Localization of QTLs and candidate genes involved in the regulation of ...

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 253

Localization of QTLs and candidate genes involved in the regulation of frost resistance in cereals GÁBOR GALIBA1, NICOLA PECCHIONI3, ATTILA VÁGÚJFALVI1, ENRICO FRANCIA2, BALÁZS TÓTH1, DELFINA BARABASCHI 3, SAMANTHA BARILLI2, CRISTINA CROSATTI2, LUIGI CATTIVELLI2 * AND MICHELE A. STANCA2 1

Agricultural Research Institute of the Hungarian Academy of Sciences, Martonvásár, Hungary 2

Experimental Institute for Cereal Research, Via S.Protaso 302, 29017 Fiorenzuola d’Arda (PC), Italy

3

University of Modena and Reggio Emilia, Faculty of Agricultural Science, Via Kennedy 17, 42100 Reggio Emilia, Italy *Corresponding author: [email protected]

Abstract The recent advances in the molecular investigation of the stress response have led to the identification of a great number of genes whose expression is associated to cold acclimation. In the model species Arabidopsis thaliana, a crucial role in the regulation of the gene set involved in cold tolerance has been clearly demonstrated for a family of transcription factors named C-repeat binding factor (CBF). Genes similar to the Arabidopsis CBF genes were identified in the EST databases of many crop species including barley and wheat. In Triticeae, CBF is a multigene family with more than six members per genome and most of the CBF-cereal homologous sequences are clustered together on the long arm of chromosome 5. On the other hand, parallel genetic studies have identified several major genes and QTLs responsible for frost resistance or for components associated to frost resistance on each member of the 5th homoeologous chromosome of Triticeae. Soon after the discovery of the CBF transcription factors it was suggested that the CBF-cereal homologous genes might represent candidate genes for the loci controlling stress tolerance in cereals. Recent findings have demonstrated that the cereal CBF locus cosegregates with one of the two major QTLs for frost tolerance in barley and einkorn. This result represents one of the best successful examples of candidate gene approach for unraveling a complex phenotype such as the tolerance to abiotic stress.

Tuberosa R., Phillips R.L., Gale M. (eds.), Proceedings of the International Congress “In the Wake of the Double Helix: From the Green Revolution to the Gene Revolution”, 27-31 May 2003, Bologna, Italy, 253-266, ©2005 Avenue media, Bologna, Italy.

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 254

GALIBA ET AL.

Introduction To achieve a full frost resistance the winter cereals must undergo an acclimation process called “hardening”. The same conditions, essential for vernalization of winter genotypes, promote the hardening process in both spring and winter types. Temperatures of 2-5 ºC and photoperiods of about 12 h are considered to be optimal for cold hardening, although temperatures below 0 ºC may induce a second phase in the hardening process leading to the maximal expression of freezing resistance (Levitt 1980). The exposure of plants to low temperature promotes a number of physiological and molecular reactions that depend, in the initial phases, on a complex cascade of stress signal transduction in which only a few regulatory genes control many downstream events that contribute to stress tolerance as a whole. The transduction of the stress signal is based on the action of second messengers (calcium, inositol 1,4,5-trisphosphate -IP3-, cyclic ADP-ribose -cADPR-, ABA) and kinases (e.g. MAP kinases). These processes lead to the activation of several transcription factors able to drive the expression of hundreds of cold regulated (cor) genes whose products lead to frost tolerance (Shinozaki and Yamaguchi-Shinozaki 2000; Cattivelli et al. 2002). A fundamental priority in understanding the molecular basis of the plant stress response concerns the identification of regulatory genes which can be used as a target for biotechnological applications. In the model species Arabidopsis thaliana, a crucial role in the regulation of the gene set involved in cold tolerance has been clearly demonstrated for a family of transcription factors called C-repeat binding factors (CBFs). CBFs (also known as DREB1s) have been shown to increase freezing tolerance when over-expressed in transgenic plants (Jaglo-Ottosen et al. 1998; Liu et al. 1998). The evidence that some molecular mechanisms involved in stress tolerance are conserved between species also phylogenetically distant, and the availability of a vast amount of genetic information in the public database, supply the scientific community with powerful tools for comparative genomics and for the transfer of knowledge from model species to crops. As a consequence, CBF-like sequences have been isolated on the basis of homology with Arabidopsis counterparts in different species including cereals such as barley, maize and wheat (Jaglo et al. 2001; Choi et al. 2002; van Buuren et al. 2002; Xue 2002). Beside CBFs, other transcription factors were also found to be involved in the control of the cold response. The existence of CBF-parallel pathways involved in cold-acclimation was supported by transcriptional profiling as well as by direct cloning of other regulatory sequences. When the microarray technology was used to dissect the molecular response to cold, several other genes coding for putative transcription factors were induced/repressed during cold acclimation in Arabidopsis (Kreps et al. 2002; Seki et al. 2002). The expression analysis of transgenic plants over-expressing each of the three members of the CBF family provided additional evi254

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 255

GALIBA ET AL.

dence for CBF-independent pathways involved in cold response (Fowler and Thomashow 2002). Osmyb4 is a rice MYB transcription factor induced during exposure to low temperature. When the Osmyb4 gene was over-expressed in Arabidopsis, the transgenic plants showed a significant increase in frost tolerance and a constitutive expression of many genes associated with the cold response (Vannini et al. 2004). The recent advances in the molecular investigation of the stress response, particularly after the recent development of the array technology, have led to the identification of a great number of genes whose expression is associated to cold acclimation. On the other hand, parallel genetic studies have identified several loci responsible for frost resistance or for components associated to frost resistance (Cattivelli et al. 2002). The challenge of the future is to understand the relationship between resistance loci and the expression of stress-responsive genes.

The candidate gene approach Although the first attempts in plants seldom turned out successfully, the candidate gene (CG) approach has been pursued in the last ten years, in association with linkage genetics with the aim of characterizing and cloning Mendelian genes and QTLs responsible of key agronomical traits (Pflieger et al. 2001). Conceptually, the CG approach is an alternative to the direct fine mapping/positional cloning approach of a gene known only by linkage to a given phenotype. In fact, even if in recent years Mendelian genes are being cloned by position in large genomes such as wheat, and QTLs in relatively small genomes such as tomato and rice (Fridman et al. 2000; Yano et al. 2000; Feuillet et al. 2003), the CG approach can represent a significant shortcut. The challenge is to demonstrate the perfect co-segregation of a CG with a locus responsible for the trait of interest by means of either linkage mapping or linkage disequilibrium studies. The CGs can be divided into “functional candidates” and “positional candidates” (de Vienne 1999). When functional CGs are used, sequences known to control key metabolisms potentially involved in the exploitation of a given trait are used as candidates to dissect the genetic basis of the trait itself. A first successful example of functional CG approach is the maize gene p1, a transcription activator for part of the flavonoid pathway leading to the biosynthesis of maysin. The p1 locus perfectly cosegregates with a resistance QTL to Helicoverpa zeae (Byrne et al. 1996). In recent years, several other examples have been reported, e.g. several genes coding for enzymes of the lipid metabolism were found to cosegregate with QTLs for the oil and fatty acid contents (Kianian et al. 1999; Pèrez-Vich et al. 2002). A first important case of positional CG approach in plants concerns the gene CO (CONSTANS) of Arabidopsis and two QTLs for early flowering in Brassica nigra (allotetraploid). By using the Arabidopsis/B. nigra synteny, Lagercrantz et al. (1996) discovered a posteriori that CO mapped in the model plant at the precise colinear position of the flowering QTLs found in B. nigra. 255

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 256

GALIBA ET AL.

Since the genomes of two model plants (Arabidopsis and rice) have been sequenced (The Arabidopsis Genome Initiative 2000; Goff et al. 2002; Yu et al. 2002), virtually the entire sequence of a genomic region underlying a QTL is a “positional candidate genomic sequence”, and this could greatly accelerate both the discovery and validation of CGs for many QTLs. This “candidate sequence” strategy might also overtake in efficiency the insertional mutagenesis approaches for cloning those genes that have either an unresolved or a lethal phenotype. Ishimaru et al. (2004), by means of the annotation data of the 155-164 cM region on chromosome 1 encompassing a QTL for plant height in rice, were able to select, among 64 possible CGs, the SPS gene encoding a sucrose phosphate synthase as the one responsible for the trait. Soon after the discovery of the Arabidopsis CBF transcription factors, an attractive hypothesis was published by Sarhan and Danyluk (1998). They suggested that the CBF-cereal homologous genes might be used in a CG approach as candidate genes for the loci controlling stress tolerance in cereals. More then six years later, part of this hypothesis has been demonstrated and now the cereal CBF sequences represent the best candidates for one of the major QTL for frost tolerance in barley (Francia et al. 2004) and einkorn (Vágújfalvi et al. 2003). These results represent one of the best successful examples of CG approach for unraveling a complex phenotype such as the tolerance to abiotic stress.

Localization of QTLs for frost resistance in wheat and barley The location of QTLs/genes controlling complex traits like freezing resistance has been possible in the last 15 years by the application of marker-mediated techniques. This was achieved by exploiting precise genetic stocks, such as doubled haploids (DHs), recombinant substitution lines (RSLs) and recombinant inbred lines (RILs), along with the comprehensive genetic maps now available.

Mapping loci for frost resistance with wheat cytogenetic stocks

Since the pioneering studies of Ernie Sears (Sears 1954), the wheat cytogenetic stocks represent an ideal tool to locate loci or traits on chromosomes or on chromosome arms. The availability of collections of inter-varietal chromosome substitution lines provided the first genetic tool to identify the wheat chromosomes carrying genes affecting frost resistance. The evaluation of frost resistance under artificial and field conditions of the 21 Chinese Spring (CS)/Cheyenne (CNN) chromosome substitution lines have identified the chromosomes of the 5th homoeologous group together with the 2B and 4B chromosomes as those carrying important loci influencing frost tolerance (Sutka 1981; Sutka and Snape 1989). Vernalization requirement (Vrn) and frost resistance (Fr) have always been considered as two highly associated traits. Using the mapping population developed 256

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 257

GALIBA ET AL.

from the cross between the chromosome substitution line CS/T. spelta 5A (frost-sensitive, vernalization-insensitive) and the chromosome substitution line CS/CNN 5A (frost-resistant, vernalization-sensitive) a more precise mapping of Vrn and Fr was achieved. The Vrn-A1 and Fr-A1 loci were located closely linked on the distal portion of the long arm of 5A and a recombination event was found between them (Galiba et al. 1995). Sutka et al. (1999) gave further support to the hypothesis of linkage between the two loci rather than pleiotropy of Vrn-A1 on frost resistance, demonstrating by means of homozygous deletion lines for chromosome 5AL, that the Vrn-A1 and Fr-A1 loci are physically separated in wheat. More recently, the corresponding Vrn and Fr genes on the long arm of 5D and 5B chromosomes were also mapped (Snape et al. 1997; Tóth et al. 2003). When comparative maps for the long arm of chromosomes 5A, 5B and 5D were produced, the comparison of a set of common markers suggested that Fr-A1, Fr-D1 and Fr-B1 genes could be orthologous (Snape et al. 2001; Tóth et al. 2003).

Mapping QTLs for frost resistance in barley

Genetic analysis of frost resistance in barley was mainly achieved by using double haploid populations deriving from crosses between winter frost resistant and spring frost susceptible cultivars. A major QTL associated with the field winter survival of barley was mapped onto chromosome 5H (Hayes et al. 1993; Pan et al. 1994); the largest QTL effect was detected in an unresolved 21 cM interval on the long arm. This interval comprises the homoeologous region carrying the Vrn-A1 and Fr-A1 genes of wheat chromosome 5A, on the basis of colinearity of the Xwg644 and Xcdo504 RFLP loci (Iwaki et al. 2002). So, the accepted view based on the above-cited results was that each member of the 5th homoeologous chromosome of wheat carries only one major gene affecting frost resistance and, based on the conservation of gene synteny within Triticeae, this gene was likely present in barley in orthologous position on the long arm of chromosome 5H. This “dogma” was challenged only recently using different genetic materials and when, instead of studying the survival after freezing as a trait, the amount of mRNAs and proteins of cold-regulated (cor) genes was quantified.

The cold-dependent expression of cor14b is controlled by loci located on 5A and 5H chromosomes

Among the large number of barley and wheat cor genes described in the past, cor14b (formerly pt59) is one of the most studied. Messenger RNAs corresponding to the cold-regulated gene cor14b are accumulated in barley leaves when plants are exposed to low temperature. The expression of cor14b is strictly regulated by cold (Cattivelli and Bartels 1990), although it is enhanced by light-dependent factor(s) (Crosatti et al. 1999). Further studies have demonstrated that the cor14b gene encodes for the COR14b protein, which is cold regulated and imported into the chloroplast (Crosatti et al. 1996). Much experimental evidence suggests a relation257

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 258

GALIBA ET AL.

ship between the accumulation of the COR14b protein and frost resistance. In particular, it has been demonstrated that in barley the threshold-induction temperature for COR14b protein is lower in frost-sensitive than in frost-tolerant cultivars (Crosatti et al. 1996) and, when evaluated under field conditions, winter barleys accumulated more COR14b than spring ones (Giorni et al. 1999). A gene homologous to cor14b is expressed in response to low temperature in other monocots including wheat (Cattivelli and Bartels 1990). Vágújfalvi et al. (2000) first reported on the genetic regulation of the wheat gene homologous to the barley cor14b. Among the wheat plants raised under control conditions (18/13 °C day/night) the accumulation of cor14b mRNA was observed in the leaves of frost-resistant genotypes, but not in those of frost-sensitive varieties and lines. At higher temperatures (25/18 °C) there was no detectable quantity of cor14b mRNA in any of the genotypes. At low (2 °C) temperature all the varieties accumulated cor14b mRNA to a similar extent. As experienced previously in barley, gene expression was temperature- and resistance-dependent, though the temperature threshold at which the gene became expressed was higher in wheat than in barley. This result was confirmed by the Western blot analysis of the COR14b protein, and it was followed by the mapping of the loci regulating the expression of the cor14b gene. The results showed that the 5A chromosome carries genes responsible for the sensing of the threshold temperature. In the CS genetic background at 2 °C the CNN 5A chromosome increased the amount of cor14b mRNA. At 18/13 °C the COR14b protein was only present in detectable amount in CNN and in the CS/CNN 5A chromosome substitution line, but not in CS. A chromosome substitution line developed introducing the 5A chromosome of T. spelta, an extremely frost sensitive wheat, in CS background was also impaired in the expression of Cor14b at 18/13 °C. The analysis of single chromosome recombinant lines derived from the cross between CS/T. spelta 5A and CS/CNN 5A identified two loci with additive effect which were involved in the genetic control of cor14b mRNAs accumulation. The first locus was positioned tightly linked to the RFLP marker psr911, while the second one was located between the RFLP marker Xpsr2021 and the frost resistance gene Fr-A1. The RFLP mapping of cor14b, carried out in a T. monococcum mapping population, located the gene on the long arm of the chromosome 2Am demonstrating that the different expression profile of cor14b mRNA in resistant and susceptible cultivars cannot be ascribed to allelic variations at the cor14b locus. So, although Vágújfalvi et al. (2000) were able to map two regulatory loci controlling the expression of a cor gene involved in frost resistance, only the distal one of the two loci could be initially associated with a known frost tolerant locus (Fr-A1). A further insight was achieved when a new QTL of frost resistance (designated Fr-A2) was discovered on the long arm of chromosome 5A, in a diploid wheat RIL mapping population (Vágújfalvi et al. 2003). Since the winter parental line (T. monococcum ssp. aegilopoides G3116) was significantly more frost tolerant than the spring one (T. monococcum ssp. monococcum DV92), segregation for 258

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 259

GALIBA ET AL.

frost resistance was observed among the RILs. The analysis showed a QTL with a LOD score of 8.9, the peak centred on the RFLP marker Xbcd508, explaining 49% of the variation in frost resistance; segregation was also found for cor14b mRNA accumulation and the corresponding QTL with a LOD score of 3.5 was mapped with the same peak marker (Vágújfalvi et al. 2003). Fr-A2 is a putatively bifunctional QTL controlling both the accumulation of cor14b mRNA and frost tolerance, and it is the only QTL found in the einkorn segregating population studied. This recent result is thus in apparent contrast with what previously found for frost resistance in bread wheat (Fr-A1 instead of Fr-A2; Galiba et al. 1995) or in barley (Fr-H1, colinear to Fr-A1; Pan et al. 1994) and for cor14b accumulation in bread wheat (two linked loci instead of one; Vágújfalvi et al. 2000). In fact, Fr-A2 is relatively close in terms of cM, but not colinear (being more proximal) to the Fr-A1 locus. The QTL mapping picture has been further clarified, even if not completely, by an experimental study of barley. Francia et al. (2004) found two QTLs on the long arm of chromosome 5H to determine frost tolerance in the Nure ✕ Tremois cross, with rather balanced and almost completely additive effects. By using markers in common with the einkorn and wheat maps, the authors were able to demonstrate that the two loci are colinear, respectively, to Fr-A1 and Fr-A2. For this reason these new QTLs can be referred to as Fr-H1 and Fr-H2. These latest results could suggest, as a working hypothesis, that two loci regulating frost tolerance are present in related species of Triticeae. The reason for not mapping one of the two QTLs in some of the populations examined could be due to the lack of segregation of alleles at one locus. Alternatively, also the mapping methodology (e.g. SIM vs. CIM) of linked QTLs could have led to the lack of resolution of the two loci. Considering the cor14b gene product accumulation, Francia et al. (2004) found that only the proximal of the two QTLs of frost resistance, namely Fr-H2, was responsible for the regulation of the cor gene, with no detectable effect at Fr-H1. A second minor QTL of regulation, explaining only about 10% of phenotypic variation for the trait, and not additive (most likely epistatically dependent from Fr-H2) was mapped to chromosome 6HS. Moreover, the same QTL, Fr-H2, was also responsible of the regulation of another cor gene, tmcap3 (Baldi et al. 1999), with again no detectable effect at Fr-H1. These results concerning the mapping of QTLs of cor gene expression in barley are in agreement with the findings of Vágújfalvi et al. (2003) in einkorn, but not with the data obtained in bread wheat where two loci were mapped by means of the cytogenetic stocks (Vágújfalvi et al. 2000). Most likely this could be due, as in the case above, to lack of segregation in the very different materials analyzed belonging to different species; additionally this could raise the hypothesis to be verified in other mapping populations that more than one locus is responsible for the accumulation of the cor14b gene product. A representation of the current knowledge on QTLs and genes involved in frost resistance in barley and wheat is presented in Figure 1. 259

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 260

GALIBA ET AL.

Figure 1. Summary of frost tolerance QTLs and genes mapped on the homoeologous Triticeae chromosome 5L. Distances between markers are in Kosambi cM and linkage groups are oriented with centromere (C) at the top. Position and distance of inferred markers are indicated in parentheses. Gray boxes on the left side of the chromosome bars indicate the map intervals where the frost tolerance QTLs have been mapped with a LOD > 3.0; the QTL peaks are pointed out by a black square. Relevant genes for frost resistance (Fr-), vernalization requirement (Vrn-) and regulation of Cor14b (Rcg) are in bold italics.

Frost resistance, regulation of cor gene expression and the CBF locus cosegregate in einkorn and barley The role of the CBF transcription factors in the response to cold stress has been extensively studied. Three CBF sequences characterized by a low temperature-dependent expression profile are known in Arabidopsis (Medina et al. 1999). These transcriptional activators were shown to bind to a specific motif, known as C-repeat/DRE, present in the promoter of many cor genes involved in low temperature stress response. A relationship was demonstrated between the overexpression of a CBF gene and the expression of cor genes and, furthermore, between the expression of the cor genes driven by CBF and the level of frost resistance (reviewed in Thomashow et al. 2001). Genes similar to the Arabidopsis CBF genes were identified in the EST databases of many crop species including barley, wheat and maize. In Triticeae, CBF is a 260

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 261

GALIBA ET AL.

multigene family still not completely described; so far more than six members are known in a diploid species such as barley. Most of the CBF cereal homologous sequences are clustered together on the long arm of the chromosome 5. Experimental evidence suggests that the cold-responsive pathway based on CBF is conserved between Arabidopsis and Triticeae. The C-repeat/DRE motif has been found in the promoter of several wheat and barley cor genes. Furthermore, a barley CBF sequence (HvCBF1) was shown to transactivate the promoter of a cold-regulated dehydrin (Ouellet et al. 1998; Xue 2002). When the CBF3 gene from barley was used in einkorn as RFLP probe, its mapping position was completely linked with the RFLP locus Xbcd508 corresponding to the peak of Fr-A2 QTL (Vágújfalvi et al. 2003). Choi et al. (2002) had previously mapped the CBF3 gene in the orthologous region of the barley chromosome 5H; this result was also confirmed by Francia et al. (2004). HvCBF4, a CBF sequence belonging to the CBF cluster on the chromosome 5H, represents the peak marker for the Fr-H2 bifunctional QTL controlling both frost resistance and expression of cor genes (Figure 1). The results described above suggest that CBFs could represent the CG for Fr-H2 and Fr-A2. Considering that the CBF sequences encode transcription factors and that the identified QTLs are also involved in the regulation of cor gene expression, it could be hypothesized that CBFs are likely involved in the expression of cor genes by binding to their promoters. Indeed, the promoter of cor14b was found to contain a C-repeat/DRE recognition motif giving further support to a CBF gene as CG of its regulation. The cor14b promoter was previously shown by deletion analysis to contain a 28-bp fragment (GTCACCCAAAGGTACGTGAGGTCGGCAA) that conferred low-temperature responsiveness (Dal Bosco et al. 2003). This fragment contains a basic Leucine zipper protein binding motif, an ABRE (opposite orientation), but also a C-repeat/DRE (in opposite orientation, in italics and underlined), with which a CBF protein could interact. The demonstration of the role of CBFs as CGs for frost tolerant QTLs will require further investigations and validation by means of transformation through analysis of alleles at several CBF genes in differently phenotyped cultivars and through fine mapping of this chromosomal region in einkorn, bread wheat and barley.

Candidate gene(s) for the Fr-H1 and Fr-A1 loci Together with Fr-H2, a second distal QTL for frost resistance (Fr-H1) was found to cosegregate with the Vrn-H1 gene in barley (Francia et al. 2004). Curiously, while this QTL had the largest effect on winter survival in field conditions, it showed about the same effect of the companion QTL for resistance to frost in controlled conditions. By means of commonly mapped markers, Fr-H1 was found to be colinear to the only 261

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 262

GALIBA ET AL.

QTL of frost resistance reported by Hayes et al. (1993) and by Pan et al. (1994) in barley and with the putatively major gene Fr-A1 mapped by Galiba et al. (1995) in bread wheat. The peak marker for Fr-H1 (Hv635P2.4) is an SSR marker developed from a BAC sequence during the positional cloning of Vrn-A1. Recently, a major QTL of reproductive frost tolerance in barley affecting ear sterility has been mapped to the Vrn-H1 genomic region in several Australian segregating populations (Reinheimer et al. 2004). Whether the Vrn genes themselves can be claimed as CGs of these distal QTLs of barley and bread wheat is a matter of interesting debate. Some authors have postulated for many years that “winter” alleles at the Vrn-H1 and Vrn-A1 genes would have a pleiotropic effect on the frost tolerance of cereals (Brule-Babel and Fowler 1988; Roberts 1990). Limin and Fowler (2002) developed near-isogenic lines (NILs) of bread wheat for contrasting alleles (spring, Vrn-A1, and winter, vrn-A1) at the Vrn-A1 locus, and tested the effect of the different alleles on phenological development and frost tolerance. The authors concluded that the transition from the vegetative to the reproductive phase represents a major developmental factor influencing cold tolerance; the winter type NILs would acquire more tolerance by increasing the duration of the vegetative/reproductive transition and Vrn-A1 would be a direct regulator of cold tolerance in bread wheat. Storlie et al. (1998) developed NILs by introgressing the Vrn-A1/Fr-A1 region by means of the RFLP marker wg644, from winter cultivars into a spring one. The authors found an increased frost tolerance in the NILs, even if they did not resolve the interval between the two genes. The recent progress in the understanding the role of Vrn genes in the flowering process (Yan et al. 2003, 2004) will allow to address the question about the interaction between these genes and frost resistance. On the other hand, some consideration appear in contrast with the hypothesis of Limin and Fowler (2002): as an example, it is possible that frost tolerance is linked with the Vrn gene by means of linkage drag of a large genomic segment during the breeding process of winter type cereals. Moreover, at least an experimental observation is in contrast with the hypothesis of Vrn as candidate gene for Fr1 since it has been reported that Fr-A1 and Vrn-A1 could be physically separated by means of deletion lines (Sutka et al. 1999). Also in this case, similarly to Fr-H2 and Fr-A2, a number of experiments are underway to identify the best CG for the QTL. The transformation of minus genotypes with the winter alleles of the Vrn-A1 gene, as well as the fine mapping of the QTL are two examples. An additional approach provided by the availability of the flowering genes could be the sequencing of alleles at the Vrn gene of chromosome group 5 in many barley and wheat winter (or spring) genotypes contrasting for frost tolerance.

262

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 263

GALIBA ET AL.

Acknowledgements This work was supported by grants the National Research Council of Italy (CNR-MTA bilateral project), by Italian Ministry of Foreign Affairs (Italy-Hungary bilateral project), by the Italian Ministry of University and Science (projects FIRB Plant-Stress and FIRB Function-Map) and by OTKD TO 14277.

References Baldi P, Grossi M, Pecchioni N, Valè G, Cattivelli L (1999) High expression level of a gene coding for a chloroplastic amino acid selective channel protein is correlated to cold acclimation in cereals. Plant Mol Biol 41:233-243 Brule-Babel AL, Fowler DB (1988) Genetic control of cold hardiness and vernalization requirement in wheat. Crop Sci 28:879–884 Byrne PF, McMullen MD, Snooks ME, Musket TA, Theuri JM, Widstrom NW, Wiseman BR, Coe EH (1996) Quantitative trait loci and metabolic pathways: genetic control of the concentration of maysin, a corn earworm resistance factor, in maize silks. Proc Natl Acad Sci USA 93:8820–8825 Cattivelli L, Bartels D (1990) Molecular cloning and characterization of cold-regulated genes in barley. Plant Physiol 93:1504-1510 Cattivelli L, Baldi P, Crosatti C, Di Fonzo N, Faccioli P, Grossi M, Mastrangelo AM, Pecchioni N, Stanca AM (2002) Chromosome regions and stress-related sequences involved in resistance to abiotic stress in Triticeae. Plant Mol Biol 48:649-665 Choi DW, Rodriguez EM, Close TJ (2002) Barley Cbf3 gene identification, expression pattern and map location. Plant Physiol 129:1-7 Crosatti C, Nevo E, Stanca AM, Cattivelli L (1996) Genetic analysis of the accumulation of COR14 proteins in wild (Hordeum spontaneum) and cultivated (Hordeum vulgare) barley. Theor Appl Genet 93:975-981 Crosatti C, Polverino de Laureto P, Bassi R, Cattivelli L (1999) The interaction between cold and light controls the expression of the cold-regulated barley gene cor14b and the accumulation of the corresponding protein. Plant Physiol 119:671-680 Dal Bosco C, Busconi M, Govoni C, Baldi P, Stanca AM, Crosatti C, Bassi R, Cattivelli L (2003) Cor gene expression in barley mutants affected in chloroplast development and photosynthetic electron transport. Plant Physiol 131:793-802 de Vienne D, Leonardi A, Damerval C, Zivy M (1999) Genetics of proteome variation for QTL characterization: application to drought-stress responses in maize. J Exp Bot 50:303–309 Feuillet C, Travella S, Stein N, Albar L, Nublat A, Keller B (2003) Map-based isolation of the leaf rust disease resistance gene Lr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc Natl Acad Sci USA 100:15253-15258 Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14:1675-1690 Francia E, Rizza F, Cattivelli L, Stanca AM, Galiba G, Toth B, Hayes PM, Skinner JS, Pecchioni N (2004) Two loci on chromosome 5H determine low-temperature resistance in a ‘Nure’ (winter) x ‘Tremois’ (spring) barley map. Theor Appl Genet 108:670-680

263

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 264

GALIBA ET AL.

Fridman E, Pleban T, Zamir D (2000) A recombination hotspot delimits a wild-species quantitative trait locus for tomato sugar content to 484 bp within an invertase gene. Proc Natl Acad Sci USA 97:4718-4723 Galiba G, Quarrie SA, Sutka J, Morgounov A, Snape JW (1995) RFLP mapping of the vernalization (Vrn1) and frost resistance (Fr1) genes on chromosome 5A of wheat. Theor Appl Genet 90:1174-1179 Giorni E, Crosatti C, Baldi P, Grossi M, Marè C, Stanca AM, Cattivelli L (1999) Cold-regulated gene expression during winter in frost tolerant and frost susceptible barley cultivars grown under field conditions. Euphytica 106:149-157 Goff SA, Ricke D, Lan T-H, Presting G, Wang R, Dunn M, Glazebrook J, Sessions A, Oeller P, Varma H, Hadley D, Hutchison D, Martin C, Katagiri F, Lange BM, Moughamer T, Xia Y, Budworth P, Zhong J, Miguel T, Paszkowski U, Zhang S, Colbert M, Sun W-L, Chen L, Cooper B, Park S, Wood TC, Mao L, Quail P, Wing R, Dean R, Yu Y, Zharkikh A, Shen R, Sahasrabudhe S, Thomas A, Cannings R, Gutin A, Pruss D, Reid J, Tavtigian S, Mitchell J, Eldredge G, Scholl T, Miller RM, Bhatnagar S, Adey N, Rubano T, Tusneem N, Robinson R, Feldhaus J, Macalma T, Oliphant A, Briggs S (2002) A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 296:92-100 Hayes PM, Blaket T, Chen THH, Tragoonrung S, Chen F, Pan A, Liu B (1993) Quantitative trait loci on barley (Hordeum vulgare L.) chromosome 7 associated with components of winterhardiness. Genome 36:66-71 Ishimaru K, Ono K, Kashiwagi T (2004) Identification of a new gene controlling plant height in rice using the candidate-gene strategy. Planta 218:388-395 Iwaki K, Nishida J, Yanagisawa T, Yoshida H, Kato K (2002) Genetic analysis of vrn-B1 for vernalization requirement by using linked dCAPS markers in bread wheat (Triticum aestivum L.). Theor App Genet 104:571-576 Jaglo KR, Kleff S, Amundsen KL, Zhang X, Haake V, Zhang JZ, Deits T, Thomashow MF (2001) Components of the Arabidopsis C-repeat/dehydration-responsive element binding factor cold-response pathway are conserved in Brassica napus and other plant species. Plant Physiol 127:910–917 Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF (1998) Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science, 280:104-106 Kianian SF, Egli MA, Phillips RL, Rines HW, Somers DA, Gengenbach BG, Webster FH, Livingston SM, Groh S, O’Donoughue LS, Sorrells ME, Wesenberg DM, Stuthman DD, Fulcher RG (1999) Association of a major groat oil content QTL and an acetyl-CoA carboxylase gene in oat. Theor Appl Genet 98:884–894 Kreps J, Wu Y, Chang HS, Zhu T, Wang X, Harper J (2002) Transcriptome changes for Arabidopsis in response to salt, osmotic and cold stress. Plant Physiol 130:2129–2141 Lagercrantz U, Putterill J, Coupland G, Lydiate D (1996) Comparative mapping in Arabidopsis and Brassica, fine scale genome collinearity and congruence of genes controlling flowering time. Plant J 9:13-20 Levitt J (1980) Responses of plants to environmental stresses. Vol. 1. Chilling, freezing, and high temperature stresses. Academic Press, New York, NY, USA Limin AE, Fowler DB (2002) Developmental traits affecting low-temperature tolerance response in near-isogenic lines for the vernalization locus Vrn-A1 in wheat (Triticum aestivum L.). Ann Bot 89:579-585

264

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 265

GALIBA ET AL.

Liu Q, Sakuma Y, Abe H, Kasuga M, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998) Two transcriptional factors, DREB1 and DREB2, with an EREP/AP2 DNA binding domain, separate two cellular signal transduction pathways in drought- and low temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10:1391-1406 Medina J, Bargues M, Terol J, Perez-Alonso M, Salinas J (1999) The Arabidopsis CBF gene family is composed of three genes encoding AP2 domain-containing proteins whose expression is regulated by low temperature but not by abscisic acid or dehydration. Plant Physiol 119:463-469 Ouellet F, Vazquez-Tello A, Sarhan F (1998) The wheat wcs120 promoter is cold-inducible in both monocotyledonous and dicotyledonous species. FEBS Lett 423:324-328 Pan A, Hayes PM, Chen F, Chen THH, Blaket T, Wright S, Karsai I, Bedö Z (1994) Genetic analysis of the components of winterhardiness in barley (Hordeum vulgare L.). Theor Appl Genet 89:900-910 Perez-Vich B, Fernandez-Martinez JM, Grondona M, Knapp SJ, Berry ST (2002) Stearoyl-ACP and oleoyl-PC desaturase genes cosegregate with quantitative trait loci underlying high stearic and high oleic acid mutant phenotypes in sunflower. Theor Appl Genet 104:338-349 Pflieger S, Lefebvre V, Causse M (2001) The candidate gene approach in plant genetics: a review. Mol Breed 7:275-291 Reinheimer JL, Barr AR, Eglinton JK (2004) QTL mapping of reproductive frost tolerance in barley. In: Proceeding of the IX International Barley Genetics Symposium Brno (CZ) pp 991-997 Roberts DWA (1990) Identification of loci on chromosome 5A of wheat involved in control of cold hardiness, vernalization, leaf length, rosette growth habit, and height of hardened plants. Genome 33:247-259 Sarhan F, Danyluk J (1998) Engineering cold-tolerant crops throwing the master switch. Trends Plant Sci 3:289-290 Sears ER (1954) The aneuploids of common wheat. Mo Agric Exp Stn Res Bull 572:1-59 Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, Yamaguchi-Shinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K (2002) Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. Plant J 31:279-292 Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signaling pathways. Cur Op Plant Biol 3:217-223 Snape JW, Sarma R, Quarrie SA, Fish L, Galiba G, Sutka J (2001) Mapping genes for flowering time and frost resistance using precise genetic stocks. Euphytica 120:309-315 Snape JW, Semikhodskij A, Fish L, Sharma RN, Quarrie SA, Galiba G, Sutka J (1997) Mapping frost resistance loci in wheat and comparative mapping with other cereals. Acta Agron Hung 45:265-270 Storlie EW, Allan RE, Walker Simmons MK (1998) Effect of the Vrn1-Fr1 interval on cold hardiness levels in near-isogenic wheat lines. Crop Sci 38:483-488 Sutka J (1981) Genetic studies of frost resistance in wheat. Theor Appl Genet 59:145-152 Sutka J, Snape JW (1989) Location of a gene for frost resistance on chromosome 5A of wheat. Euphytica 42:41-44 Sutka J, Galiba G, Vágújfalvi A, Gill BS, Snape JW (1999) Physical mapping of the Vrn-A1 and Fr1 genes on chromosome 5A of wheat using deletion lines. Theor Appl Genet 99:199-202 The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408:796-815

265

Galiba-Cattivelli-4

25-10-2005

16:29

Pagina 266

GALIBA ET AL.

Thomashow MF, Gilmour SJ, Stockinger EJ, Jaglo-Ottosen KR, Zarka DG (2001) Role of the Arabidopsis CBF transcriptional activators in cold acclimation. Physiol Plant 112:171-175 Tóth B, Galiba G, Fehér M, Sutka J Snape JW (2003) Mapping genes affecting flowering time and frost resistance on chromosome 5B of wheat. Theor Appl Genet 107:509-514 Vágújfalvi A, Crosatti C, Galiba G, Dubcovsky J, Cattivelli L (2000) Mapping of regulatory loci controlling the accumulation of the cold regulated cor14b mRNA in wheat. Mol Gen Genet 263:194-200 Vágújfalvi A, Galiba G, Cattivelli L, Dubcovsky J (2003) The cold-regulated transcriptional activator Cbf3 is linked to the frost-resistance locus Fr-A2 on wheat chromosome 5A. Mol Genet Genomics 269:60-67 van Buuren M, Salvi S, Morgante M, Serhani B, Tuberosa R (2002) Comparative genomic mapping between a 754 kb region flanking DREB1A in Arabidopsis thaliana and maize. Plant Mol Biol 48: 741-750 Vannini C, Locatelli F, Bracale M, Magnani E, Marsoni M, Osnato M, Mattana M, Baldoni E, Coraggio I (2004) Overexpression of the rice Osmyb4 gene increases chilling and freezing tolerance of Arabidopsis thaliana plants. Plant J 37:115-127 Xue GP (2002) An AP2 domain transcription factor HvCBF1 activates expression of cold-responsive genes in barley through interaction with a (G/a)(C/t)CGAC motif. Biochim Biophys Acta 1577:63-72 Yan L, Loukoianov A, Blechl A, Tranquilli A, Ramakrishna W, SanMiguel P, Bennetzen JL, Echenique V, Dubcovsky J (2004) The wheat VRN2 gene is a flowering repressor down-regulated by vernalization. Science 303:1640-1604 Yan L, Loukoianov A, Tranquilli G, Helguera M, Fahima T, Dubcovsky J (2003) Positional cloning of the wheat vernalization gene VRN1 Proc Natl Acad Sci USA 100:6263–6268 Yano M, Katayose Y, Ashikari M, Yamanouchi U, Monna L, Fuse T, Baba T, Yamamoto K, Umehara Y, Nagamura Y, Sasaki T (2000) Hd1, major photoperiod-sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANT. Plant Cell 12:2473-2484 Yu J, Hu S, Wang J, Wong GK-S, Li S, Liu B, Deng Y, Dai L, Zhou Y, Zhang X, Cao M, Liu J, Sun J, Tang J, Chen Y, Huang X, Lin W, Ye C, Tong W, Cong L, Geng J, Han Y, Li L, Li W, Hu G, Huang X, Li W, Li J, Liu Z, Li L, Jianping Liu J, Qi Q, Liu J, Li L, Li T, Wang X, Lu H, Wu T, Zhu M, Ni P, Han H, Dong W, Ren X, Feng X, Cui P, Li X, Wang H, Xu X, Zhai W, Xu Z, Zhang J, He S, Zhang J, Xu J, Zhang K, Zheng X, Dong J, Zeng W, Tao L, Ye J, Tan J, Ren X, Chen X, He J, Liu D, Tian W, Tian C, Xia H, Bao Q, Li G, Gao H, Cao T, Wang J, Zhao W, Li P, Chen W, Wang X, Zhang Y, Hu J, Wang J, Liu S, Yang J, Zhang G, Xiong Y, Li Z, Mao L, Chengshu Zhou C, Zhu Z, Chen R, Hao B, Zheng W, Chen S, Guo W, Li G, Liu S, Tao M, Wang J, Zhu L, Yuan L, Yang H (2002) A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296:79-92

266