Low Expression of lncRNA-GAS5 Is Implicated in ... - Semantic Scholar

RESEARCH ARTICLE

Low Expression of lncRNA-GAS5 Is Implicated in Human Primary Varicose Great Saphenous Veins Li Li1,2,3,4☯, Xiang Li5☯, Erlinda The1,2,6☯, Li-Jie Wang1,6☯, Tian-You Yuan1,6, Shi-Yi Wang1,6, Jing Feng6, Jing Wang6, Yuan Liu1,6, Ya-Han Wu1,2,6, Xiu-E Ma1,6, Jin Ge7, YingYu Cui2,3,4*, Xiao-Yan Jiang2,3,4* 1 Research Center for Translational Medicine, East Hospital, Tongji University School of Medicine, Shanghai 200120, China, 2 Key Laboratory of Arrhythmias of the Ministry of Education of China, Tongji University School of Medicine, Shanghai 200092, China, 3 Institute of Medical Genetics, Tongji University, Shanghai 200092, China, 4 Department of Pathology and Pathophysiology, Tongji University School of Medicine, Shanghai 200092, China, 5 Department of Cardiology, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China, 6 Department of Cardiology, East Hospital, Tongji University School of Medicine, Shanghai 200120, China, 7 Department of Vascular Surgery, East Hospital, Tongji University School of Medicine, Shanghai 200120, China

OPEN ACCESS Citation: Li L, Li X, The E, Wang L-J, Yuan T-Y, Wang S-Y, et al. (2015) Low Expression of lncRNAGAS5 Is Implicated in Human Primary Varicose Great Saphenous Veins. PLoS ONE 10(3): e0120550. doi:10.1371/journal.pone.0120550 Academic Editor: Qiong Wu, Harbin Institute of Technology, CHINA Received: October 29, 2014 Accepted: January 23, 2015 Published: March 25, 2015 Copyright: © 2015 Li et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: This work was supported by the General Program of National Natural Science Foundation of China (81100551, to Xiao-Yan Jiang; 81270231, to Li Li), and the Fundamental Research Funds for the Central Universities (1500219042, to Xiao-Yan Jiang). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist.

☯ These authors contributed equally to this work. * [email protected] (X-YJ); [email protected] (Y-YC)

Abstract The cellular mechanisms of primary varicose great saphenous veins (GSVs) involve inflammation, apoptosis, and proliferation of local cells and extracellular matrix degradation. Long non-coding RNAs (lncRNAs) play important roles in these cellular processes; however, which and how lncRNAs related to these mechanisms take effect on GSVs remain unclear. By screening lncRNAs that might experience changes in GSV varicosities, we selected the lower expressed lncRNA-GAS5 (growth arrest specific transcript 5) for functional assessments. Silencing of lncRNA-GAS5 promoted cell proliferation and migration, and cell cycle of the human saphenous vein smooth muscle cells (HSVSMCs), whereas overexpressing it inhibited these cellular behaviors and reduced apoptosis of HSVSMCs. RNA pull-down experiment revealed a direct bind of lncRNA-GAS5 to a Ca2+-dependent RNA-binding protein, Annexin A2. Further experiments showed that silencing of Annexin A2 reduced the HSVSMCs proliferation and vice versa. In the context of lncRNA-GAS5 knockdown, silencing of Annexin A2 reduced the proliferation of HSVSMCs while overexpression of Annexin A2 increased the proliferation. Thus, the low expression of lncRNA-GAS5 may facilitate HSVSMCs proliferation and migration through Annexin A2 and thereby the pathogenesis of GSV varicosities.

Introduction Varicose veins, with leg edema, chronic and disabling venous ulceration, affect 25% adult population and lead to considerable morbidity and cost of health service resources, while great

PLOS ONE | DOI:10.1371/journal.pone.0120550 March 25, 2015

1 / 16

lncRNA-GAS5 in Human Primary Varicose Great Saphenous Veins

saphenous veins (GSVs) or saphenofemoral junction account for about 70% of varicose veins [1–3]. The pathogenesis processes of GSVs are associated with leukocyte diapedesis and local inflammation, smooth muscle cell (SMC) apoptosis and proliferation, extracellular matrix degradation, and endothelial cell injury, which result in venous valvular dysfunctions that cause blood reflux, vein wall tension increase, vein wall dilation and tissue remodeling [3,4,5]. However, the molecular pathways involved in these processes remain elusive. Some protein molecules such as HIF-1 alpha [6], Janus-kinase/signal transducers [7], poly ADP ribose polymerase (PARP) [8], and intercellular adhesion molecule 1 [9] were involved in the pathogenesis processes of GSVs. Recently, using genome-wide screening and subsequently q-RT-PCR validations, we found six lncRNAs (AF119885, AK021444, NR_027830, G36810, NR_027927, and uc.345-) aberrantly expressed in GSVs, suggesting lncRNAs might be involved in the pathogenesis processes of GSVs [10]. In the present study, we selected lncRNAs relating to cell proliferation, growth, apoptosis, tumor genesis and vascular disease in lncRNAdb database, which provides detailed lncRNA information, including sequences, functions, expressions, associated proteins and cellular locations [11], to observe which and how long non-coding RNAs (lncRNAs) take effects on the pathology of GSVs. This study helps identify novel molecular mechanisms involved in the pathogenesis of GSVs.

Materials and Methods Patients and tissue samples Fifty-three samples of human primary great saphenous veins (GSVs) were retrieved from 53 patients (25 males, 28 females) who were undergoing GSVs varicose vein excision in Shanghai East Hospital, Tongji University School of Medicine, China. The diagnosis of primary varicose GSVs was based on the clinical signs and duplex ultrasound scanning. All patients were characterized as having primary varicosities. The exclusion criteria, classification criteria, and ultrasound scanning assessment were described in details previously [10]. According to clinical, etiological, anatomical and pathological elements classification system (CEAP) [12,13], the subjects were class 4–6 GSVs, with 51 of the subjects in class 4, one in class 5 and one in class 6. The clinical demographic characteristics and clinical risk factors of the subjects are given in Table 1. The methods to prepare paired tissues were described in detail previously [10]. The tissues were then snap-frozen into liquid nitrogen immediately after resection for later RNA extraction. A fraction of NV tissues were used to isolate and culture the human saphenous vein smooth muscle cells (HSVSMCs). Written informed consent was obtained from all participants. The study was approved by the Human Ethics Committee of Shanghai East Hospital, Tongji University School of Medicine (NO.: 2011-DF-53).

Screening of differentially expressed lncRNAs Long noncoding RNA database (lncRNAdb,http://lncrnadb.com/) is a database providing comprehensive annotations of eukaryotic long non-coding RNAs. We analyzed the structure, expression levels and functions of all the 111 human species lncRNAs in the lncRNAdb in August, 2011 and filtered the candidate lncRNAs which may be related to the pathophysiological processes of primary varicose veins using the key words such as cell proliferation, growth, apoptosis, tumor genesis and vascular disease. Each full sequence of the filtered candidate lncRNAs was searched by UCSC Genome Browser Home and inputed into the Roche Applied Science: Universal Probe Library System—Assay Design Center (https://www.roche-applied-science. com) [14] to design proper probes and primers for the Q-RT-PCR.


2 / 16


Table 1. The clinical information of 53 patients involved in the study. Male

Female

Total

Patients number of gender

25

28

53

Age±SD (years)

56.5±10.0

56.1±7.7

56.3±8.7

Course of CVI (years)

11.2±7.4

8.9±8.2

10.0±7.8

Hypertension

9

6

15

Parkinson

1

1

2

Gastric ulcer

0

1

1

Diabetes

1

0

1

left limb

11

6

17

right limb

12

13

25

double limbs

2

9

11

Class 6

1

0

1

Class 5

1

0

1

Class 4

23

28

51

Specialist physic examination

Perthes test (-)

25

28

53

Duplex ultrasound scanning

Deep venous thrombosis

0

2

2

Valve insufﬁciency of GSV

25

28

53

Reﬂux of GSV

25

28

53

Previous chronic illnesses

Limbs of Surgery

CEAP grade

doi:10.1371/journal.pone.0120550.t001

Total RNA was extracted from frozen vein specimens of 53 pairs of samples using TRIzol reagent (Invitrogen Life Technologies) and then reverse transcribed using a PrimeScript RT Reagent Kit (Takara) according to the manufacturer’s instructions. LncRNA expression in VV and paired NV tissues was measured by Q-RT-PCR using Power SYBR Green PCR Master Mix (Applied Biosystems) on the ABI PRISM 7900 Sequence Detection System (SDS) instrument which were described in detail previously [10]. All experiments were performed in triplicate.

Isolation and culture of the human saphenous vein smooth muscle cells (HSVSMCs) The HSVSMCs were successfully isolated by tissue explant outgrowth [15] (S2 Fig.).The human saphenous vein tissures were put into the high glucose DMEM (Hyclone) containing 10%FBS (GIBCO) and 100X Penicillin-Streptomycin (GIBCO) immediately after resection from the patients in the operating room. The tissues were transported into the laboratory on the ice, and were dissected in the super clean bench. The tunica media were stripped and cut into pieces (1mm3). The tissues pieces were mixed with FBS and evenly attached to the bottom of the 25 cm2 flask with 1cm intervals. The flasks were incubated at 37°C in a 5% CO2 humidified incubator and cannot be moved in the first 3 days, then the culture medium were changed every 3 days. After one month of cultivation, HSVSMCs were almost growing a confluent layer (S2 Fig.), and then were subcultured. HSVSMCs of the fifth generation were identified by staining with immunofluorescence (S3 Fig.). The growth characteristics of HSVSMCs were studied. The cell survival rate was 96.5% tested by the Trypan Blue. The growth curve of HSVSMCs (S4 Fig.) was shown according to the cytometry. The HSVSMCs proliferation activity (S5 Fig.) was detected by cell counting kit-8 (CCK-8) (Beyotime, Jiangsu, China) [16], its growth increased significantly during the 3–5 days, and indicated a proliferative time of HSVSMCs growth. The HSVSMCs migration activity detected by scratching. The 5–12 passages HSVSMCs were used for functional study.


3 / 16


Proliferation, migration, apoptosis and cell cycle of HSVSMCs affected by lncRNA-GAS5 Three different lncRNA-GAS5 siRNAs (small interfering RNAs) were designed by Shanghai GenePharma Company according to the full sequence of lncRNA-GAS5 (NR_002578.2) in NCBI. The siRNAs ID were GAS5-homo-385, GAS5-homo-204, and GAS5-homo-151. Negative-control and positive-control siRNA were also purchased from Shanghai GenePharma Company. The siRNAs were transfected into HSVSMCs according to the manufacturer’s instructions by Lipofectamin RNAiMAX (Invitrogen). The full sequence of lncRNA-GAS5 (631nt, excluding the 20nt polyA) were cloned into the expression vector pCMV-N-Flag and transfected into HSVSMCs according to the manufacturer’s instructions by Lipofectamine 2000 (Invitrogen). The transfection efficiencies (fluorescently labelled cells after 48 hours) were 70–80%. The analysis of specific silencing or overexpression of lncRNA-GAS5 expression was carried out after 48 hours, using Q-RT-PCR. The lncRNA-GAS5 primers were humanGAS5-F(5'to3'): cttgcctggaccagcttaat; human-GAS5-R (5'to3'): caagccgactctccatacct. To assess the proliferation, migration, apoptosis and cell cycle of HSVSMCs when silencing or overexpression of lncRNA-GAS5. The proliferation abilities of HSVSMCs were measured using CCK-8 kit (Beyotime, Jiangsu, China) and EDU kit (RiboBio, Guangzhou,China) [17] according to the manufacturer’s instructions. As a proliferation inhibitor, rapamycin was used to inhibit the proliferation abilities of normal HSVSMCs to make the proliferation abilities changes more significant [18]. The concentration of rapamycin used in the study were 0,100 and 200ng/ml, and the action time of rapamycin were 48 hours. Cell scratch test and Transwell (BD) were used to measure the migration abilities of HSVSMCs. After transfected by lncRNA-GAS5 siRNA for 48 hours, the HSVSMCs were passage into the Transwell Inserts. Then 4 hours, 7 hours, 10 hours later, the migration HSVSMCs were photographed and counted, respectively. The migration abilities of HSVSMCs were reflected indirectly by the new migration cells counting with Transwell. The apoptosis of HSVSMCs were measured by Flow Cytometry using Annexin V-FITC apoptosis kit (Beyotime, Jiangsu, China) [19] according to the manufacturer’s instructions. Moreover, p27-kip1 and p21-cip1, two negative regulatory factors of Cyclin Dependent Kinase, which could inhibite the process of cell cycle acting as antagonist of Cyclin [20], were choosen to reflect cell cycle changes indirectly. The p27-kip1and p21-cip1 mRNA expression level were measured by Q-RT-PCR.

RNA pulldown assay and matrix-assisted laser desorption/ ionization time of flight mass spectrometry (MALDI-TOF-MS) RNA pull-down assay [21] was used to find the proteins bonding to lncRNA-GAS5 directly. Briefly, the biotin-labeled full length lncRNA-GAS5 RNA and antisense lncRNA-GAS5 RNA were transcribed in vitro with the Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Roche), treated with RNase-free DNase I (Roche), recycled with QIA quick Nucleotide Removal Kit(Qiagen) and purified with the RNeasy Mini Kit (Qiagen). HSVSMCs proteins were extracted using the RIPA (Beyotime) and protease inhibitor cocktail (Roche). One milligram of HSVSMCs proteins was then mixed with 3ug of biotin-labeled lncRNA-GAS5 RNAs incubated at 4C for 1 hour. Thirty microliters of washed streptavidin agarose beads (Invitrogen) were washed by 100ul RIPA buffer(Sigma), then added to each binding reaction and further incubated at room temperature for 1 hour. Beads were washed by DEPC-treated PBS briefly three times and boiled in sodium dodecyl sulfate buffer at 100C for 10 minutes, and the retrieved protein was visualized by an SDS-PAGE gel electrophoresis (Beyotime, Jiangsu, China) [22] and silver staining technique (Beyotime, Jiangsu, China) [23]. The Specific differently stained


4 / 16


gel pieces were cut down and Proteins in gel pieces were identified by MALDI-TOF-MS with the help of Shanghai Boyuanbio Company.

Statistical analysis All the statistical analyses were performed using SPSS version 18.0 software (SPSS). For Q-RT-PCR analysis, all samples were normalized to GAPDH. The mean value in each triplicate was used to calculate relative lncRNAs concentrations (ΔCt = Ct mean lncRNAs-Ct mean GAPDH). Expression fold changes were calculated using 2-ΔΔCt methods. For comparisons, independent-samples Student’s t-tests and one-way analysis of variance were performed. The value of P