SHORT COMMUNICATION Localization of Two Potassium Channel b Subunit Genes, KCNA1B and KCNA2B DENNIS SCHULTZ,* MICHAEL LITT,*,†,1 LESLIE SMITH,* MATHEW THAYER,*
AND
KEN MCCORMACK‡
Departments of *Molecular and Medical Genetics and †Biochemistry and Molecular Biology, Oregon Health Sciences University, Portland, Oregon 97201; and ‡Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706 Received August 25, 1995; accepted November 28, 1995
The gating properties and current amplitudes of mammalian voltage-activated Shaker potassium channels are modulated by at least two associated b subunits (Kvb1.1 and Kvb1.2). The human Kvb1.1 gene (KCNA1B) resides on chromosome 3, as indicated by somatic cell hybrid mapping. More precise localization of KCNA1B to 3q26.1 was obtained with fluorescence in situ hybridization (FISH) and was corroborated by PCR screening of the CEPH YAC library. The human Kvb1.2 gene (KCNA2B) resides on chromosome 1, as indicated by somatic cell hybrid mapping, and has been localized by FISH to 1p36.3. q 1996 Academic Press, Inc.
Shaker and other voltage-dependent K/ channel proteins help to determine the electrical properties of excitable cells and play additional physiological roles in nonexcitable cell types (5). Mammals contain a large number of K/ channel genes, often clustered within the genome, which may have arisen through local and chromosomal duplication events (6, 7). Associated b subunits modulate the gating properties and amplitudes of Shaker K/ currents (2,10, 12–14, 16, 17). The mammalian b1 and b2 genes encode divergent N-termini (4, 8, 10) but are homologous throughout a core region that is related to a superfamily of NAD(P)Hdependent enzymes (9, 10). The human b3 polypeptide (4, 8) is derived from the same gene as the b1 isoform by alternative splicing (10). Drosophila (2) and Arabidopsis (GenBank Accession No. L40948) homologs show significant identity within the core region (48 and 53%, respectively), and prokaryotic homologs with ú35% amino acid identity throughout the same region are also found in the database: mocA (GenBank Accession No. U19620) from Rhizobium (T. McCormack, pers. comm. New York, May 1995) and igrA (GenBank Accession No. M37389) from Pseudomonas (9). Because Shaker K/ channels have not been found in prokaryotes or Arabidopsis, ancestral b subunits are likely to have evolved prior to Shaker channels. The Shaker b 1 To whom correspondence should be addressed at Oregon Health Sciences University, L333, Portland, OR 97201-3098. Telephone: (503) 494-7717. Fax: (503) 494-8393. E-mail:
[email protected].
subunits may also associate with non-Shaker channels, and additional b subunit genes may have evolved in association with other K/ channel families (15, 18). Mutations in genes encoding a subunits of K/ channels are associated with episodic ataxia/myokymia (1) and Long QT syndrome (3). Mutations in K/ channel b subunits may also cause inherited diseases; testing of this hypothesis would be facilitated by chromosomal localization of these genes. Here, we report the mapping of the human Kvb1.1 (KCNA1B) and Kvb1.2 (KCNA2B) genes to chromosomes 3q26.1 and 1p36.3, respectively. Neither of these genes maps within the identified clusters of K/ channel a subunit genes (6, 7). PCR primers were designed from the 3*-untranslated region of full-length human cDNA clones of the human KCNA1B and KCNA2B genes (10). Primer sequences used in mapping were 1-22-S, GCATGGTTAAAATAGCGGCCTG; 1-24-A, ATAGAATGGATTTTCTTGGTTTTGTG; 2-22-S, CTCGCCAGCTAGCTCCATAGGG; and 2-23-A, GAGTGGAGACCCCCGGGACTTGG. PCR reactions for KCNA1B were performed in 10 ml of 11 Perkin–Elmer buffer, 2.5 mM Mg2/, 0.2 mM dNTPs, 0.5 pmol/ml each primer, 0.5 units Perkin– Elmer AmpliTaq, and 5% glycerol. PCR reactions for KCNA2B were identical except that 5% DMSO was substituted for 5% glycerol. Primers 1-22-S and 1–24–A amplify a 175-bp segment of KCNA1B starting 26 nt downstream from the stop codon (Fig. 1A; GenBank Accession No. U33428). On amplification of DNAs containing human chromosome 3 from the human 1 rodent somatic cell hybrid panel NIGMS 2, these primers yielded a product of the expected size. Neither mouse nor hamster DNA nor DNAs from panel members lacking human chromosome 3 yielded a detectable PCR product (data not shown). When the same primer pair was used to screen the CEPH mega-YAC library, it identified YAC 750_g_6 (data not shown). According to the CEPH-Ge´ne´thon database, this YAC contains the STSs D3S1275 and D3S1570. On the CHLC integrated map of chromosome 3 (v4), these markers map about 180 cM from 3pter. Primers 2-22-S and 2-23-A amplify a 320-bp segment GENOMICS
389
31, 389–391 (1996) ARTICLE NO. 0065
0888-7543/96 $12.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ 6r0e$$3875
01-03-96 21:16:25
gnmxa
AP-Genomics
390
SHORT COMMUNICATION
FIG. 1. Human Kv b1.1 (KCNA1B) (A) and Kv b1.2 (KCNA2B) (B) cDNAs. Coding (hatched) and noncoding regions of the cDNAs are shown in relation to those used for genomic screening and PCR analysis. Restriction fragments used for screening an EMBL3 bacteriophage human genomic library are indicated and described in the text. Positions of primers are indicated by arrows.
from the 3*-untranslated region of the KCNA2B cDNA (Fig. 1B; GenBank Accession No. U33429). Upon amplification of somatic cell hybrid panels NIGMS 1 and 2, these primers yielded a PCR product of the expected size only with DNA from cell lines that contained human chromosome 1 (data not shown). To confirm localizations of KCNA1B and KCNA2B and to map them cytogenetically, we performed fluorescence in situ hybridization (FISH). Inserts from the genomic phage clones L6 (for KCNA1B) and L9 (for KCNA2B) were obtained by long PCR with vector primers flanking the cloning site and were nick-translated to incorporate biotin-11–dUTP. Slides of chromosomally normal metaphase spreads were prepared from peripheral blood samples by routine methods (20). Hybridizations were performed on these slides at 377C overnight, with final probe concentrations varying from 40 to 60 ng/ml. Signal detection was performed according to the method of Trask and Pinkel (19). Slides were stained with propidium iodide (0.3 mg/ml), coverslipped, and viewed under UV fluorescence with FITC filters (Zeiss). Metaphase spreads showing probe signals were photographed with Fuji color film (ASA 100) at ASA 400. Identifications of chromosomal loci were obtained by staining the same metaphase spreads sequentially with chromomycin A3/distamycin to produce fluorescent R-bands. R-banded metaphase spreads were then photographed with technical Pan 2415 film (Kodak) at ASA 400. For FISH localization of KCNA1B, the probe utilized was an 18-kb insert of the L6 EMBL3 genomic clone isolated by screening with a 714-bp SacI cDNA fragment (Fig. 1A). Thirty-four cells showing hybridization at 3q26.1 were photographed. Nineteen metaphases (55%) had signals on all four chromatids of the chromosome 3 pair at this locus; 9 (26%) showed hybridization to three chromatids of the pair, and 6 (18%) showed hybridization to both chromatids of one chromosome. These results are summarized as an idiogram in Fig. 2A. To localize KCNA2B by FISH, we used as probe an 18-kb insert of the EMBL3 genomic clone L9 isolated by screening with the PstI fragments 1 and 3 of the cDNA (Fig. 1B). [Verification that clone L9 originates from the KCNA2B locus was provided by showing that
/ 6r0e$$3875
01-03-96 21:16:25
gnmxa
FIG. 2. FISH analysis of KCNA1B (A) KCNA2B (B), showing idiograms of chromosomes 3 and 1, respectively, with arrows indicating the localization of specific FISH signals.
AP-Genomics
SHORT COMMUNICATION
it yields a 320-bp product on amplification with the 222-S and 2-23-A primers (data not shown).] Thirty-nine cells showing hybridization to 1q36.3 were photographed. Eighteen metaphases (46%) had signals on all four chromatids of the chromosome 1 pair at this locus; 13 (33%) showed hybridization to three chromatids of the pair, and 8 (20%) showed hybridization to both chromatids of one chromosome. These results are summarized as an idiogram in Fig. 2B. Background hybridization is often seen when examining metaphase spreads for FISH signals. These signals are nonspecific and random, i.e., not found at the same locus in more than one cell examined. The FISH signals seen for KCNA1B and KCNA2B at 3q26.1 and 1p36.3, respectively, were the only signals seen at the same locus in all cells examined in each of two separate experiments. Also, these two loci were the only sites that showed FISH signals on all four chromatids of the chromosome pairs at one locus. Except for the two loci described, none of the FISH signals seen occurred at the same locus in more than one cell examined. The results described above localize the KCNA1B subunit of Shaker potassium channels to 3q26.1. The same primers that amplify part of the 3*-untranslated region of the cDNA were used to map KCNA1B to chromosome 3 with NIGMS panel 2 and to YAC 750_g_6. This YAC contains the STSs D3S1275 and D3S1570, which are flanked by cytogenetically localized markers D3S1308 and D3S1548 on the CHLC-integrated genetic linkage map v4, suggesting the localization of this YAC to 3q24– q26. Our FISH results are consistent with this localization but make it more precise (3q26.1). Furthermore, the gene encoding the human b3 polypeptide, an alternatively spliced form of Kvb1.1 (10), has been mapped with somatic cell hybrid panels to chromosome 3 (4). The chromosomal localizations of the KCNA1B and KCNA2B genes presented here will allow these genes to be tested as candidate genes for inherited diseases affecting various organs, such as the nervous system and the heart. For example, localization of Charcot-MarieTooth disease, type 2A (CMT2A), to 1p35–p36 (11) suggests that KCNA2B is a candidate gene for this disease. ACKNOWLEDGMENTS
REFERENCES
5. 6.
7.
8.
9.
10.
11.
12. 13.
14.
15.
17.
18.
1. Browne, D., Gancher, S. T., Nutt, J. G., Brunt, E. R. P., Smith, E. A., Kramer, P., and Litt, M. (1994). Episodic ataxia/myokymia syndrome is associated with point mutations in the human potassium channel gene KCNA1. Nature Genet 8: 136– 140. 2. Chouinard, S. W., Wilson, G. F., Schlimgen, A. K., and Ganetzky, B. (1995). A potassium channel b-subunit related to the
01-03-96 21:16:25
4.
16.
This work was supported by NIH Grants HG00022 (to M.L.) and GM49334 (to M.T.). K.M. was supported by a long-term HFSP fellowship. We are grateful to Walter Stuehmer and Linda Iverson, in whose laboratories some of this work was completed.
/ 6r0e$$3875
3.
gnmxa
19.
20.
391
aldo-keto reductase superfamily is encoded by the Drosophila Hyperkinetic locus. Proc. Natl. Acad. Sci. USA 92: 6763–6767. Curran, M. E., Splawski, I., Timothy, K. W., Vincent, G. M., Green, E. D., and Keating, M. T. (1995). A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell 80: 795–803. England, S. K., Uebele, V. N., Shear, H., Kodali, J., Bennett, P. B., and Tamkun, M. M. (1995). Characterization of a voltagegated K/ channel subunit expressed in human heart. Proc. Natl. Acad. Sci. USA 92: 6309–6313. Hille, B. (1992). ‘‘Ionic Channels of Excitable Membranes,’’ 2nd ed., Sinauer, Sunderland, MA. Klocke, R., Roberds, S. L., Tamkun, M. M., Gronemeier, M., Augustin, A., Albrecht, B., Pongs, O., and Jockusch, H. (1993). Chromosomal mapping in the mouse of eight K/-channel genes representing the four Shaker-like subfamilies Shaker, Shab, Shaw, and Shal. Genomics 18: 568–574. Lock, L. F., Gilbert, D. J., Street, V. A., Migeon, M. B., Jenkins, N. A., Copeland, N. G., and Tempel, B. L. (1994). Voltage-gated potassium channel genes are clustered in paralogous regions of the mouse genome. Genomics 20: 354–362. Majumder, K., De Biasi, M., Wang, Z., and Wible, B. A. (1995). Molecular cloning of a novel potassium channel b-subunit from human atrium. FEBS Lett. 361: 13–16. McCormack, T., and McCormack, K. (1994). Shaker K/ channel subunits belong to an NAD(P)H-dependent oxidoreductase superfamily. Cell 79: 1133–1135. McCormack, K., McCormack, T., Tanouye, M., Rudy, B., and Stuhmer, W. (1995). Alternative splicing of the human Shaker K/ channel b-1 gene and functional expression of the b-2 gene product. FEBS Lett. 370: 32–36. Othmane, K. B., Middleton, L. T., Loprest, L. J., Wilkinson, K. M., Lennon, F., Rozear, M. P., Stajich, J. M., Gaskell, P. C., Roses, A. D., Pericak-Vance, M. A., and Vance, J. M. (1993). Localization of a gene (CMT2A) for autosomal dominant Charcot-Marie-Tooth disease type 2 to chromosome 1p and evidence of genetic heterogeneity. Genomics 17: 370–375. Parcej, D. N., and Dolly, J. O. (1989). Dendrotoxin acceptor from bovine synaptic plasma membranes. Biochem. J. 257: 899–903. Rehm, H., and Ladzunski, M. (1988). Purification and subunit structure of a putative K/ channel protein identified by its binding properties for dendrotoxin I. Proc. Natl. Acad. Sci. USA 85: 4919–4923. Rettig, J., Heinemann, S. H., Wunder, F., Lorra, C., Parcej, D. N., Dolly, J. O., and Pongs, O. (1994). Inactivation properties of voltage-gated K/ channels altered by presence of b-subunit. Nature 369: 289–294. Rhodes, K. J., Keilbaugh, S. A., Barrezueta, N. X., Lopez, K. L., and Trimmer, J. S. (1995). Association and colocalization of K/ channel a- and b-subunit polypeptides in rat brain. J. Neurosci. 15: 5360–5371. Rudy, B., Hoger, J. H., Lester, H. A., and Davidson, N. (1988). At least two mRNA species contribute to the properties of rat brain A-type potassium channels expressed in Xenopus oocytes. Neuron 1: 649–658. Scott, V. E. S., Rettig, J., Parcej, D. N., Keen, J. N., Findlay, J. B. C., Pongs, O., and Dolly, J. O. (1994). Primary structure of a b-subunit of a-dendrotoxin-sensitive K/ channels from bovine brain. Proc. Natl. Acad. Sci. USA 91: 1637–1641. Serodio, P., Kentros, C., and Rudy, B. (1994) Identification of molecular components of A-type channels activating at subthreshold potentials. J. Neurophysiol. 72: 1516–1529. Trask, B., and Pinkel, D. (1990). Flow cytometry. In ‘‘Methods in Cell Biology’’ (H. A. Crissman and Z. Darzynkiewicz, Eds.), Vol. 33, Academic Press, New York. Yunis, J. J., and Chandler, M. E. (1977). High resolution chromosome analysis in clinical medicine. Prog. Clin. Pathol. 7: 267–288.
AP-Genomics
