (1994) Interleukin-8 and related chemotactic cytokines–CXC and CC chemokines. Adv Immunol 55:97–179 Baggiolini M, Dewald B, and Moser B (1997) Human chemokines: an update. Annu Rev Immunol 15:675–705 Erdel M, Theurl M, Meyer M, Duba HC, Utermann G, WernerFelmayer G (2001) High-resolution mapping of the human 4q21 and the mouse 5E3 SCYB chemokine cluster by fiberfluorescence in situ hybridization. Immunogenetics 53:611–615 Hughes AL, Yeager M (1999) Coevolution of the mammalian chemokines and their receptors. Immunogenetics 49:115–124
603 Lee HH, Farber JM (1996) Localization of the gene for the human MIG cytokine on chromosome 4q21 adjacent to INP10 reveals a chemokine “mini-cluster”. Cytogenet Cell Genet 74:255–258 Luster AD (1998) Chemokines–chemotactic cytokines that mediate inflammation. N Engl J Med 338:436–445 Mackay CR (2001) Chemokines: immunology′s high impact factors. Nat Immunol 2:95–101 Modi WS, Amarante MR, Hanson M, Womack JE, Chidambaram A (1998) Assignment of the mouse and cow CXC chemokine genes. Cytogenet Cell Genet 81:213–216 Nomiyama H, Mera A, Ohneda O, Miura R, Suda T, Yoshie O (2001) Organization of the chemokine genes in the human and mouse major clusters of CC and CXC chemokines: diversification between the two species. Genes Immun 2:110–113 O’Donovan N, Galvin M, Morgan JG (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet Cell Genet 84:39–42 Ohneda O, Ohneda K, Nomiyama H, Zheng Z, Gold SA, Arai F, Miyamoto T, Taillon BE, McIndoe RA, Shimkets RA, Lewin DA, Suda T, Lasky LA (2000) WECHE: a novel hematopoietic regulatory factor. Immunity 12:141–150 Rossi DL, Hurst SD, Xu Y, Wang W, Menon S, Coffman RL, Zlotnik A (1999) Lungkine, a novel CXC chemokine, specifically expressed by lung bronchoepithelial cells. J Immunol 162:5490–5497 Rovai LE, Herschman HR, Smith JB (1997) Cloning and characterization of the human granulocyte chemotactic protein-2 gene. J Immunol 158:5257–5266 Smith JB, Herschman HR (1995) Glucocorticoid-attenuated response genes encode intercellular mediators, including a new C-X-C chemokine. J Biol Chem 270:16756–16765
Smith JB, Rovai LE, Herschman HR (1997) Sequence similarities of a subgroup of CXC chemokines related to murine LIX: implications for the interpretation of evolutionary relationships among chemokines. J Leukoc Biol 62:598–603 Warden CH, Mehrabian M, He KY, Yoon MY, Diep A, Xia YR, Wen PZ, Svenson KL, Sparkes RS, Lusis AJ (1993) Linkage mapping of 40 randomly isolated liver cDNA clones in the mouse. Genomics 18:295–307 Widney DP, Xia YR, Lusis AJ, Smith JB (2000) The murine chemokine CXCL11 (IFN-inducible T cell alpha chemoattractant) is an IFN-gamma- and lipopolysaccharide-inducible glucocorticoid-attenuated response gene expressed in lung and other tissues during endotoxemia. J Immunol 164:6322–6331 Wuyts A, Haelens A, Proost P, Lenaerts JP, Conings R, Opdenakker G, Van Damme J (1996) Identification of mouse granulocyte chemotactic protein-2 from fibroblasts and epithelial cells. Functional comparison with natural KC and macrophage inflammatory protein-2. J Immunol 157:1736–1743 Wuyts A, Van Osselaer N, Haelens A, Samson I, Herdewijn P, Ben-Baruch A, Oppenheim JJ, Proost P, Van Damme J (1997) Characterization of synthetic human granulocyte chemotactic protein 2: usage of chemokine receptors CXCR1 and CXCR2 and in vivo inflammatory properties. Biochemistry 36: 2716–2723 Zhang C, Thornton MA, Kowalska MA, Sachis BS, Feldman M, Poncz M, McKenzie SE, Reilly MP (2001) Localization of distal regulatory domains in the megakaryocyte-specific platelet basic protein/platelet factor 4 gene locus. Blood 98:610–617 Zlotnik A, Yoshie O (2000) Chemokines: a new classification system and their role in immunity. Immunity 12:121–127
