Jul 28, 2014 - Ben Amor et al., 2009; Liu et al., 2012), suggesting roles in certain ...... data collection and analysis, decision to publish, or preparation of the ...
Jin et al (10) suggested that ..... Liu and Xiao (24) reported that hypoxia promotes hypoxia inducible ..... Zhang C, Liu J, Jin N, Zhang G, Xi Y and Liu H: SiRNA.
Feb 15, 2017 - many highly-connected genes, including XLOC_058593, BMP3, MYOD1, and LAMP3. This study provides a valuable resource for chicken ...
Aug 26, 2013 - Minghui Zhu,1 Guoyong Chen,1 WeiWei Wang,1 Fred G. Biddle,4 and Jianqin Gu3. 1 Clinical Research Center, People's Hospital of ...
Dec 1, 2010 - Rous, a junior faculty member then at Rockefeller. University, a hen that had a breast ...... splicing in adenovirus-2 by Philip Sharp and Richard. Roberts [262,263]. ...... Tang S, Tao M, McCoy JP Jr, et al. The E7 oncoprotein is.
Dec 1, 2010 - Dr. Harald zur Hausen of Germany won the Nobel. Prize in 2008 for his discovery in 1983 that HPVs cause cervical cancer. HUMAN DNA AND ...
Jul 7, 2015 - served than mRNA and small noncoding RNAs [4, 5], lack of conservation does not ... associated noncoding RNAs dynamically expressed in ESCs during cardiac ... In human, several cytoplasmic lncRNAs transactivate Staufen1- ..... noncoding
Sep 2, 2014 - Nasopharyngeal Carcinoma and Their Prognostic Value ... Nasopharyngeal Carcinoma, Sun Yat-Sen University Cancer Center, 651 Dongfeng ...
Sep 29, 2013 - Ismael A Vergara4, Elai Davicioni4, Nicholas Erho4, Mercedeh Ghadessi4, Robert B Jenkins5, Timothy J Triche4, ...... Pflueger, D. et al. ... Trapnell, C., Pachter, L. & Salzberg, S.L. TopHat: discovering splice junctions with.
Oct 15, 2015 - Stephen Dalton,6 Robert Chunhua Zhao,4,* and Runsheng Chen1,2,*. 1Key Laboratory of RNA Biology, Institute of Biophysics, Chinese ...
Oct 26, 2010 - Envelope Reverse 1 (SER1), and SARS Spike Reverse 4 (SSR4) and those with primers designed for mouse 18S gene using the same strains ...
of Medicine, Nanjing 210002, China. 1Department of Urology, Changzheng Hospital, Second Military Medical. University, 415 Fengyang Road, Shanghai ...
Wang et al.: Pancreatic Meg3 Regulates MafA by Inactivating Rad21, Smc3 or Sin3α ... Long noncoding RNA ⢠Meg3 ⢠Beta cells ⢠MafA ⢠Rad21 ⢠Smc3 ⢠Sin3α.
Nov 19, 2018 - Vasculogenic mimicry (VM) gives rise to tumor neovascularization that is ... reproduction in any medium, provided you give appropriate credit to ...
Aug 13, 2018 - (2014) 142(1):32â8. doi:10.1111/imm.12227. 35. Xin J, Li J, Feng Y, Wang L, ... 1155â67. doi:10.1158/0008-5472.CAN-16-1508. 37. Michalik ...
The methylation status of the MEG3 promoter in cervical cancer tissue samples was ..... ferentiation, and lymphatic vascular space invasion (LVSI). Univariate ...
Stephen Dalton, Robert Chunhua Zhao, and Runsheng Chen ..... RNAs were in vitro transcribed with Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
May 13, 2016 - therapy (ADT) is the first line therapy for most first time diagnostic prostate cancer ..... 6E and 6F) and decreased the down- regulation of TIMP2/3 by AR knockdown ..... address codes in development and disease. Cell. 2013;.
Apr 7, 2016 - Coordination of p300-mediated chromatin remodeling and ..... Overexpression VP64-dCas9 /multiplexed sgRNA construct. Tug1 KD. Tug1 OE.
coding RNA TUG1 in human cholangiocarcinoma. Oncotarget 8: ... Li S, Xu S, et al: The long noncoding RNA TUG1 acts as a competing endogenous RNA to ...
Feb 10, 2018 - RNA ANRIL was associated with a susceptibility to CAD by evaluating ... Submmited 15 September 2017; Accepted 6 January 2018; Published ...
Jul 9, 2014 - We observed that the migration and invasion of cervical cancer cells in vitro were inhibited upon suppression of lncRNA-. EBIC by .... free growth medium supplemented with 10% FBS and cultured ..... Gibb EA, Becker-Santos DD, Enfield KS
and Shanghai Medical College, The Chinese Ministry of. Education, Fudan University, Shanghai 200032, China. Tel: +86-21-64037181; Fax: +86-21-64037181;.
(Related to Figure 2) Whole genome array of K652 cells with Saf overexpression. ... (Related to Figure 3) Saf interacts with Fas mRNA. ... 5'-3' exoribonuclease 2.
Long noncoding RNA Saf and splicing factor 45 increase soluble Fas and resistance to apoptosis Supplementary Material
Figure S1. (Related to Figure 2) Whole genome array of K652 cells with Saf overexpression. Log2 normalized intensity of probes from Affymetrix HG-U133_Plus2 arrays performed on K562 cells. Linear regressions highlight + 2-fold change in transcript levels where the dot corresponding to Saf is labeled.
Figure S2. (Related to Figure 3) Saf interacts with Fas mRNA. (A) Schematic diagram of the RNA pull-down assay. (B) Agarose gel images of RT-PCR products generated for the indicated genes from RNA before (input) and after RNA pull-down using biotin-labeled versions of Saf (Left) or firefly luciferase (fLuc, Right). W, no template control.
Table S1. Primers used in these studies. A. Primers used for PCR cloning Name
B. Primers used for RT-PCR and qRT-PCR Primer Name
Forward
Reverse
Saf
ATCAGCGAACAGCCTGAGTT
GAGCCATGTAGTGGGGAAGA
47S pre rRNA
GCTGACACGCTGTCCTCTGG
GAGAACGCCTGACACGCACG
snoRNA U87
ATGGGATCATGGAGCAGCTG
TCACACCCATGACTGCCACT
RPL13A
CCTGGAGGAGAAGAGGAAAGAGA
TTGAGGACCTCTGTGTATTTGTCAA
Fas (endogenous)
ATGTGAACATGGAATCATCAAGG
GGAGATTCATGAGAACCTTGG
LUST
AACAAGCCGCCTGAACTAAA
CTGATTCCCCCAGTCTTCAA
Zeb2NAT
GTCAAGCCTTTGGCATCATT
GGGCAGAGAACTTTGTTCCA
C. Primers used for RNAse A protection assay Primer Name Ex2 For In2 Rev In2 For Ex3 Rev Ex3 For In3 Rev In3 For Ex4 Rev Ex4 For In4 Rev In4 For Ex5 Rev Ex5 For Ex6 Rev Ex6 For In6 Rev In6 For Ex7 Rev Ex7 For In7 Rev In7 For Ex8 Rev
Table S2. (Related to Figure 4) Top twenty-one Saf interacting nuclear proteins identified by mass spectrometry. Two biological replicates using mass-spectrometry analysis. *confirmed by RNA-coimmunoprecipitation and western blot with specific antibodies. Name SSB NRF SKIV2L2 SPF45 COIL ZCCHC8 PHF5A SF3A DDX18 H3F3A U2AF1 PRKRA CPSF1 PDCD11 SNRPF SNRPE RCC2 MSH2 ZC3HAV1 GAR1 XRN2
Description Sjogren Syndrome Antigen B* NF-kappaB repressing factor ATP-dependent helicase SKIV2L2 Splicing Factor 45* Coilin Zinc finger CCHC domain-containing protein 8 Splicing factor 3B-associated 14 kDa protein Splicing factor 3A ATP-dependent RNA helicase DDX18 Histone H3-3 A subunit Splicing factor U2AF 35 kDa subunit Interferon-induced protein kinase Cleavage and polyadenylation specific factor 1 Programmed Cell Death Protein 11 RRP5 Small nuclear ribonucleoprotein F Small nuclear ribonucleoprotein E Regulator Of Chromosome Condensation protein 2 DNA mismatch repair protein Zinc finger CCCH-type antiviral protein 1 H/ACA ribonucleoprotein complex subunit 1 5'-3' exoribonuclease 2
Table S3. (Related to Figure 7 and Experimental Procedures) RNAi Consortium shRNA clones used in this study. Knockdown (KD) efficiency determined by qRTPCR normalized to RNaseP and expressed relatve to PGF (NTC) control. NTC, nontargeting control. Clone Number