19, No. 13 3507-3510. Two dimensional single-strandconformation polymorphism analysis: a useful tool for the detection of mutations in long DNA fragments.
Nucleic Acids Research, Vol. 19, No. 13 3507-3510
Two dimensional single-strand conformation polymorphism analysis: a useful tool for the detection of mutations in long DNA fragments Heinrich Kovar, Gunhild Jug, Herbert Auer1, Tim Skern1 and Dieter Blaas1 Children's Cancer Research Institute, St Anna Kinderspital, Kinderspitalgasse 6, A-1090 Vienna and 'Institute for Biochemistry, University of Vienna, Wahringerstrasse 17, A-1090 Vienna, Austria Received May 16, 1991; Accepted June 14, 1991
ABSTRACT A new two-dimensional gel system for the analysis of single strand conformational polymorphisms has been developed to identify point mutations, deletions and insertions in long DNA fragments (e.g. 2.7 kb) generated by the polymerase chain reaction. In this procedure, such DNA fragments are first restricted with frequent-cutter enzymes. The resulting small fragments are then separated in the first dimension according to their size by electrophoresis under denaturing conditions; these single stranded DNA fragments are subsequently fractionated in the second dimension by electrophoresis on a non denaturing slab gel based on their fold-back conformation which is completely sequence-dependent. The method was tested on three previously characterized pH 4.5 resistant mutants of HRV1 4 and was then used to determine changes in three further mutants. INTRODUCTION Enzymatic amplification of minute amounts of DNA by the polymerase chain reaction technique (PCR) has considerably simplified the molecular diagnosis of a wide range of genetic alterations. However, the rapid and unambiguous detection of mutations in amplified fragments still presents difficulties, if the time consuming and error prone (1,2) cloning of PCR generated DNA fragments is to be avoided. For example, specific hybridization to oligonucleotide probes (3-5) is restricted to known mutations and RNase digestion of heteroduplexes formed between a probe RNA and the target DNA allows detection of only 50% of all mismatches formed (6). Furthermore, the denaturing gradient gel electrophoresis technique (DDGE) (7-10), based on the melting characteristics of DNA, requires attachment of GC-rich sequences (GC-clamps) in order to allow the identification of the majority of mutations in short DNAfragments (11). A rapid and simple method alternative to these techniques is electrophoresis under nondenaturing conditions of short singlestranded DNA fragments. The single stranded DNA adopts a folded conformation, which is stabilized by intrastrand interactions, so that the conformation, and therefore the mobility,
is dependent on the sequence. This technique has been named 'single strand conformation polymorphism analysis' (SSCP, 12); the conditions employed do not exclude, however, the reassociation of the single stranded fragments, giving rise to ambiguous bands. Moreover, the method does not allow the discrimination between single-base alterations and small deletions or insertions and cannot be employed for DNA-fragments exceeding 300 base-pairs. To overcome this limitation, combinations of primer pairs in a 'mixed' PCR (13) or in multiple simultaneous SSCP analyses (14) have been used. However, both of these modifications require a set of primers and the results may not be completely unambiguous; we present here a simple, rapid and accurate two-dimensional gel system (needing only one pair of primers) based on a similar principle referred to as 2DSSCP. Its applicability is demonstrated by the analysis of mutants of HRV14 resistant to exposure at pH 4.5 (15).
MATERIALS AND METHODS Virus Acid stable variants of HRV14 were selected as described elsewhere (15). Individual mutants were isolated from plaques and grown in suspension cultures. Virus was recovered, and RNA was isolated from PEG-precipitated virus as described (16). cDNA synthesis and amplification of the viral capsid region First strand cDNA from the 5' end of viral RNA spanning the capsid region was synthesized by reverse transcription using 90 pmol of oligonucleotide B (GTGTCATCAAGTTGTAATTC, complementary to nucleotides 3262 -3243) as a primer, (numbering according to (17)) and was desalted by spun-column chromatography through Sephadex G50 (18). Half of the cDNA was added to 40 pmol of oligonucleotide A (ACTACTTTGGGTGTCC, corresponding to nucleotides 546-562) and the mixture was lyophilized. The DNA was dissolved in 10 Al of PCR reaction mix containing 67 mM Tris-HCl (pH8.8), 16 mM (NH4)2SO4, 6.7 mM MgCl2, 6.7 ,uM EDTA, 10 mM 2-mercaptoethanol, dNTPs at 1.5 mM each, 170 jig/ml bovine serum albumin (DNase free, Pharmacia), 2.5 U Taq-polymerase (AmpliTaq, USB), and overlaid with paraffin oil (19). For direct labelling of PCR-products, 10 to 30 yCi a-[32P]-dCTP was
3508 Nucleic Acids Research, Vol. 19, No. 13 included. The DNA was denatured at 95°C for 10 min. and PCR was performed in a Bio-Med thermocycler 60 set at 95°C (1 min.), 56°C (1 min.), and 70°C (15 min.) for 15 cycles followed by one annealing step at 56°C (1 min.) and one extension step at 72°C (15 min.). PCR products were extracted with phenol /CHC13 /isoamylalcohol (25:24: 1) and precipitated with ethanol according to standard procedures (18).
2DSSCP analysis Restriction digestions of PCR products were performed according to the manufacturer's recommendations followed by phenol/ CHCl3/isoamylalcohol extraction. Nucleic acids were precipitated in the presence of 10/zg of transfer RNA and dissolved in 5 yl water, lyophilized and taken up in 2 /l 50 % formamide, 1OmM EDTA, 0.025% bromophenol blue, 0.025% xylene cyanol FF. Samples were heated to 80°C for 5 min. and immediately applied to denaturing tube gels. First dimension electrophoresis was carried out in siiconized glass capillaries (60 to 120 mm, inner diameter 0.6-0.8 mm, as stated in the text) which had been filled with a denaturing gel mix consisting of 6% polyacrylamide and 7.6 M urea in TBE (0.089 M Tris-borate, 0.089 M boric acid, 2 mM EDTA) using a syringe. Electrophoresis was carried out at 65°C for 10 to 30 min. at 400V in preheated TBE-buffer in a tube cell with a water-thermostatable casing (Buchler Instruments or Bio Rad). A thorough degassing of the gel mix and the hot electrophoresis buffer prior to use was found to be essential. Tube gels were expelled from the capillaries using compressed air and placed horizontally on top of a 0.7 mm slab gel (33 x41 cm) made of 6% polyacrylamide, 90 mM Tris-borate, pH 8.3, and 4mM EDTA and were overlaid with the same buffer and a few microliters of tracking dye (0.1 % bromophenol blue in 4M urea, 50% sucrose, 50 mM EDTA). Electrophoresis was performed in a nucleic acid sequencing cell (Pokerface, Hoefer Scientific Instruments) at 4°C in the cold room using precooled buffer at 30 W for 5 to 15 min. Electrophoresis was continued over night at 3-4 W. Gels were dried on filter paper (3MM, Whatman) and exposed to X-ray film.
The filterpaper was removed from the swollen gel and DNA was eluted at 37°C with one change of buffer in Eppendorf vials over night. All vials were preincubated with denatured salmon sperm DNA for 1 hr. at 37°C to minimize loss of labelled single stranded DNA due to adsorption. Eluted DNA was recovered by centrifugation through a cushion of siliconized glass wool. The remainder of unlabelled restricted PCR product was added, the mixture was heated to 95°C for 5 min. and held at 37°C for 30 min. in order to convert the labelled ssDNA to dsDNA. 5 izg of salmon sperm DNA was added, the DNA was precipitated, washed with 70% ethanol and subjected to MaxamGilbert sequencing (20).
RESULTS The selection and characterization of three isolates of HRV14 resistant to treatment at pH 4.5 has previously been described (15); standard cDNA cloning and DNA sequencing showed that each of the three isolates had the mutation Thr 7:Ile in VP2 and that two (HRV 14-as 1 and -as2) possessed the mutation AsnlOO:Ile in VP1. The third (HRV14-as3) carried the mutation Asp 01 :Glu in VPI. To determine whether 2DSSCP could resolve these differences, the genomic regions between nucleotides 546 and 3262 of HRV 14-as 1, -as2, and -as3 were amplified, the labelled
40 f..
s6
Sequencing In the case of isolate HRV 14-asS the sequence of the fragment found to contain an alteration by 2DSSCP was determined as follows: cDNA was amplified without incorporation of radioactive nucleotides and restricted with HaeIII. An aliquot of the fragments was dephosphorylated by calf intestine phosphatase, 5' end-labelled with 50 /Ci -y-[32P]-ATP by T4 polynucleotide kinase using standard procedures (18), and subjected to 2DSSCP analysis. Spots corresponding to polymorphic single strands, as identified on the autoradiograph, were cut from the dried gel and submerged in 50 yd of 10 mM Tris-HCl (pH7.6), 1 mM EDTA. oligo A
oligo B
546
3262
VP4
VP2
.Fi A
I B
VP1
VP3
I
-i
I C
D
E F
G
H
Fig. 1. The 2.7 kb capsid encoding region of the HRV14 genome flanked by oligonucleotides A and B. HaeIl restriction sites are indicated by arrows, resulting fragments are denoted A through H.
Fig. 2. 2DSSCP analysis of HRV14-wt and -as3. Autoradiographs are shown in a 2.6 fold size-reduction. Each pair of spots represents the separated single strands of the corresponding fragments indicated at the right side of the figure.
_.~- D ~
Nucleic Acids Research, Vol. 19, No. 13 3509 which additionally reduced the separation time in the first dimension to ten minutes (see Fig. 3 and 4). The results obtained for wild-type HRV14 and HRV14-as2 and -as3 are presented in Fig. 3. HRV14-asl was shown to be indistinguishable from HRV14-as2 in 2DSSCP analysis and by sequencing of cloned cDNA (data not shown) and was therefore not considered further. Careful examination of the single stranded fragments from wt-HRV14 and HRV14-as3 revealed differences in migration of only two fragments, namely B and G. Comparison of the spots derived from HRV 14-as2 and HRV 14-as3 revealed
products were restricted with HaeIH and analyzed by 2DSSCP. HaeIII cuts the 2.7kb PCR product into fragments of 300 (A), 98 (B), 378 (C), 902 (D), 155 (E), 66 (F), 273 (G) and 544 (H) base-pairs (Fig. 1). As discussed later, all fragments but C, D and H are small enough to be readily resolved in the nondenaturing gel. 2DSSCP analysis of MboII- or RsaI-digested DNA showed that the regions corresponding to these latter fragments were not changed when compared to wild type and were therefore not further considered (data not shown). As shown in Fig.2 for wild-type and isolate HRV14-as3, all HaeIII fragments resolved in the first dimension according to their size gave rise to only two spots in the 2DSSCP analysis corresponding to the different conformations of the complementary single strands. For comparison, autoradiographs of the various isolates separated on the same gel were either placed on top of each other or a grid was used to align the specific patterns (compare Fig. 3a and b). The relative positions of the spots for one sample on different gels were also highly reproducible and could be used to detect even small differences in the migration of a particular fragment. Initial experiments were performed with 12 cm tube gels for electrophoresis in the first dimension, allowing the comparison of only two samples in parallel on the second dimension gel (Fig. 2). In order to analyze 4 to 5 PCR products on a single slab gel, 6 cm tube gels were used in subsequent experiments
A wt
-as4
wt
-as3
-as2
-as3
A
wt -as2
.
,
*
'
ON
G AG
AC CT
G
C
-us5
wt
T A
T
I
0
T
T T T T A A
C T C T T C G T T T T A A
C
C
A A G
A A G
C 4-
T C G
A
_.
___
G
-as3
wt
-as4
-as6
T A A C
--
T G
C
*
;
2600
A G
G T G T C T
a
1
A
HRV1 4
B -as2
t
I0
-as6
_
-as3
I,
S
4,
B
A."_......
wt
c
i
..... .
.
-as3 -as5
-as2
w
. _.. . . . . .
.
-as6
+-
T T A C
T
T
A
A
A A
C
C
2630
B
It
F
Fig. 4. Polymorphism and direct sequencing of fragment G. A) A detail from the 2DSSCP
Fig. 3. 2DSSCP analysis of HRV14-wt, -as2, -as3, -as4, and -as6. Autoradiographs from different gels are separated by a vertical line. A) The upper part of the autoradiographs is shown in a 1.8 fold size-reduction overlayed with a grid. B) The lower part of the autoradiographs is presented in a 1.3 fold size-reduction. The polymorphic single strands of fragments B and G are indicated by arrows.
analysis
of HRV14-wt, -as2, -as3, -as5, and -as6,
showing
the
polymorphic single strands of fragment G. The second dimension gels were run for a prolongued period of time in order to obtain better resolution (1.3 fold size reduction). The arrows indicate the single stranded fragments eluted from the gel and sequenced by the Maxam-Gilbert method. B) Sequence of the sense strand of HRV14-as5 fragment G from nucleotides 2601 to 2630. The single base substitutions in HRV14-as5 as compared to -wt are indicated by arrows.
3510 Nucleic Acids Research, Vol. 19, No. 13 differences in the mobility only for fragment G. It can be concluded therefore that the two isolates have nucleotide changes on fragments B and G relative to the wild-type; however, the mutations carried in fragment G are not identical. This result correlates exactly with that obtained by direct sequencing as fragment B contains the VP2 mutation (identical in all mutants) and fragment G the VPI mutation (at amino acid position 100 in HRV 14-as2 and at amino acid position 101 in HRV 14-as3). The previously uncharacterized mutants HRV 14-as4, -asS, and -as6 were then examined by 2DSSCP, as shown in Fig. 3 and Fig. 4. For the mutants HRV 14-as4 and -as6, differences to the wild-type were again found in fragments B and G; the B fragments showed the same mobility as those from HRV 14-as2 and -as3 indicating that these isolates carry the same mutation in VP2 (Fig. 3a). HRV14-asS also yielded B fragments possessing this mobility (data not shown). The migration of the G fragments was identical for HRV14-as2, -as4, and -as6 and clearly different from that of -as3 and wild-type (Fig. 3b). The G fragments from HRV14-asS, however, showed a mobility different from that of all others so far examined (Fig. 4a), indicating the presence of a different sequence. DNA sequencing was therefore carried out on 5'end labelled single strands eluted from 2DSSCP as described in Materials and Methods. Two single base substitutions were detected (Fig. 4b), one being identical to the alteration identified in VP1 of HRV14-asl, -as2, -as4, and -as6; the second, an A-G transition at position 2609, results in a Glu95:Gly amino acid change in VP1.
DISCUSSION The method of detecting mutations in long DNA fragments by 2DSSCP described here offers a number of advantages. First, all steps including reverse transcription, amplification, mutation detection, and sequencing of the fragment containing the alteration can be performed using a single pair of oligonucleotides with standard equipment. Second, several analyses can be carried out simultaneously. As the restriction fragments are separated under denaturing conditions in the first dimension, reassociation is prevented, and there are no difficulties arising from the presence of double stranded DNA in the second dimension. For instance, in one dimensional SSCP analysis, we often observed more than two signals, possibly due to reassociation of the single strands (data not shown); prior separation of the fragments in denaturing tube gels, however, resulted in only two highly reproducible spots in the second dimension in almost all cases. The detection of four different mutations in the six viral isolates examined, clearly showed that sequences differing in only one nucleotide possessed different migration characteristics. The identification of the one previously unknown mutation was then shown to be possible by chemical sequencing of the labelled DNA eluted from the dried gel, demonstrating the sensitivity of the technique. It cannot, however, be excluded that mutations localised close to one end of a fragment would not sufficiently influence the conformation of the DNA to change the migration and would be therefore not detected by 2DSSCP analysis. This problem is easily solved by performing the analysis with a second restriction enzyme. Such an approach may also be necessary when the distribution of restriction enzyme sites does not give an optimal pattern of fragments; in the work described, digestions with RsaI and MboR were performed to ensure that the regions represented by larger HaelH fragments did not contain mutations. Comparison of the time necessary for the detection of the
mutations in HRV-as 1 - as3 by cDNA cloning and DNA sequencing (several weeks) and those in HRV 14-as4 -as6 by 2DSSCP (a few days) illustrates the rapidity of the latter technique. The analysis of the isolates HRV 14-as4-as6 showed that they possessed the same mutations as HRV 14-as 1 and -as2 (VP2 Thrl7:Ile, VPI AsnlOO:Ile), except that HRV14-as5 contained an extra mutation. The new mutation in HRV 14-asS (A-G at # 2609; Glu95:Gly) was detected within 48 hrs. and characterized within less than a week. Thus 2DSSCP represents a significant improvement in detecting mutations in PCR fragments, due to its speed, its simplicity, and to its ability to detect practically all mutations. It should be useful not only for the analysis of genetically homogeneous populations (e.g. viral isolates) but for monitoring two alleles differing in as little as one nucleotide in clinical samples, even if present in a subpopulation of cells. Moreover, it can be used to compare cloned PCR products to their parental sequences in order to exclude entry of errors into sequence data bases.
ACKNOWLEDGEMENTS This work was supported by a grant from the 'Osterreichischer Fonds zur Forderung der Wissenschaftlichen Forschung'. We wish to thank Z.Rattler for moral support.
REFERENCES 1. Keohavong, P., and Thilly, W.G. (1989) Proc. Natl. Acad. Sci. USA 86, 9253 -9257. 2. Belyavsky, A.-Vinogradova, T., and Rajewsky, K. (1989) Nucl. Acids Res.
8, 2919-2932. 3. Botstein, D., White, R.L., Skolnick, M., and Davis, R.W. (1980) Am. J. Hum. Genet. 32, 314-331. 4. Wallace, R.B., Johnson, M.F., Hiorose, T., Miyake, T., Kawashima, E.H., and Itakura, K. (1981) Nucl. Acids Res. 9, 879-893. 5. Landegren, U., Kaiser, R., Sanders, J., and Hood, L. (1988) Science 241, 1077-1080. 6. Winter, E., Yamamoto, F., Almoguera, C., and Preucho, M. (1985) Proc. Natl. Acad. Sci. USA 82, 7575-7579. 7. Fischer, S.G., and Lerman, L.S. (1980) Proc. Natl. Acad. Sci. USA 77, 4420-4424. 8. Fischer, S.G.. and Lerman, L.S. (1983) Proc. Natl. Acad. Sci. USA 80, 1579-1583. 9. Meyers, R.M., Lumelsky, N., Lerman, L., and Maniatis, T. (1985) Nature 313, 495 -498. 10. Meyers, R.M., Maniatis T., and Lerman, L.S. (1987) Meth. Enzymol. 155, 501 -527. 11. Sheffield, V.C., Cox, D.R., Lerman, L.S., and Myers, R.M. (1989) Proc. Natl. Acad. Sci. 86, 232-236. 12. Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, K. (1989). Genomics 5, 874 -879. 13. Suzuki, Y., Orita, M., Shiraishi, M., Hayashi, K., and Sekiya,T. (1990) Oncogene 5, 1037 - 1043. 14. Murakami, Y., Katahira, M., Makino, R., Hayashi, K., Hirohashi, S.. and Sekiya, T. (1991) Oncogene 6, 37-42. 15. Skemn, T., Torgersen, H., Auer, H., Kuechler, E., and Blaas, D. (1991). Virology (in press). 16. Skemn, T., Sommergruber, W., Blaas, D., Pieler, Ch., and Kuechler, E. (1984) Virology 136, 125-136. 17. Stanway, G., Huges, P.J., Montford, R.C., Minor, Ph.D., and Almond, J.W. (1984). Nucleic Acids Res. 12, 7859-7875. 18. Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor University Press, Cold Spring Harbor. 19. Jeffrey, A.J., Wilson, V., Neumann, R., and Keyte, J. (1988) Nucl. Acids Res. 16, 10953- 10971. 20. Maxam, A.M., and Gilbert, W. (1980) Meth. Enzymol. 65, 499-560. 21. Jeffrey, A.J., Neumann, R., and Wilson, V. (1990) Cell 60, 473-485.
