Mol Biol Rep (2015) 42:507–516 DOI 10.1007/s11033-014-3794-1
Loss of heterozygosity of chromosome 13q33-34 region and molecular analysis of ING1 and p53 genes in bladder carcinoma Mehri Igci • Ahmet Arslan • Sakip Erturhan • Yusuf Ziya Igci • Elif Pala Bulent Gogebakan • Metin Karakok • Ecir Ali Cakmak • Beyhan Cengiz
•
Received: 9 September 2013 / Accepted: 10 October 2014 / Published online: 17 October 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Cancer is a consequence of accumulation of genetic and epigenetic alterations in the cell which can lead to activation of oncogenes or inactivation of tumor suppressor genes (TSG). Since members of ING family were discovered as TSGs in different cancer types, it was aimed to analyze the chromosome 13q33-34 region, ING1 and p53 genes in bladder cancer. 30 paired normal and tumor tissues were investigated in terms of microdeletion of chromosome 13q33-34 region, ING1 expression and mutation status of ING1 and p53 genes. Because there is no data available about the transcription factors which bind to ING1 promoter, the promoter sequence was analyzed via Genomatix-MatInspector and TFSEARCH softwares. Used DS markers were D13S285, D13S1315, D13S796, D13S278, D13S158, and D13S779 where loss of
heterozygosity (LOH) results were as 23.3, 20, 6.7, 3.3, 6.7, and 0 %, respectively. The highest LOH scores were obtained with markers D13S285 and D13S1315 which are flanking the ING1. Seven of 30 cases showed alteration in expression (p [ 0.05). However, no mutation was detected in the exons of ING1. One patient showed a two-nucleotide deletion in p53 gene. However no significant TSG activity of ING1 was observed while higher activity was reported in different cancer types. As for the LOH data 13q33-34 region may contain different candidate TSGs like COL4A1, COL4A2 and SOX1. As a result of computational promoter analysis, some factors like ABL, E2F, HIF1, SOX, P53, BPTF, NRSF, c-Rel and c-ETS were associated with the promoter region. Molecular analysis of ING1 promoter warrants further analysis. Keywords 13q33-34 Bladder cancer ING1 expression Loss of heterozygosity Mutation Tumor suppressor genes
M. Igci (&) A. Arslan Y. Z. Igci E. Pala E. A. Cakmak Department of Medical Biology, Faculty of Medicine, University of Gaziantep, 27310 Gaziantep, Turkey e-mail:
[email protected];
[email protected] S. Erturhan Department of Urology, Faculty of Medicine, University of Gaziantep, 27310 Gaziantep, Turkey B. Gogebakan Department of Medical Biology, Faculty of Medicine, Mustafa Kemal University, Hatay, Turkey M. Karakok Department of Pathology, Faculty of Medicine, University of Gaziantep, 27310 Gaziantep, Turkey B. Cengiz Department of Physiology, Faculty of Medicine, University of Gaziantep, 27310 Gaziantep, Turkey
Introduction Bladder cancer is one of the most common human malignancies. In Turkey, bladder cancer is the third of the most common cancer types, accounting for 8.2 % of all cancers [1] and the fourth most common male cancer in America [2]. Cancers are genetic diseases that are a consequence of alterations in the structure, expression, and function of tumor supressor genes [3]. Loss of heterozygosity (LOH) leading to inhibition of TSGs has been known to be one of the contributing mechanisms of tumor progression. In accordance with Knudson’s two-hit hypothesis; for the nonhereditary cases, cells must experience two
123
508
independently occurring mutational events in tumor suppressor gene [4]. Alleles of a tumor suppressor gene are inactivated by deletion, hypermetilation, or combination of both [5]. Mutational inactivation of tumor suppressor genes leads loss of normal function of cells and cells display phenotypes of neoplastic growth [6]. To determine the chromosomal loci of putative tumor-suppressor genes in tumor, loss of heterozygosity (LOH) analysis is an effective method, because LOH unmaskes the recessive mutation of tumor-suppressor gene in the remaining allele [7]. For 13q33-34 region, loss of heterozygosity was reported by several research groups [8–14]. Among these studies, loss of 13q33-34 region was associated with different types of carcinomas including esophageal squamous cell cancer [10], head and neck squamous cell carcinomas [11], primary small cell lung carcinomas [13], and T cell leukaemia/lymphoma [14]. Also gastric differentiated-type carcinoma was associated with the changes in chromosome 13q33-34 region [15]. Chen and coworkers [10] and Gunduz and coworkers [11] claim that lowered gene expression of ING1 may contribute to the pathogenesis of esophageal squamous cell and head and neck squamous cell carcinomas, respectively. ING1 is also an intimate partner of p53 protein of which is mutated in nearly half of all human cancers [16]. ING proteins play a critical role in several central cellular processes such as cell migration growth regulation, DNA repair, senescence, and apoptosis [17, 18]. ING proteins affect cell cycle [19] and supression of ING proteins increase migration, and relieve contact inhibition [20]. Now it is known that ING1 and p53 are not essential for the activity of each other but there is a synergy between them in inducing apoptosis [16]. The transcription factor p53 is an important protein in cell cycle arrest, apoptosis, senescence, and DNA repair [16]. Numerous posttranslational modifications, such as acetylation, and phosphorylation modulate p53 activity [16]. Since ING1 is a component of Sin3/HDAC1/2 complexes, it is associated with specific histone modifying complexes, linking chromatin regulation with p53 function and tumor suppression [21]. In human cancer, activity of p53 is lost by mutation or by loss of cell signaling upstream or downstream of p53. Hence it was planned to analyze both ING1 and p53 together in this study. The Inhibitor of Growth 1 (ING1) gene has been cloned and characterized as a tumor suppressor gene (TSG) [20] because it is mapped on 13q [22], a frequent deletion target in many tumor types. Allelic loss of 13q33-34 region has been shown on several cancer studies including human head and neck cancer [11], esophageal squamous cell [10]. Since the loss of ING1 expression occurs in several cancer types and knockout mice are cancer prone, the TSG status of ING1 gene has been fully established [23]. However, to
123
Mol Biol Rep (2015) 42:507–516
our knowledge, with the exception of the study of Gunduz et al.[11], in this gene, no tumor-specific somatic mutation has been reported. In this study, we aimed to determine the LOH profile of the 13q33-34 region and expression status of ING1 mRNA and to screen the mutations of ING1 and p53 genes in bladder carcinoma. However, the upstream regulators of ING1 have not been identified. Because there is no data available about the transcription factors which bind to ING1 promoter, the promoter sequence was analyzed using bioinformatics tools in this study for the first time.
Materials and methods Tissue samples Tumor tissues and matched normal bladder tissues were obtained from 30 patients (23 males, 7 females; age: 65,7 ± 20) diagnosed as bladder cancer. Tissue samples were collected at the Department of Urology, Gaziantep University Hospital. Immediately after surgery the samples were stored in liquid nitrogen and transferred to a -80 °C deep freezer until the isolation of DNA and RNA. At the Department of Pathology, diagnostic studies were performed and all samples were confirmed as bladder carcinoma. The study was approved by the local Ethics Committee (Approval No: 02-2009/63), informed consent was obtained from all participants and it was conducted in accordance with the Declaration of Helsinki. DNA and RNA isolation Both genomic DNA and total RNA were isolated from frozen tissues using Roche Applied Science High Pure PCR Template Preparation Kit (Cat. No. 11 796 828 001) and Roche Applied Science High Pure RNA Tissue Kit (Cat. No.12 033 674 001) in accordance with the manufacturer’s instructions. The DNA samples were stored at 20 °C and the RNA samples were stored at -80 °C until further analysis. Microsatellite analysis of 13q33-34 chromosomal region Primer sequences for microsatellite markers D13S779, D13S158, D13S278, D13S796, D13S1315, and D13S285 were obtained from the NCBI database [24]. Polymerase chain reaction (PCR) was carried out in 10 ll of reaction mixture containing 50 ng of genomic DNA, 0.25 unit of Taq DNA polymerase (Fermentas, Vilnius, Lithuania), 1X PCR buffer, 2 mM of each deoxynucleotide triphosphate,
Mol Biol Rep (2015) 42:507–516
and 20 pmol of each primer. The thermocycling procedure is as follows: initial denaturation at 94 °C for 5 min, 25 cycles of denaturation (95 °C for 30 s), annealing (at temperatures: 56, 57, 58, 57.6, 58, 58 °C, respectively for 30 s) and extension (72 °C for 30 s), and final extension (72 °C for 2 min). Amplification was achieved with Eppendorf Mastercycler gradient. The PCR products were resolved as a single band by 1 % agarose gel electrophoresis prior to microsatellite analysis. 7 ll of loading dye (95 % formamide, 0.05 % bromphenol blue, 0.05 % xylene cyanol, and 20 mM EDTA,) was added to 3 ll of
509
the PCR product. The mixed samples were denatured by heat, kept on ice, and quickly loaded onto an 8 % polyacrylamide gel containing 7 M urea and electrophoresed. After electrophoresis the gels were silver stained to visualize the banding patterns and the images were transferred to the computer by using 1,200 dpi scanner. LOH was scored by measuring the intensity of the heterozygous alleles. The intensity of the bands was measured by ImageJ (1.42q) program (Fig. 1). In tumor DNA, as compared with the normal DNA, 50 % reduced intensity showed the LOH.
Fig. 1 The intensity of the bands was measured by ImageJ (v.1.42q) program. Gel images of LOH analysis and graphical representation of these images created by ImageJ software are seen together
123
510
Single strand conformation polymorphism (SSCP) and nucleotide sequence analysis of ING1 SSCP experiments were realized using the DNA samples of both normal and tumor tissues of the patients. Exons 1a, 1b and 2 were amplified by PCR with two, one and three primer sets, respectively (Ex1aF: 50 -GTGGAGGAAGCGGAAAGC, Ex1aR: 50 -GGACCTTGGCGAATCAAAG, Ex1b_1F: 50 - GACCGCTATCCCCGAAAGTA, Ex1b_1R: 50 -GGAGGAGAACCAACCACACC, Ex1b_2F: 50 -CCAG CCTTGGATTGGTTCTT, Ex1b_2R: 50 -GTGGACGCAG CCCCAGTC, Ex2_1F: 50 -GCGAGTGACGCCTGTCCTT C, E2_1R: 50 -CGCTTGCTGTTGGGCTTGTC, E2_2F: 50 GCGACACAGCGGGCAACA, E2_2R: 50 -CGGCAGGGGACGCCTCTC, E2_3F: 50 -GCCAAGACCTCCAAGAAGAAGA, E2_3R: 50 -GGTTTATTTTGTCCTCCTCACA CC). The PCR mixture contained 50 ng of DNA, 1X PCR buffer, 2.5 mM MgCl2, 20 pmol of each primer, 2 mM of each deoxynucleotide triphosphate, and 0,25 unit of Taq DNA polymerase (Fermentas, Vilnius, Lithuania) in a 10 ll volume. Following the initial denaturation at 95 °C for 5 min, 35 cycles of a denaturation step at 95 °C for 30 s, an annealing step (at temperatures: 56.6, 61.5, 63.3, 65.5, 66.3, 62.5, respectively) for 45 s, and an extension step at 72 °C for 30 s were performed. A final extension step for 2 min at 72 °C was added. As described previously, 3 ll of PCR product was mixed with 7 ll of loading dye and denatured by heat, and loaded onto an 8 % polyacrylamide gel. Bands were detected by standart silver staining method. The bands which showed different electrical mobility were excised from the gel and reamplified with the same sets of primers and sequenced by using ABI 3130 nucleotide sequence analyzer.
Mol Biol Rep (2015) 42:507–516
Prediction of upstream regulators of ING1 promoter The regulation of ING1 gene and the regulatory factors which bind to ING1 promoter have not been identified thus far. In this study we have used the online transcription factor finder programs: Genomatix-MatInspector [26] and TFSEARCH [27]. Both softwares are able to predict the candidate known transcription factors binding to the uploaded genomic sequence. The sequence of the promoter region (5,000 nt. in length) was obtained from NCBI database (gi: 238018069, ref NG_012197.1).
Screening of p53 gene Exons 4 to 9 of p53 were analyzed by PCR-SSCP and direct nucleotide sequencing by using the following primers for both experiments: Ex4F (50 -ATCTACAGTCCCCC TTGCCG), Ex4R (50 -GCAACTGACCGTGCAAGTCA), Ex5F (50 -GACTTTCAACTCTGTCTCCTTC), Ex5R (50 AACCAGCCCTGTCGTCTCTC), Ex6F (50 -ACCATGAG CGCTGCTCAGAT), Ex6R (50 -AGTTGCAAACCAGAC CTCAG), Ex7F (50 -CTTGGGCCTGTGTTATCTCCT), Ex7R (50 -AGGGTGGCAAGTGGCTCCTG), Ex8F (50 CCTTACTGCCTCTTGCTTCTC), Ex8R (50 -TGAATCTG AGGCATAACTGCAC), Ex9F (50 -AGTTATGCCTCAGA TTCACTTTT), Ex9R (50 -GATAAGAGGTCCCAAGACTTAG). PCR, SSCP and sequencing procedures were as described for ING1 mutation analysis.
Results LOH analysis
Expression analysis of ING1 gene RNA samples were extracted from paired normal and tumor tissues and amplified with RT-PCR (Reverse transcriptase-polymerase chain reaction). The cDNAs were reamplified with primers for ING1 (F: 50 -GAGATCGACGCGAAATACCAA, R: 50 -CTCCTGGCTGCGGATCAG) and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) (F: 50 -AGACCACAGTCCATGCCATCAC, R: 50 -GGTCCACCACCCTGTTGCTGT) genes to compare the expression levels of ING1. PCR products were loaded onto agarose gel and electrophoresed. The gel images were evaluated by using integrated density (ID) values obtained via ImageJ software as described before [25]. As compared with the normal RNA, 50 % reduced intensity in tumor RNA indicated to downregulation of ING1 mRNA in tumor tissues.
123
Fourteen of 30 tumors (47 %) showed LOH at different microsatellite marker (Table 1). Obtained LOH results are summarized in Fig. 2. Two tumors (samples 22, 26) displayed a large deletion. The most frequent losses were seen at markers D13S285 (23.3 %) and D13S1315 (20 %) which were flanking the IRS2 (insulin receptor substrate 2), COL4A1 (collagen, type IV, alpha 1), COL4A2 (collagen, type IV, alpha 2), RAB20 (member RAS oncogene family), CARKD (carbohydrate kinase domain containing), CARS2 (cysteinyl-tRNA synthetase 2, mitochondrial), ING1 (inhibitor of growth family, member 1), RPL21P107 (ribosomal protein L21 pseudogene 107), ANKRD10 (ankyrin repeat domain 10), PARP1P1 [poly (ADP-ribose) polymerase family, member 1 pseudogene 1], ARFGEF7 [Rho guanine nucleotide exchange factor (GEF) 7], SOX1 [SRY (sex determining region Y)-box 1] genes (Fig. 3).
Table 1 Distribution of loss of heterozygosity (LOH) for six microsatellite markers on 13q33-34 in 30 cases of bladder cancer. Black boxes: Loss of heterozygosity; Grey boxes: Noninformative cases; White boxes: Retention of heterozygosity
Mol Biol Rep (2015) 42:507–516
511
Fig. 2 Percentage of LOH results of six microsatellite markers on 13q33-34 in 30 cases of bladder cancer
Mutation screening of ING1 Exons 1a, 1b and 2 of ING1 gene were amplified via PCR and subjected to SSCP analysis. Aberrantly migrating bands were picked and sequenced by ABI 3130 sequence analyzer. However, no mutational changes in the exons of ING1 were observed. Expression analysis of ING1 gene and correlation with LOH status of 13q33-34 Tumor samples compared to non-tumors and in 6 of 30 (23.3 %) cases lower expression of ING1 mRNA were observed (Fig. 4). While the ING1 expression level was lower in patients 7, 9, 16, 18, 19, 30, the patient 10 showed higher expression. Of these patients only patient 16 had the loss of heterozygosity in the region screened by the marker D13S285 (Table 1). For the patients 7, 9, 18, 19, 30, it is believed that the underlying cause of lower expression is hypermethylation of ING1 promoter. Since we did not have sufficient amount of DNA sample for bisulfite conversion, it was not possible to analyze the methylation status of ING1 promoter in our patient group. As a result, in terms of ING1 expression levels, no significant association with bladder carcinoma was observed (p [ 0.05, Mann–Whitney test and Wilcoxon Signed-Rank test). Prediction of regulatory elements of ING1 promoter Genomatix-MatInspector and TFSEARCH softwares’ results were consistent with each other. Several numbers of factors and elements were obtained from both of the softwares. Thereafter these factors were eliminated depending on the literature knowledge combined at NCBI_OMIM database [28]. As a result, some of these proteins such as ABL, E2F, HIF1, SOX, P53, BPTF, NRSF, c-Rel and c-ETS are found functionally associated factors with cancer [28]. Their predicted binding sites at the promoter region of ING1 are seen in the Fig. 5.
123
512
Mol Biol Rep (2015) 42:507–516
Fig. 3 Physical mapping of the DS markers: D13S779, D13S158, D13S278, D13S796, D13S1315 and D13S285 on chromosome 13. The locations of the markers and genes are shown depending on mapping information derived from National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov)
Mutation analysis of p53 rs17882155 (CCC [ CGC; Pro [ Arg) was observed in exon 4 of all normal and tumor samples. This SNP was prominent in our study group. In exon 8, a two-nucleotide deletion (18788delAA) (Fig. 6) was observed in the tumor sample of patient 5 (NCBI access: NG_017013.1, GI: 293651587). It should be noted that patient 5 had no loss of heterozygosity at 13q33-34 region and no alteration in the
123
level of ING1 mRNA expression. Detected p53 mutation in patient 5 might have given rise to cancer development.
Discussion Using the expression selection of transforming genetic suppressor elements (GSE) approach, the ING1 gene has been suggested to be a candidate tumor suppressor gene
Mol Biol Rep (2015) 42:507–516
Fig. 4 Gel image of expression analysis. Agarose gel electrophoresis of amplified cDNAs of ING1 (135 bp) and GAPDH (456 bp) genes. M: 100 bp marker
[20]. After characterization of ING1 gene, several studies were performed in order to understand the biolological importance of it. Suggested tumor suppressive functions of ING1 gene are G1 cell cycle arrest, senescence, chemosensitivity, apoptosis and, anchorage-dependent growth [29]. In order to observe the alterations in gene expressions that occur in the development of bladder cancer, a study [30] comparing gene expression levels revealed that expression levels of genes: p33ING1, neuropilin-2, cytokeratin 20, and p21 were significantly associated with tumor grade, pathological stage, and also the altered expression of retinoblastoma gene. Additionally, p33ING1 gen expression was found to be associated with survival [30]. That was the sole study demonstrating a relationship between ING1 gene and bladder carcinoma. Loss of long arm of chromosome 13 is a frequent event in several cancer types [31]. In this study, loss of heterozygosity of the chromosomal region 13q33-34, gene expression of ING1 gene, and the mutations of ING1 and p53 were investigated using molecular techniques. Following the identification of ING1 gene as a candidate tumor suppressor gene [20], implications of ING1 in several cancer types were studied using both tumor samples and cancer cells and ING1 gene expression has been proved to be downregulated or lost. However mutation in ING1 gene occurs rarely. In this respect, mutation in ING1 gene is not the main reason for inactivation of ING1 gene in our patient group. Alternative mechanisms were commonly discussed like methylation status of ING1 promoter, haploinsuffiency, chromatine remodeling or miRNA expression [11]. Herein we report that D13S1315 and D13S285 markers showed loss of heterozygosity at the 13q33-34 region at rates of 23.3, 20 %, respectively.
513
However, we did not observe any somatic mutation in the exons of ING1. Hence; it is obvious that ING1 is probably not the relevant tumor suppressor gene involved in the progression of bladder carcinoma. High rates of loss of heterozygosity between the regions D13S1315 and D13S285 are associated with bladder cancer and suggest the existence of other candidate gene or genes in this region. Chromosome 13q33-34 region contains several genes including IRS2, COL4A1, COL4A2, RAB20, CARKD, CARS2, ING1, RPL21P107, ANKRD10, PARP1P1, ARFGEF7, SOX1. Toujani and coworkers [32] performed a genome-wide analysis of chromosomal alterations in Burkitt’s lymphoma. In three tumors, they observed a 10 megabases loss in the chromosome 13q33.q34 region containing more than 30 genes. Among those are ING1, COL4A2, COL4A1, RAB20, LIG4 (Ligase 4), TNFSF13B [tumor necrosis factor (ligand) superfamily, member 13b], EFNB2 (ephrin-B2), ERCC5 (excision repair cross complementation group 5), FGF14 (fibroblast growth factor 14), PCCA (propionyl CoA carboxylase, alpha polypeptide), SLC10A2 [solute carrier family 10 (sodium/bile acid cotransporter family), member 2], IRS2, ARHGEF7, ANKRD10. Findings of Toujani and coworkers are consistent with ours. Depending on a literature review, we believe that COL4A1, COL4A2 and SOX1 genes might be associated with bladder carcinoma. These genes might be candidate tumor suppressors and contribute to bladder cancer pathogenesis. However, further analysis is required. Type IV collagen is one of the main macromolecular components of basement membrane [33]. Basement membranes not only act as a mechanical support, but also affect cellular behaviours such as proliferation and differentiation [34]. COL4A1 and COL4A2 are the most abundant type IV collagens. Some noncollagenous (NC) domains of type IV collagen inhibits angiogenesis, tumor growth, proliferation and migration [35, 36]. Sisci et al. [37], demonstrated that in MCF-7 and in MDA-MB-231 cell lines expressing ERa, cell adhesion on fibronectin and type IV Collagen induces ERa-mediated transcription and reduces cell migration. Recently, Assadian and coworkers showed that p53 inhibits angiogenesis by inducing the production of Arresten, a collagen-derived antiangiogenic factor (CDAF) that is processed from a1 collagen IV [38]. p53 induces expression level of COL4A1 and release of Arresten containing fragments from the ECM [31]. COL4A1 and COL4A2 are aligned head-to-head in terms of chromosomal location and their expression is regulated by bidirectional promoters between the genes [39]. COL4A2 gene encodes the alpha-2 chain of type IV collagen. According to Kamphaus and coworkers’ study [40] Canstatin, a 24-kDa peptide derived from the noncollagenous (NC1) domain of the a-2 chain of type IV
123
514 Fig. 5 The binding sites of several factors on ING1 promoter are illustrated based on the information obtained from Genomatix-MatInspector and TFSEARCH softwares. The names of the relevant factors are written in red, and binding regions are shown in grey boxes. Nucleotide sequence of ING1 promoter was obtained from National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). (Color figure online)
123
Mol Biol Rep (2015) 42:507–516
Mol Biol Rep (2015) 42:507–516
Fig. 6 Two-nucleotide deletion (18788delAA) in the exon 8 of p53 gene obtained by direct sequence analysis. Arrow in tumor sample indicates the point in which deletion occurred
collagen, had an inhibitory effect on murine endothelial cell tube formation, human endothelial cell migration, endothelial cell proliferation and induced apoptosis. Antiangiogenic effects of canstatin were also showed by several researchers [41, 42]. Combining the findings of our study and the recent studies about the type 4 collagen, COL4A1 and COL4A2 might be tumor suppressor genes in bladder cancer pathogenesis. However, further analysis is needed. SOX1 (SRY-BOX 1) is an important transcription factor during developmental process. We do not have sufficient information about the roles of transcription factors in cancer. In a recent study it is revealed that expression of SOX1 reduces the tumor formation of neural precursors after neural stem cell transplantation [43]. Additionally, according to the results of online promoter finder programs, Genomatix and TFSEARCH, SOX1 has a binding region in ING1 promoter (Fig. 5). SOX1 is likely to be another tumor suppressor gene in bladder carcinogenesis. The relationship between bladder cancer and COL4A1, COL4A2 and SOX1 genes warrants further analysis. The computational analysis of ING1 promoter also brought out a great number of factors. Among them, depending on a literature review, ABL, E2F, HIF1, SOX, P53, BPTF, NRSF, c-Rel and c-ETS are found the remarkable factors associated with different cancer types. Mutations in the gene region of these factors can lead inactivation of ING1. However more studies are needed in order to fully establish the status of the promoter and its interest. p53 is a nuclear phosphoprotein that functions at the G1S checkpoint of cell cycle and has an important role in controlling urothelial cell growth and maintaining genomic stability [44]. Mutations and/or deletions in this tumor
515
suppressor gene are common genetic changes in human urothelial cell carcinoma [45]. In our study, it was seen that one patient has a two-nucleotide deletion (18788delAA) in exon 8. Since deletions lead to a shift in open reading frame, the following amino acids after deletion point change to the new ones. Additionally rs17882155 (CCC [ CGC; Pro [ Arg) was detected in exon 4 of all participants. But, there was no significant asociation between this SNP and bladder carcinoma. In conclusion, according to our preliminary study, LOH results of chromosome 13q33-34 region suggest that the region is likely to contain candidate tumor suppressor gene/ genes. ING1 gene was not seemed to be involved in developing bladder cancer in our Turkish population. Studies in larger populations are needed to confirm these results, and further studies are required to verify these findings in different ethnic groups. Acknowledgments This study was supported by a research project (TF.10.16) from Gaziantep University Scientific Research Projects Governing Unit. We also would like to thank Prof. Celaletdin Camci from the Department of Oncology, University of Gaziantep, for his valuable support and contribution in several stages of the study.
References 1. http://www.kanser.gov.tr/folders/file/8iL-2006-SON.pdf. Accessed 4 May 2010 2. Botteman MF, Pashos CL, Redaelli A, Laskin B, Hauser R (2003) The health economics of bladder cancer: a comprehensive review of the published literature. Pharmacoeconomics 21:1315–1330 3. Evans HJ, Prosser J (1992) Tumor-suppressor genes: cardinal factors in inherited predisposition to human cancers. Environ Health Perspec 98:25–37 4. Knudson AG (1971) Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA 68:820–823 5. Grønbaek K, Hother C, Jones PA (2007) Epigenetic changes in cancer. APMIS 115:1039–1059 6. Hinds PW, Weinberg RA (1994) Tumor suppressor genes. Curr Opin Genet Dev 4:135–141 7. Yokota J, Sugimura T, Terada M (1991) Chromosomal localization of putative tumor-suppressor genes in several human cancers. Environ Health Perspect 93:121–123 8. Walczak-Sztulpa J, Wisniewska M, Latos-Bielenska A, Linne´ M, Kelbova C, Belitz B, Pfeiffer L, Kalscheuer V, Erdogan F, Kuss AW, Ropers HH, Ullmann R, Tzschach A (2008) Chromosome deletions in 13q33-34: report of four patients and review of the literature. Am J Med Genet A 146(3):337–342 9. Vats KR, Ishwad C, Singla I, Vats A, Ferrell R, Ellis D, Moritz M, Surti U, Jayakar P, Frederick DR, Vats AN (2006) A locus for renal malformations including vesico-ureteric reflux on chromosome 13q33-34. J Am Soc Nephrol 17(4):1158–1167 10. Chen L, Matsubara N, Yoshino T, Nagasaka T, Hoshizima N, Shirakawa Y, Naomoto Y, Isozaki H, Riabowol K, Tanaka N (2001) Genetic alterations of candidate tumor suppressor ING1 in human esophageal squamous cell cancer. Cancer Res 61(11):4345–4349 11. Gunduz M, Ouchida M, Fukushima K, Hanafusa H, Etani T, Nishioka S, Nishizaki K, Shimizu K (2000) Genomic structure of the human ING1 gene and tumor-specific mutations detected in
123
516
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24. 25.
26. 27. 28. 29. 30.
Mol Biol Rep (2015) 42:507–516 head and neck squamous cell carcinomas. Cancer Res 60(12): 3143–3146 Luo J, Balkin N, Stewart JF, Sarwark JF, Charrow J, Nye JS (2000) Neural tube defects and the 13q deletion syndrome: evidence for a critical region in 13q33-34. Am J Med Genet 91(3):227–230 Ried T, Petersen I, Holtgreve-Grez H, Speicher MR, Schro¨ck E, du Manoir S, Cremer T (1994) Mapping of multiple DNA gains and losses in primary small cell lung carcinomas by comparative genomic hybridization. Cancer Res 54(7):1801–1806 Mao X, Lillington DM, Czepulkowski B, Young BD, RussellJones R, Whittaker S (2001) A case of adult T-cell leukaemia/ lymphoma characterized by multiplex-fluorescence in situ hybridization, comparative genomic hybridization, fluorescence in situ hybridization and cytogenetics. Br J Dermatol 145(1): 117–122 Morohara K, Tajima Y, Nakao K, Nishino N, Aoki S, Kato M, Sakamoto M, Yamazaki K, Kaetsu T, Suzuki S, Tsunoda A, Tachikawa T, Kusano M (2006) Gastric and intestinal phenotypic cell marker expressions in gastric differentiated-type carcinomas: association with E-cadherin expression and chromosomal changes. J Cancer Res Clin Oncol 132(6):363–375 Garkavtsev I, Boucher Y (2005) An intact ING1-P53 pathway can potentiate the cytotoxic effects of taxol. Cancer Biol Ther 4(1):48–49 Gong W, Suzuki K, Russell M, Riabowol K (2005) Function of the ING family of PHD proteins in cancer. Int J Biochem Cell Biol 37:1054–1065 Russell M, Berardi P, Gong W, Riabowol K (2006) Grow-ING, Age-ING and Die-ING: ING proteins link cancer, senescence and apoptosis. Exp Cell Res 312:951–961 Campos EI, Chin MY, Kuo WH, Li G (2004) Biological functions of the ING family tumor suppressors. Cell Mol Life Sci 61:2597–2613 Garkavtsev I, Kazarov A, Gudkov A, Riabowol K (1996) Suppression of the novel growth inhibitor P33 ING1 promotes neoplastic transformation. Nat Genet 14:415–420 Doyon Y, Cayrou C, Ullah M, Landry AJ, Coˆte´ V, Selleck W, Lane WS, Tan S, Yang XJ, Coˆte´ J (2006) ING tumor suppressor proteins are critical regulators of chromatin acetylation required for genome expression and perpetuation. Mol Cell 21:51–64 Zeremski M, Horrigan SK, Grigorian IA, Westbrook CA, Gudkov AV (1997) Localization of the candidate tumor suppressor gene ING1 to human chromosome 13q34. Somat Cell Mol Genet 23:233–236 Ythier D, Larrieu D, Brambilla C, Brambilla E, Pedeux R (2008) The new tumor suppressor genes ING: genomic structure and status in cancer. Int J Cancer 123:1483–1490 http://www.ncbi.nlm.nih.gov/unists. Accessed 13 June 2009 Igci YZ, Arslan A, Akarsu E, Erkilic S, Igci M, Oztuzcu S, Cengiz B, Gogebakan B, Cakmak EA, Demiryurek AT (2011) Differential expression of a set of genes in follicular and classic variants of papillary thyroid carcinoma. Endocr Pathol 22:86–96 http://www.genomatix.de. Accessed 10 Jan 2010 http://www.cbrc.jp/research/db/TFSEARCH.html. Accessed 10 Jan 2010 http://www.ncbi.nlm.nih.gov/omim. Accessed 15 Jan 2010 Cheung KJ Jr, Li G (2001) The tumor suppressor ING1: structure and function. Exp Cell Res 268:1–6 Sanchez-Carbayo M, Socci ND, Lozano JJ, Li W, Charytonowicz E, Belbin TJ, Prystowsky MB, Ortiz AR, Childs G, Cordon-
123
31.
32.
33. 34.
35.
36.
37.
38.
39.
40.
41. 42.
43.
44. 45.
Cardo C (2003) Gene discovery in bladder cancer progression using cDNA microarrays. Am J Pathol 163:505–516 Stanbridge EJ (1992) Functional evidence for human tumour suppressor genes: chromosome and molecular genetic studies. Cancer Surv 12:5–24 Toujani S, Dessen P, Ithzar N, Danglot G, Richon C, Vassetzky Y, Robert T, Lazar V, Bosq J, Da Costa L, Perot C, Ribrag V, Patte C, Wiels J, Bernheim A (2009) High resolution genomewide analysis of chromosomal alterations in Burkitt’s lymphoma. PLoS One 17(4):e7089 Timpl R (1996) Macromolecular organization of basement membranes. Curr Opin Cell Biol 8:618–624 Maeshima Y, Colorado PC, Torre A, Holthaus KA, Grunkemeyer JA, Ericksen MB, Hopfer H, Xiao Y, Stillman IE, Kallurii R (2000) Distinct antitumor properties of a type IV collagen domain derived from basement membrane. J Biol Chem 275: 21340–21348 Colorado PC, Torre A, Kamphaus G, Maeshima Y, Hopfer H, Takahashi K, Volk R, Zamborsky ED, Herman S, Sarkar PK, Ericksen MB, Dhanabal M, Simons M, Post M, Kufe DW, Weichselbaum RR, Sukhatme VP, Kalluri R (2000) Anti-angiogenic cues from vascular basement membrane collagen. Cancer Res 60:2520–2526 Pedchenko V, Zent R, Hudson BG (2004) Alpha(v)beta3 and alpha(v)beta5 integrins bind both the proximal RGD site and nonRGD motifs within noncollagenous (NC1) domain of the alpha3 chain of type IV collagen: implication for the mechanism of endothelial cell adhesion. J Biol Chem 279:2772–2780 Sisci D, Aquila S, Middea E, Gentile M, Maggiolini M, Mastroianni F, Montanaro D, Ando` S (2004) Fibronectin and type IV collagen activate ERalpha AF-1 by c-Src pathway: effect on breast cancer cell motility. Oncogene 23:8920–8930 Assadian S, El-Assaad W, Wang XQ, Gannon PO, Barre`s V, Latour M, Mes-Masson AM, Saad F, Sado Y, Dostie J, Teodoro JG (2012) p53 inhibits angiogenesis by inducing the production of Arresten. Cancer Res 72:1270–1279 Sado Y, Kagawa M, Naito I, Ueki Y, Seki T, Momota R, Oohashi T, Ninomiya Y (1998) Organization and expression of basement membrane collagen IV genes and their roles in human disorders. J Biochem 123:767–776 Kamphaus GD, Colorado PC, Panka DJ, Hopfer H, Ramchandran R, Torre A, Maeshima Y, Mier JW, Sukhatme VP, Kalluri R (2000) Canstatin, a novel matrix-derived inhibitor of angiogenesis and tumor growth. J Biol Chem 275:1209–1215 Narazaki M, Tosato G (2006) Canstatin: an inhibitor of angiogenesis and tumor growth revisited. Cancer J 12:110–112 Li YY, Qian GS, Huang GJ, Chen F, Qian P, Yu SC, Wang CZ, Li Q, Wang JC, Wu GM (2006) Enhancement of antiangiogenic effects of human canstatin with a hypoxia-regulated transgene vector in lung cancer model. Cancer J 12:136–146 Fukuda H, Takahashi J, Watanabe K, Hayashi H, Morizane A, Koyanagi M, Sasai Y, Hashimoto N (2006) Fluorescence-activated cell sorting based purification of embryonic stem cellderived neural precursors averts tumor formation after transplantation. Stem Cells 24:763–771 Levine AJ (1997) p53, the cellular gatekeeper for growth and division. Cell 88:323–331 Wu XR (2005) Urothelial tumorigenesis: a tale of divergent pathways. Nat Rev Cancer 5:713–725
