Campylobacter jejuni or Campylobacter coli based on the results of the hippurate biochemical .... that macrolide resistance in C. jejuni and C. coli isolates may.
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, July 2005, p. 2753–2759 0066-4804/05/$08.00⫹0 doi:10.1128/AAC.49.7.2753–2759.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 49, No. 7
Macrolide Resistance in Campylobacter jejuni and Campylobacter coli: Molecular Mechanism and Stability of the Resistance Phenotype Amera Gibreel,1 Veronica N. Kos,1 Monika Keelan,2,3 Cathy A. Trieber,4 Simon Levesque,5 Sophie Michaud,5 and Diane E. Taylor1,6* Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada1; Laboratory for Foodborne Zoonoses, Population and Public Health Branch, Health Canada, Ontario, Canada2; Department of Laboratory Medicine and Pathology, University of Alberta, Edmonton, Alberta, Canada3; Department of Biochemistry, University of Alberta, Edmonton, Alberta, Canada4; Department of Microbiology and Infectious Diseases, Faculty of Medicine, University of Sherbrooke, Sherbrooke, Quebec, Canada,5 and Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canada6 Received 15 October 2004/Returned for modification 19 December 2004/Accepted 15 March 2005
A collection of 23 macrolide-resistant Campylobacter isolates from different geographic areas was investigated to determine the mechanism and stability of macrolide resistance. The isolates were identified as Campylobacter jejuni or Campylobacter coli based on the results of the hippurate biochemical test in addition to five PCR-based genotypic methods. Three point mutations at two positions within the peptidyl transferase region in domain V of the 23S rRNA gene were identified. About 78% of the resistant isolates exhibited an A3G transition at Escherichia coli equivalent base 2059 of the 23S rRNA gene. The isolates possessing this mutation showed a wide range of erythromycin and clarithromycin MICs. Thus, this mutation may incur a greater probability of treatment failure in populations infected by resistant Campylobacter isolates. Another macrolideassociated mutation (A3C transversion), at E. coli equivalent base 2058, was detected in about 13% of the isolates. An A3G transition at a position cognate with E. coli 23S rRNA base 2058, which is homologous to the A2142G mutation commonly described in Helicobacter pylori, was also identified in one of the C. jejuni isolates examined. In the majority of C. jejuni isolates, the mutations in the 23S rRNA gene were homozygous except in two cases where the mutation was found in two of the three copies of the target gene. Natural transformation demonstrated the transfer of the macrolide resistance phenotype from a resistant Campylobacter isolate to a susceptible Campylobacter isolate. Growth rates of the resulting transformants containing A-20583C or A-20593G mutations were similar to that of the parental isolate. The erythromycin resistance of six of seven representative isolates was found to be stable after successive subculturing in the absence of erythromycin selection pressure regardless of the resistance level, the position of the mutation, or the number of the mutated copies of the target gene. One C. jejuni isolate showing an A-20583G mutation, however, reverted to erythromycin and clarithromycin susceptibility after 55 subcultures on erythromycin-free medium. Investigation of ribosomal proteins L4 and L22 by sequence analysis in five representative isolates of C. jejuni and C. coli demonstrated no significant macrolide resistance-associated alterations in either the L4 or the L22 protein that might explain either macrolide resistance or enhancement of the resistance level. isolates of animal origin, especially C. coli from pigs and C. jejuni and C. coli from poultry (2, 7, 47, 53,) (S. Levesque and S. Michaud, Abstr. 12th International Workshop of Campylobacter, Helicobacter, and Related Organisms, abstr. F-45, 2003). As the potential exists for these isolates to be transmitted to humans, the presence of macrolide-resistant isolates in the food chain has raised concerns that the treatment of human infections will be compromised. Therefore, the public health effects of antibiotic use in agriculture practice, including the resistance of C. jejuni and C. coli to macrolides, should be estimated. Furthermore, macrolide resistance may be selected for during the course of antibiotic treatment in humans (13), although the rate of incidence with C. jejuni is lower than that with C. coli (36). Macrolides such as erythromycin (Ery) and clarithromycin (Cla) act by binding to the 50S subunits of bacterial ribosomes and interfere with protein synthesis by inhibiting the elongation of peptide chains (51). Generally, the resistance of different bacterial species to macrolides has been reported to be associated with target site alteration, antibiotic modification,
Campylobacter species are one of the most common causes of bacterial diarrhea in humans worldwide (43). Two Campylobacter species are usually associated with most of the infections in humans: Campylobacter jejuni and Campylobacter coli (43). Infections are generally self-limiting, with symptoms resolving in about 3 to 5 days (1, 4). Nevertheless, antibiotic therapy is required in immunocompromised patients, in the case of bacteremia, and in severe and long-lasting Campylobacter infections (1, 4). Erythromycin and fluoroquinolones are the antimicrobial agents commonly used to treat severe infections caused by Campylobacter species (5, 6), although the broad use of these drugs has raised concerns related to the development of antimicrobial resistance (35, 38). Resistance to macrolides is more prevalent in Campylobacter * Corresponding author. Mailing address: Department of Medical Microbiology and Immunology, 1-28 Medical Sciences Building, University of Alberta, Edmonton, Alberta, T6G 2H7 Canada. Phone: (780) 492-4777. Fax: (780) 492-7521. E-mail: diane.taylor@ualberta .ca. 2753
2754
GIBREEL ET AL.
or altered antibiotic transport (21, 29). In C. jejuni and C. coli, resistance to macrolides was previously shown to be associated with nucleotide mutations at positions 2058 and 2059 (based on the Escherichia coli numbering system) in the peptidyl transferase region in domain V of the 23S rRNA (10, 31, 45, 46), the target of macrolides. This mechanism has been described for a variety of organisms: E. coli (51), Streptococcus pneumoniae (9), and Helicobacter pylori (42, 48). In addition to the 23S rRNA mutations, recent studies (26, 33) have shown that macrolide resistance in C. jejuni and C. coli isolates may also involve an efflux pump, which contributes to the multidrug resistance phenotype of clinical bacteria. The resistance of Campylobacter isolates that showed low-level resistance to Ery and Cla was strongly reduced in the presence of phenylalaninearginine -naphthylamide (PAN), a unique commercial efflux pump inhibitor (26, 33). However, this agent does not appear to affect the degree of susceptibility to other antibiotics, such as fluoroquinolones (26). In this study, we investigated the genetic basis of macrolide resistance in a collection of 23 macrolide-resistant Campylobacter isolates collected from different geographic areas and identified as C. jejuni or C. coli by a combination of molecular identification methods. The stability of the erythromycin resistance (Eryr) phenotype in seven representative C. coli and C. jejuni isolates was investigated after repeated subculture on a drug-free medium. The in vitro susceptibility of the isolates to ciprofloxacin and tetracycline was also determined. MATERIALS AND METHODS Campylobacter isolates used in this study. This study was carried out using 23 macrolide-resistant isolates of Campylobacter. All isolates were microaerobic, spiral, gram-negative rods that were isolated and selected at a growth temperature of 42°C. The isolates were identified as Campylobacter as described previously (28). Identification of the isolates as C. jejuni or C. coli was carried out using the following PCR-based assays: hipO PCR (22), mapA PCR (39), Ferme´r PCR-restriction fragment length polymorphism (11), aspartokinase PCR (22), and ceuE PCR (17). Campylobacter isolates were routinely cultured on brain heart infusion agar (Difco, Becton-Dickinson, Sparks, Md.), supplemented with 0.4% yeast extract (Difco), and incubated at 37°C under microaerobic conditions (5% CO2, 10% H2, balance N2) for 48 h. The bacteria were stored at ⫺70°C in 25% glycerol Luria-Bertani broth (37). Determination of MICs. The determination of the MICs of Ery, Cla, and tetracycline was performed using the agar dilution method as previously described (15), whereas the determination of ciprofloxacin MICs was carried out using the Etest (44). To ensure reproducibility, MIC determinations were repeated at least twice. Isolates were considered resistant to Ery, Cla, tetracycline, and ciprofloxacin if they had MICs of ⱖ8, ⱖ8, ⱖ16, and ⱖ4 g/ml, respectively. Preparation of genomic DNA. All genomic DNA templates were prepared using a Promega Wizard DNA isolation kit (Promega, Madison, Wis.). Gel electrophoresis and purification of PCR products. The PCR products were visualized using agarose gel electrophoresis according to a standard method (37). PCR products were purified using either a PCR purification kit or a gel extraction kit (QIAGEN, Mississauga, Ontario, Canada). Characterization of macrolide resistance in Campylobacter isolates. In the case of C. coli, an internal part of domain V of the 23S ribosomal DNA (300 bp) was amplified by PCR using primers DP1 and CJ1 (Table 1). A reaction mixture containing the oligonucleotide primers at 0.5 M each; dATP, dCTP, dGTP, and dTTP at 200 M each; 1⫻ reaction buffer (50 M KCl, 10 mM Tris-HCl [pH 8.3], 1.5 mM MgCl2, 0.01% [wt/vol] gelatin); 1 U of Taq polymerase (PerkinElmer Cetus, Norwalk, Conn.); and 50 ng of genomic DNA template was used for PCR amplification. Thirty cycles of amplification were performed. Each cycle consisted of a 0.5-min denaturation at 95°C, a 1.0-min annealing step at 52°C, and a 1.0-min extension at 72°C. The PCR product was sequenced after purification as described above. To assess whether some isolates had a mutation at position 2611 (E. coli numbering) or at position 2717 (H. pylori numbering) of the 23S rRNA gene,
ANTIMICROB. AGENTS CHEMOTHER. TABLE 1. Primers used in this study Primer
CJ1 DP1 CJ copy-R (2611) mutation-F (2611) mutation-R FI FII FIII CJ18 CJ19 CJ20 CJ21
Sequence (5⬘-3⬘)
Positionsa
5⬘ TCAAGCTGGTTAGCTA 3⬘ 5⬘ ACGGCGGCCGTAACTATA 3⬘ 5⬘ CTACCCACCAGACATTGTC CCAC 3⬘ 5⬘ ATGTCGGCTCATCGCATC CTGG 3⬘ 5⬘ CATCCATTACACACCCAGCC TATC 3⬘ 5⬘ CCCTAAGTCAAGCCTTTCA ATCC 3⬘ 5⬘ CGTTATAGATACGCTTAGCG GTTATG 3⬘ 5⬘ CATCGAGCAAGAGTTTATGC AAGC 3⬘ 5⬘ GAAGTTGTATCTTATGATGC TGAAAA 3⬘ 5⬘ TAACTACGACACCTTGCT CTTG 3⬘ 5⬘ TCCGGTTTATATTACTGAA 3⬘ 5⬘ CTTTAGTTGGAAACCAT CTTG 3⬘
4805–4789 4497–4515 4839–4818 5100–5121 5436–5413 38701–38723 393561–393587 695881–695905 134353–134328 133563–133584 132353–132335 131731–131751
a The numbering used is based on the 23S rRNA gene of C. jejuni (accession no. Z29326) except for the FI, FII, FIII, CJ18, CJ19, CJ20, and CJ21 primers, where the numbering is based on the complete genome sequence of C. jejuni (accession no. NC_002163).
about 300 bp of the gene was amplified by PCR using (2611) mutation-F and (2611) mutation-R primers (Table 1). The amplification was performed using the above-mentioned PCR mixture and PCR conditions except that the annealing step was carried out at 56°C. The PCR product was sequenced after purification. Genes coding for L4 and L22 ribosomal proteins were amplified by PCR using the PCR mixture mentioned above. Primer pairs CJ18-CJ19 and CJ20-CJ21 were used for the amplification of the genes coding for L4 and L22 proteins, respectively (Table 1). Thirty cycles of amplification were performed. Each cycle consisted of a 1-min denaturation at 94°C, a 1-min annealing step at 60°C in the case of the L4 protein or at 50°C for the L22 protein, and a 1-min extension at 72°C. The PCR products (800 bp and 600 bp in the cases of L4 and L22, respectively) were then sequenced after purification. Different copies of the 23S rRNA genes of the C. jejuni isolates were amplified by PCR using three oligonucleotide pairs, FI–CJ copy-R, FII–CJ copy-R, or FIII–CJ copy-R (Table 1). Amplification was performed in a total volume of 50 l containing the PCR primers at 0.1 M each; 1⫻ AccuPrime PCR buffer II [60 mM Tris-SO4 (pH 8.9), 18 mM (NH4)2SO4, 0.4 mM MgSO4, 0.2 mM dGTP, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dCTP, thermostable AccuPrime protein, 1% glycerol]; 200 ng of the genomic DNA; and 1 U of AccuPrime Taq DNA polymerase (Invitrogen, Burlington, Ontario, Canada). A hot start at 95°C for 2 min was performed before the AccuPrime Taq DNA polymerase was added to the reaction mixture. Twenty-five cycles were performed, and each cycle consisted of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 68°C for 7 min. The PCR cycles were followed by a final extension period of 15 min at 68°C. The PCR products (5.7 kbp from the first copy of the 23S rRNA gene [FI–CJ copy-R], 5.8 kbp from the second copy [FII–CJ copy-R], and 5.7 kbp from the third copy [FIII–CJ copy-R]) were analyzed by gel electrophoresis, purified as described above, and investigated by nucleotide sequence analysis using the DP1 primer (Table 1). Detection of erythromycin-modifying activity. Extracellular erythromycinmodifying enzyme assays were carried out as described by Yan and Taylor (53). Stability of the erythromycin resistance phenotype. The stability of Eryr was tested by repeated subculturing of seven representative isolates on Ery-free Mueller-Hinton (MH) agar plates (BBL, Becton-Dickinson, Cockeysville, Md.). Ery MICs were determined after 15, 35, and 55 passages using the Etest. Efflux pump inhibitor assay. The effect of PAN on the Eryr of Campylobacter isolates was investigated as described previously (26) except that standard susceptibility disks (Oxoid, Nepean, Ontario, Canada) containing 15 g of Ery were used. Inhibition zone sizes were interpreted according to the guidelines of the National Committee for Clinical Laboratory Standards (30). A control plate of MH agar containing an equivalent concentration of PAN was also included to assess the effect of PAN on the growth of the isolates investigated. PAN was purchased from Sigma-Aldrich (St. Louis, MO). Natural transformation and the effect of erythromycin-associated mutation on
MACROLIDE RESISTANCE IN C. JEJUNI AND C. COLI
VOL. 49, 2005 TABLE 2. Characteristics of the C. coli isolates involved in this study Isolate
Source (country)
Yr of collection
UA29 001B-17 001B-15 001A-18 UA37 UA40 UA609 UA585 UA749
Sheep (Guelph, Canada) Poultry (Quebec, Canada) Poultry (Quebec, Canada) Clinical (Quebec, Canada) Clinical (Belgium) Clinical (Brussels) Clinical (Ottawa, Canada) Clinical (Wales) Clinical (Belgium)
1980 2001 2001 2000 1974 1982 1984 1984 1989
a
TABLE 3. Characteristics of the C. jejuni isolates involved in this study
Resistance phenotypea
Eryr Eryr Eryr Eryr Eryr Eryr Eryr Eryr Eryr
2755
Clar Clar Clar Clar Clar Clar Clar Clar Clar
Tcr Tcr Tcr Tcr Tcr Tcr Tcr
Tc, tetracycline.
the growth rate of the transformants. The PCR fragments containing the 23S rRNA mutations from two isolates (one carried an A-20593G transition, and the other had an A-20583C mutation) were introduced into a susceptible isolate of C. jejuni (isolate 81116) by natural transformation using the biphasic system as described previously (50). Eryr transformants were selected on MH agar (BBL) plates containing 16 g/ml of Ery. The resulting Eryr transformants in each case were screened for the existence of erythromycin-associated mutations by PCR amplification using the DP1 and CJ1 primers (Table 1). The Ery MICs were also determined for the resulting transformants. Growth experiments were performed to assess the effect of the erythromycin-associated mutation on the growth patterns of Eryr transformants compared to the effect on their parental isolate. A 24-h culture of each transformant was inoculated into 40 ml of MH broth (BBL, Becton-Dickinson, Cockeysville, MD) to an optical density of 0.003 at 625 nm, which was determined using a spectrophotometer (Ultrospec 3000; Pharmacia Biotech, Piscataway, NJ). Ery was added to the culture of the transformants to obtain a final concentration of 15 g/ml, whereas the culture of the parent isolate, C. jejuni 81116, was left free of Ery. All cultures were incubated at 37°C with shaking (140 rpm) under microaerobic conditions for 54 h. Sampling of 0.2 ml from each culture was done at 0, 6, 24, 30, 48, and 54 h. The number of viable cells (CFU) in each sample was estimated by spreading an aliquot of the appropriate dilutions onto MH agar plates. The plates were subsequently incubated at 37°C in a microaerobic atmosphere for 48 h. The growth experiments were carried out in triplicate. Similarly, the growth pattern of Eryr isolate 001A168 was compared to that of its susceptible isogenic isolate, resulting from 55 subcultures on a drug-free medium. PCR screening for the tet(O) gene. Tetracycline-resistant isolates were screened for the existence of the tet(O) gene by PCR using the primers and method described previously (16). Analysis of the QRDR. The genetic basis of ciprofloxacin resistance in Campylobacter isolates was determined by PCR amplification of the quinolone resistance determining region (QRDR) of the gyrA gene as described previously (49). The PCR products were purified and sequenced as mentioned above. DNA sequencing. DNA samples were prepared for sequencing as described previously (16).
RESULTS Characterization of Campylobacter isolates. Twenty-three Eryr Campylobacter isolates collected from different geographic areas were included in this study (Tables 2 and 3). They comprised 6 isolates from poultry, 1 from sheep, 1 from cattle, and 15 clinical isolates. All isolates were initially identified as C. jejuni or C. coli based on the results of the hippurate hydrolysis test. The identification of the isolates was further confirmed by the use of other molecular PCR-based assays which target different genes, such as hipO, mapA, ceuE, the aspartokinase gene, and the 23S rRNA gene. In the latter case, species differentiation was accomplished by digestion of the PCR product, representing the highly polymorphic part of the 23S rRNA gene, by two restriction enzymes, AluI and Tsp509I (11). Of the 23 isolates, 9 were classified as C. coli (2 from
Isolate
001B-40 001B-34 001B-31 001B-22 UA336 001A-15 001A-115 001A-114 001A-168 UA697 UA695 UA709 UA710 UA261 a b
Source (country)
Yr of collection
Resistance phenotypeb
Poultry (Quebec, Canada) Poultry (Quebec, Canada) Poultry (Quebec, Canada) Poultry (Quebec, Canada) Cattle (Southampton, United Kingdom) Clinical (Quebec, Canada) Clinical (Quebec, Canada) Clinical (Quebec, Canada) Clinical (Quebec, Canada) Clinical (United Kingdom) Clinical (Edmonton, Canada) Clinical (The Netherlands) Clinical (Ottawa, Canada) Clinical (Southampton, United Kingdom)
2001 2001 2001 2001 1982
Eryr Cipr Eryr Eryr Eryr
Clar Tcr Eryr Clar Tcr Clar Tcr Clar Tcr Clar
2000 2001 2001 2001 1984 1986 NAa 1987 1982
Cipr Eryr Eryr Eryr Eryr Eryr Eryr Eryr Eryr
Eryr Clar Tcr Clar Tcr Tcr Clar Clar Clar Clar Tcr Clar Clar Tcr
NA, not available. Tc, tetracycline; Cip, ciprofloxacin.
poultry, 1 from sheep, and 6 clinical isolates) (Table 2), and 14 isolates were classified as C. jejuni (4 from poultry, 1 from cattle, and 9 from humans) (Table 3). Detection of the resistance patterns of Campylobacter isolates. The MICs of Ery and Cla for all resistant isolates were determined using the agar dilution method. The MICs for Ery and Cla ranged from 128 to ⬎1,024 and from 64 to 256 g/ml, respectively (Table 4). All Eryr isolates showed cross-resistance to Cla with the exception of the clinical isolate 001A-114, which was resistant to Ery only (Table 4). In addition to macrolide resistance, some C. jejuni and C. coli isolates were also resistant to tetracycline (14 isolates) or tetracycline and ciprofloxacin (2 isolates) (Tables 2 and 3). The MIC of the two ciprofloxacin-resistant isolates was 32 g/ml. None of the isolates collected between 1974 and 1989 were resistant to ciprofloxacin. The MICs of the tetracycline-resistant isolates ranged from 16 to 512 g/ml, with the highest MICs being demonstrated by the isolates collected from poultry (256 to 512 g/ ml). The rate of incidence of tetracycline resistance among the isolates collected between 1974 and 1989 was lower than that of the isolates collected in Quebec between 2000 and 2001. This supports recent studies showing that the increase in the incidence of tetracycline and ciprofloxacin resistance is a trend occurring not only across Canada (14, 16) but also in other countries (19, 24, 25, 32). In this study, the QRDR of the gyrA gene of the ciprofloxacin-resistant isolates showed the C-to-T transition at nucleotide 256, resulting in the substitution of Ile for Thr at amino acid 86 which was previously observed to mediate high quinolone resistance in Campylobacter isolates (41). Also, all tetracycline-resistant isolates were found to carry the tet(O) gene, the resistance marker commonly detected in tetracycline-resistant Campylobacter isolates (16, 40). The mechanism of macrolide resistance in Campylobacter coli isolates. In C. coli isolates, the complete genome sequence is not yet available; therefore, the detection of a potential macrolide-associated mutation in domain V of the 23S rRNA gene was mainly analyzed by amplifying a 300-bp fragment of the target gene (where the majority of point mutations related to macrolide resistance are expected to exist) without specific amplification of the three copies of the target gene. The PCR
2756
GIBREEL ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
TABLE 4. Susceptibility of C. jejuni and C. coli isolates to two macrolides and the position of the macrolide-associated mutation in the 23S rRNA gene MIC (g/ml) Species and isolate Erythromycin
C. jejuni NCTC 11168b jejuni 81116b coli 001B-17 coli 001B-15 coli 001A-18 coli UA29 coli UA37 coli UA40 coli UA609 coli UA585 coli UA749 jejuni 001A-15 jejuni 001B-40 jejuni 001B-34 jejuni 001B-31 jejuni 001B-22 jejuni UA336 jejuni 001A-115 jejuni 001A-114 jejuni 001A-168 jejuni UA697 jejuni UA695 jejuni UA709 jejuni UA710 jejuni UA261
C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C.
Clarithromycin
23S rRNA gene mutationa
0.75
0.5
None (wild-type)
0.75 ⬎1,024 128 256 ⬎1,024 ⬎1,024 256 ⬎1,024 ⬎1,024 ⬎1,024 ⬎1,024 ⬎1,024 512 512 256 ⬎1,024 512 512 512 512 ⬎1,024 ⬎1,024 ⬎1,024 ⬎1,024
0.75 128 128 128 128 128 64 64 128 128 128 256 128 64 64 128 64 2 64 128 64 128 64 128
None (wild-type) A2059G A2059G A2059G A2059G A2059G A2059G A2059G A2059G or A2058G A2059G A2059G A2059G A2059G A2059G A2059Gc A2059Gc A2059G A2059G A2058G A2058C A2058C A2058C No mutation A2059G
a The position of the 23S rRNA gene mutation is based on the numbering of the E. coli gene. b C. jejuni strain NCTC 11168 and strain 81116 were included as representatives of macrolide-susceptible strains. c The mutation in this isolate was detected in only two copies of the 23S rRNA gene.
products were sequenced to verify the specificity of the primers (CJ1-DP1) (Table 1) and the presence of a mutation(s) that could be associated with macrolide resistance. The numbering used throughout the paper is based on the 23S rRNA gene of E. coli unless otherwise indicated. All C. coli isolates exhibited an A3G transition at position 2059 (Table 4). In one case (isolate UA585) (Table 4), repeated amplification and DNA sequencing revealed that different copies of the 23S rRNA gene may have an A3G transition at two variable positions. On one occasion, an A3G transition was detected at position 2058, and in another instance, the same mutation was observed at a neighboring position (position 2059). Confirmation of this hypothesis awaits completion of the genome sequence of C. coli in order to carry out the specific amplification of each copy of the target gene. The mechanism of macrolide resistance in Campylobacter jejuni isolates. In C. jejuni isolates, operon-specific PCRs were performed to amplify the three copies of the 23S rRNA gene. In the majority of C. jejuni isolates (13 of 14 isolates), the amplification resulted in PCR fragments of the expected size. However, in one case (UA261) (Tables 3 and 4), repeated attempts yielded no products at all. Amplification of a 300-bp fragment of the target gene in isolate UA261, where the majority of point mutations related to macrolide resistance are expected to occur, was performed using the CJ1-DP1 primer pair (Table 1). DNA sequencing of the resulting PCR products revealed an A3G transition at position 2059. In the other 13 isolates, each copy of the target gene was specifically amplified
and analyzed by DNA sequencing. Two of the 13 isolates (001B-22 and UA336) (Table 4) exhibited an A3G transition at position 2059 in only two of the three copies of the target gene. Six of the 13 isolates showed an A3G transition at position 2059 in all three copies of the target gene (Table 4). Three isolates (UA695, UA697, and UA709) (Table 4), however, carried an A3C transversion at position 2058 in all three copies of 23S rRNA gene. Surprisingly, isolate 001A-168 exhibited an A3G transition at position 2058 (Table 4). In contrast, the molecular mechanism of macrolide resistance remains undetermined in the case of isolate UA710. Sequencing of the three copies of the 23S rRNA gene in UA710 revealed no point mutation at either position 2058 or position 2059. Mutations at other positions associated with macrolide resistance, such as position 2611 (27) or position 2717 (H. pylori numbering) (12), were not detected in any of the copies of the target gene. To rule out the possibility that isolate UA710 is resistant to macrolides due to the production of an extracellular enzyme capable of modifying erythromycin and related macrolides, a biological assay for the detection of erythromycin-modifying activity was performed. E. coli BM2571 (pIP1527), which contains the ereA gene encoding erythromycin esterase, was included in the assay as a positive control. The assay indicated that extracellular degradation of erythromycin was not responsible for macrolide resistance in isolate UA710. In addition, no correlation was found between macrolide resistance in UA710 and alteration in the ribosomal protein L4 or L22 (see below). Investigation of the ribosomal proteins L4 and L22 in some isolates of C. jejuni and C. coli. Five representative isolates were examined regarding alterations in the ribosomal proteins L4 and L22. The Campylobacter isolates examined included two C. coli isolates (UA585 and 001B-15) (Table 4) and three isolates of C. jejuni (UA710, UA695, and 001B-22) (Table 4). The representative isolates exhibited variable resistance levels and also carried different point mutations in the 23S rRNA gene. Two C. jejuni strains, NCTC 11168 and 81-176, were also included as representatives of macrolide-susceptible strains. The L4 and L22 proteins of C. jejuni NCTC 11168 showed variation in some amino acid residues compared to the corresponding proteins of strain 81-176 (data not shown). Also, the L22 protein of C. jejuni 81-176 has an insertion of six amino acids (118APAAKK) compared to the L22 protein of NCTC 11168. The ribosomal proteins L4 and L22 of the five representative isolates, however, demonstrated complete identity with the corresponding proteins of either C. jejuni strain 11168 or C. jejuni strain 81-176 with the exception of the L22 protein in isolate UA695. This isolate exhibited a P13S alteration in the L22 protein. The mutation at this position has not been identified as a macrolide resistance-associated mutation in other bacterial species (21, 51). This might imply that the P13S alteration in isolate UA695 is not related to macrolide resistance. Effect of efflux pump inhibition on erythromycin resistance in Campylobacter isolates. The activity of PAN as an efflux pump inhibitor was investigated for all Eryr isolates. The patterns of resistance to Ery in 18 of the 23 isolates, including UA710, were not affected by the presence of 15 g/ml of the PAN inhibitor, indicating that the efflux pump plays no role in mediating macrolide resistance in these isolates. One isolate
VOL. 49, 2005
of C. jejuni (001A-15), however, demonstrated an increase in the inhibition zone diameter for 15 g of Ery from 0 to 45 mm in the presence of 15 g/ml PAN, indicating complete susceptibility to Ery. In C. coli isolates UA749 and 001B-15 (Table 2), the presence of PAN resulted in a slight increase in the diameter of the inhibition zone from 0 to 22 mm and from 0 to 24 mm, respectively, although this was not sufficient to completely restore susceptibility to Ery. In two other isolates of C. coli (001B-17 and 001A-18) (Table 2), the presence of 15 g/ml PAN during susceptibility testing resulted in a marked inhibition of their growth interfering with the assay. The effect of two lower concentrations of PAN inhibitor (5 and 10 g/ml) on the growth and Eryr of C. coli isolates 001B-17 and 001A-18 was assessed. Both concentrations of PAN had no influence on either the growth or the Eryr of isolate 001A-18. Although the presence of 10 g/ml PAN had no effect on the growth of isolate 001B-17, it did result in a slight increase in the inhibition zone diameter around the Ery disk (from 0 to 15 mm). Neither the growth nor the Eryr of isolate 001B-17 was affected by the presence of 5 g/ml PAN. Stability of macrolide resistance. To examine whether the level of macrolide resistance, the type of mutation in the 23S rRNA gene, and the number of the mutated copies of the target gene (in the case of C. jejuni) play a role in the stability of Eryr in Campylobacter in vitro, seven representative isolates (001B-15, UA749, 001B-22, 001A-168, UA697, UA709, and UA40) (Table 4) were examined after 15, 35, and 55 repeated subcultures on drug-free media. The representative isolates demonstrated a wide range of Ery MICs (128 to ⬎1,024 g/ml) as well as different types of macrolide-associated mutations (four had an A2059G mutation, two carried an A2058C mutation, and one had an A2058G mutation). The isolates remained remarkably resistant to Ery except for isolate 001A168, which reverted back to Ery and Cla susceptibility after 55 subcultures (MICs of 2 g/ml and 4 g/ml, respectively). In addition, sequencing of the three copies of the 23S rRNA gene of the Ery-susceptible isolate 001A-168 revealed no point mutation at position 2058. This finding confirmed that the A2058G mutation was responsible for macrolide resistance in isolate 001A-168. Transformation studies and effect of the 23S rRNA mutation on the growth rate of Campylobacter isolates. Transformation studies were used to confirm that the A2058C and A2059G mutations observed are associated with the resistance of Campylobacter isolates to macrolides. Transformation of a part of the 23S rRNA gene (300-bp PCR product amplified by the use of the CJ1-DP1 primer pair) from isolates UA695 and UA37 (with A3C and A3G mutations at positions 2058 and 2059, respectively) yielded Eryr transformants at a frequency of 10⫺6 and 5 ⫻ 10⫺7 transformants per recipient cell, respectively. The resulting transformants exhibited levels of Eryr comparable to those of isolates UA695 and UA37 (MICs of ⬎1,024 g/ml). Subsequent sequencing of the region carrying domain V of the 23S rRNA gene (amplified by the CJ1-DP1 PCR primers) in the transformants indicated that the resistance-associated mutation was homozygous and identical to that of the corresponding donor isolate. This suggests that the emergence of the transformants involved acquisition of the mutant sequence by all 23S rRNA gene copies, presumably one after the other.
MACROLIDE RESISTANCE IN C. JEJUNI AND C. COLI
2757
To assess the impact of these mutations on the growth of their host, we compared the growth pattern of each type of the Eryr transformants to that of its parent isolate (C. jejuni 81116). Also, the growth pattern of the Eryr isolate 001A-168 (carrying the A2058G mutation in the 23S rRNA gene) was compared to that of its susceptible counterpart. The growth of each type of the Eryr transformants exhibited no difference compared to that of the parent C. jejuni 81116, as indicated by viable counts over a period of 54 h (data not shown). Samples of Eryr isolate 001A-168, collected after 48 and 54 h, demonstrated about a 2-log viability decrease compared to the corresponding samples of its susceptible counterpart (data not shown). In addition, there was a marked reduction in the sizes of the colonies of Eryr isolate 001A-168 relative to those of the corresponding colonies of its susceptible isogenic isolate. DISCUSSION Macrolides, the drugs of choice for treating Campylobacter infections, are widely used in the veterinary field for prophylactic and therapeutic purposes. Massive consumption of these drugs may lead to the emergence of macrolide-resistant isolates, resulting in problems in the treatment of resistant Campylobacter infections. Therefore, the study and monitoring of macrolide resistance are, in turn, becoming increasingly important. Our data regarding species classification of the Eryr Campylobacter isolates confirm that there is no single ideal method that could be used in practice for reliable identification of Campylobacter isolates to the species level. This was in agreement with other studies (17, 22, 39). The accurate identification of the Campylobacter isolates as C. jejuni or C. coli provides important data for surveillance and risk assessment studies on which intervention strategies can be based. Moreover, rapid and accurate identification of C. coli isolates may be useful clinically as it has been reported that up to 70% of C. coli isolates may be resistant to erythromycin (5, 6). In this study, the main mechanism of macrolide resistance was due to a single point mutation in the 23S rRNA gene. In agreement with the results of previous studies (20, 31, 33, 46), the most predominant mutation identified among the C. coli and C. jejuni isolates was the A2059G transition mutation. The isolates exhibiting this mutation elicited a wide range of Ery and Cla MICs (from 128 to ⬎1,024 and from 64 to 256 g/ml, respectively) (Table 4). Another macrolide-associated mutation (A2058C transversion) was found in only three C. jejuni isolates. This mutation was previously reported to occur at a relatively low frequency in resistant C. jejuni isolates (46) and also in H. pylori isolates (8). This mutation was associated with a narrow range of MICs for Ery and Cla (from 512 to ⬎1,024 and from 64 to 128 g/ml, respectively) (Table 4). In addition, one of the clinical C. jejuni isolates showed an A3G transition at position 2058, which is homologous to the A2142G mutation commonly described in H. pylori isolates (8). This mutation has not previously been shown to cause macrolide resistance in Campylobacter isolates. The inability to amplify the three copies of the 23S rRNA gene in C. jejuni isolate UA261 was intriguing and may indicate that the rRNA operons in some C. jejuni isolates may exhibit a certain degree of sequence variation upstream of the 16S
2758
GIBREEL ET AL.
rRNA gene. This could hinder the annealing of the forward PCR primers (FI, FII, and FIII) to their targets, resulting in negative PCR amplifications. The apparently high frequency of the A2059G mutation among the isolates examined might be the result of biological features generated by this mutation. The growth experiments revealed that the isolates with the A2058C and A2059G mutations had similar growth patterns. This does not explain why the A2058C mutation was found at such a low frequency. It is, however, possible that the A2058C transversion leads to a minor alteration in the ribosome structure, with a minimal effect on growth rate which was not detectable during the relatively short period of our in vitro growth experiment. The data from the growth experiment, however, implied that the A2058G mutation in the 23S rRNA gene might have a negative effect on the growth rate of its host. This may explain the rare occurrence of this mutation among C. jejuni isolates. Our results imply that at least two mutated copies of the target gene are necessary to confer macrolide resistance in C. jejuni isolates. In H. pylori isolates, it was found that a mutation in one of the two 23S rRNA copies was enough to cause high-level resistance (18). The only example of a single mutated copy among multiple 23S rRNA operons giving rise to Eryr was in Streptomyces ambofaciens, the spiramycin producer (34); one of four rRNA operons carrying an A2058G mutation was found to confer an apparent 40-fold increase in the Ery MIC. It is difficult to conclude in this study whether the number of mutated copies of the 23S rRNA gene or the position of the mutation correlated with the level of resistance. Other investigators (20, 33) also did not find any such correlation. In this study, the PAN inhibitor was found to potentiate the effect of Ery in four cases, but complete susceptibility was restored in only one isolate of C. jejuni (001A-15). It is not clear why isolate 001A-15 became susceptible in spite of the continued presence of the A2059G mutation in all three copies of the target gene. A previous study (23), however, demonstrated a similar phenomenon where the addition of MC-207,110 (an efflux pump inhibitor) restored the activity of levofloxacin in isolates of Pseudomonas aeruginosa irrespective of the presence of target-based mutations and also regardless of the level of resistance of the individual isolates. It ought to be mentioned that the addition of 15 g/ml of PAN was found to have an inhibitory effect on the growth of two isolates, although this concentration was within the range used in a previous study (26). Payot et al. (33), however, used a higher concentration of the inhibitor (40 g/ml), but it did not affect the growth of the isolates examined in their study. This finding suggests that the effect of PAN on the growth of Campylobacter could be isolate dependent, necessitating careful optimization of the inhibitor concentration when used in similar investigations. The observation that the Eryr phenotype of isolate 001A-168 was unstable in the absence of Ery selection pressure is in agreement with previous studies of macrolide resistance in H. pylori isolates (3, 8, 52). These studies found that H. pyloriresistant isolates carrying an A2142G mutation in the target gene showed a higher rate of instability of the resistance phenotype than those with an A2143G mutation (3, 8, 52). The data on the stability of Eryr in Campylobacter isolates might suggest that the rate of detection of the A2058G mutation
ANTIMICROB. AGENTS CHEMOTHER.
could be underestimated in macrolide-resistant isolates due to the subcultures performed from the first isolation to the moment of susceptibility test performance. No clear association was observed between the stability of Eryr in Campylobacter isolates and the level of Eryr or the number of the mutated copies of the target gene. Whether or not the instability of Eryr in Campylobacter isolates could be associated with the A2058G mutation in the target gene needs to be further investigated. In conclusion, the data presented here confirmed the previous findings showing that mutations in the 23S rRNA gene at positions 2058 and 2059 are mainly responsible for macrolide resistance in C. jejuni and C. coli. The occurrence of another mutation, the A2058G transition, which is homologous to the A2142G mutation in H. pylori, was also described here for the first time in one isolate of C. jejuni. Although previous work with E. coli and other organisms has implicated the ribosomal proteins L4 and L22 in macrolide resistance (21, 51), no evidence was found for the contribution of these ribosomal proteins to macrolide resistance in the representative Campylobacter isolates investigated. In addition, our results also indicated that the Eryr phenotype in C. jejuni and C. coli is generally stable. The stability of Eryr seems to be independent of the level of Eryr or the number of the mutated copies of 23S rRNA gene. Some of the Campylobacter isolates examined exhibited multidrug resistance, which poses a threat to humans and further limits therapeutic options. ACKNOWLEDGMENTS This research was supported by funding from the National Science and Engineering Research Council (NSERC), the Alberta Heritage Foundation for Medical Research (AHFMR), and the Canadian Institutes of Health Research (as a part of the Safe Food and Water Initiative). A.G. is an AHFMR postdoctoral fellow. D.E.T. is an AHFMR scientist. REFERENCES 1. Aarestrup, F. M., and J. Engberg. 2001. Antimicrobial resistance of thermophilic Campylobacter. Vet. Res. 32:311–321. 2. Aarestrup, F. M., E. M. Nielsen, M. Madsen, and J. Engberg. 1997. Antimicrobial susceptibility patterns of thermophilic Campylobacter spp. from humans, pigs, cattle, and broilers in Denmark. Antimicrob. Agents Chemother. 41:2244–2250. 3. Alarcon, T., D. Domingo, N. Prieto, and M. Lopez-Brea. 2000. Clarithromycin resistance stability in Helicobacter pylori: influence of the MIC and type of mutation in the 23S rRNA. J. Antimicrob. Chemother. 46:613–616. 4. Allos, B. M. 2001. Campylobacter jejuni infections: update on emerging issues and trends. Clin. Infect. Dis. 32:1201–1206. 5. Altekruse, S. F., N. J. Stern, P. I. Fields, and D. L. Swerdlow. 1999. Campylobacter jejuni—an emerging foodborne pathogen. Emerg. Infect. Dis. 5:28– 35. 6. Blaser, M. J. 1997. Epidemiologic and clinical features of Campylobacter jejuni infections. J. Infect. Dis. 176(Suppl. 2):S103–S105. 7. Chuma, T., T. Ikeda, T. Maeda, H. Niwa, and K. Okamoto. 2001. Antimicrobial susceptibilities of Campylobacter strains isolated from broilers in the southern part of Japan from 1995 to 1999. J. Vet. Med. Sci. 63:1027–1029. 8. Debets-Ossenkopp, Y. J., A. B. Brinkman, E. J. Kuipers, C. M. J. E. Vandenbroucke-Grauls, and J. G. Kusters. 1998. Explaining the bias in the 23S rRNA gene mutations associated with clarithromycin resistance in clinical isolates of Helicobacter pylori. Antimicrob. Agents Chemother. 42:2749– 2751. 9. Depardieu, F., and P. Courvalin. 2001. Mutation in 23S rRNA responsible for resistance to 16-membered macrolides and streptogramins in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 45:319–323. 10. Engberg, J., F. M. Aarestrup, D. E. Taylor, P. Gerner-Smidt, and I. Nachamkin. 2001. Quinolone and macrolide resistance in Campylobacter jejuni and C. coli: resistance mechanisms and trends in human isolates. Emerg. Infect. Dis. 7:24–34. 11. Ferme´r, C., and E. O. Engvall. 1999. Specific PCR identification and differentiation of the thermophilic campylobacters, Campylobacter jejuni, C. coli, C. lari, and C. upsaliensis. J. Clin. Microbiol. 37:3370–3373.
VOL. 49, 2005 12. Fontana, C., M. Favaro, S. Minelli, A. A. Criscuolo, A. Pietroiusti, A. Galante, and C. Favalli. 2002. New site of modification of 23S rRNA associated with clarithromycin resistance of Helicobacter pylori clinical isolates. Antimicrob. Agents Chemother. 46:3765–3769. 13. Funke, G., R. Baumann, J. L. Penner, and M. Altwegg. 1994. Development of resistance to macrolide antibiotics in an AIDS patient treated with clarithromycin for Campylobacter jejuni diarrhea. Eur. J. Clin. Microbiol. Infect. Dis. 13:612–615. 14. Gaudreau, C., and H. Gilbert. 1998. Antimicrobial resistance of clinical strains of Campylobacter jejuni subsp. jejuni isolated from 1985 to 1997 in Quebec, Canada. Antimicrob. Agents Chemother. 42:2106–2108. 15. Gaudreau, C., and H. Gilbert. 1997. Comparison of disc diffusion and agar dilution methods for antibiotic susceptibility testing of Campylobacter jejuni subsp. jejuni and Campylobacter coli. J. Antimicrob. Chemother. 39:707–712. 16. Gibreel, A., D. M. Tracz, L. Nonaka, T. M. Ngo, S. R. Connell, and D. E. Taylor. 2004. Incidence of antibiotic resistance in Campylobacter jejuni isolated in Alberta, Canada, from 1999 to 2002, with special reference to tet(O)-mediated tetracycline resistance. Antimicrob. Agents Chemother. 48: 3442–3450. 17. Gonzalez, I., K. A. Grant, P. T. Richardson, S. F. Park, and M. D. Collins. 1997. Specific identification of the enteropathogens Campylobacter jejuni and Campylobacter coli by using a PCR test based on the ceuE gene encoding a putative virulence determinant. J. Clin. Microbiol. 35:759–763. 18. Hulte´n, K., A. Gibreel, O. Sko ¨ld, and L. Engstrand. 1997. Macrolide resistance in Helicobacter pylori: mechanism and stability in strains from clarithromycin-treated patients. Antimicrob. Agents Chemother. 41:2550–2553. 19. Ishihara, K., T. Kira, K. Ogikubo, A. Morioka, A. Kojima, M. KijimaTanaka, T. Takahashi, and Y. Tamura. 2004. Antimicrobial susceptibilities of Campylobacter isolated from food-producing animals on farms (1999– 2001): results from the Japanese Veterinary Antimicrobial Resistance Monitoring Program. Int. J. Antimicrob. Agents 24:261–267. 20. Jensen, L. B., and F. M. Aarestrup. 2001. Macrolide resistance in Campylobacter coli of animal origin in Denmark. Antimicrob. Agents Chemother. 45:371–372. 21. Leclercq, R. 2002. Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications. Clin. Infect. Dis. 34:482–492. 22. Linton, D., A. J. Lawson, R. J. Owen, and J. Stanley. 1997. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol. 35: 2568–2572. 23. Lomovskaya, O., M. S. Warren, A. Lee, J. Galazzo, R. Fronko, M. Lee, J. Blais, D. Cho, S. Chamberland, T. Renau, R. Leger, S. Hecker, W. Watkins, K. Hoshino, H. Ishida, and V. J. Lee. 2001. Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for combination therapy. Antimicrob. Agents Chemother. 45:105–116. 24. Luber, P., J. Wagner, H. Hahn, and E. Bartelt. 2003. Antimicrobial resistance in Campylobacter jejuni and Campylobacter coli strains isolated in 1991 and 2001–2002 from poultry and humans in Berlin, Germany. Antimicrob. Agents Chemother. 47:3825–3830. 25. Lucey, B., B. Cryan, F. O’Halloran, P. G. Wall, T. Buckley, and S. Fanning. 2002. Trends in antimicrobial susceptibility among isolates of Campylobacter species in Ireland and the emergence of resistance to ciprofloxacin. Vet. Rec. 151:317–320. 26. Mamelli, L., J. P. Amoros, J. M. Pages, and J. M. Bolla. 2003. A phenylalanine-arginine beta-naphthylamide sensitive multidrug efflux pump involved in intrinsic and acquired resistance of Campylobacter to macrolides. Int. J. Antimicrob. Agents 22:237–241. 27. Misyurina, O. Y., E. V. Chipitsyna, Y. P. Finashutina, V. N. Lazarev, T. A. Akopian, A. M. Savicheva, and V. M. Govorun. 2004. Mutations in a 23S rRNA gene of Chlamydia trachomatis associated with resistance to macrolides. Antimicrob. Agents Chemother. 48:1347–1349. 28. Nachamkin, I. 1999. Campylobacter and Arcobacter, p. 716–726. In P. R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.), Manual of clinical microbiology, 7th ed. American Society for Microbiology, Washington, D.C. 29. Nakajima, Y. 1999. Mechanisms of bacterial resistance to macrolide antibiotics. J. Infect. Chemother. 5:61–74. 30. National Committee for Clinical Laboratory Standards. 2001. Performance standards for antimicrobial susceptibility testing; 11th informational supplement. NCCLS publication no. M100–S11. National Committee for Clinical Laboratory Standards, Wayne, Pa. 31. Niwa, H., T. Chuma, K. Okamoto, and K. Itoh. 2001. Rapid detection of
MACROLIDE RESISTANCE IN C. JEJUNI AND C. COLI
32. 33.
34.
35.
36.
37. 38. 39. 40. 41.
42.
43. 44. 45. 46.
47.
48.
49.
50. 51. 52. 53.
2759
mutations associated with resistance to erythromycin in Campylobacter jejuni/coli by PCR and line probe assay. Int. J. Antimicrob. Agents 18:359–364. Osterlund, A., M. Hermann, and G. Kahlmeter. 2003. Antibiotic resistance among Campylobacter jejuni/coli strains acquired in Sweden and abroad: a longitudinal study. Scand. J. Infect. Dis. 35:478–481. Payot, S., L. Avrain, C. Magras, K. Praud, A. Cloeckaert, and E. ChaslusDancla. 2004. Relative contribution of target gene mutation and efflux to fluoroquinolone and erythromycin resistance, in French poultry and pig isolates of Campylobacter coli. Int. J. Antimicrob. Agents 23:468–472. Pernodet, J. L., F. Boccard, M. T. Alegre, M. H. Blondelet-Rouault, and M. Guerineau. 1988. Resistance to macrolides, lincosamides and streptogramin type B antibiotics due to a mutation in an rRNA operon of Streptomyces ambofaciens. EMBO J. 7:277–282. Reina, J., N. Borrell, and A. Serra. 1992. Emergence of resistance to erythromycin and fluoroquinolones in thermotolerant Campylobacter strains isolated from feces 1987–1991. Eur. J. Clin. Microbiol. Infect. Dis. 11:1163– 1166. Sa ´enz, Y., M. Zarazaga, M. Lantero, M. J. Gastan ˜ ares, F. Baquero, and C. Torres. 2000. Antibiotic resistance in Campylobacter strains isolated from animals, foods, and humans in Spain in 1997–1998. Antimicrob. Agents Chemother. 44:267–271. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Segreti, J., T. D. Gootz, L. J. Goodman, G. W. Parkhurst, J. P. Quinn, B. A. Martin, and G. M. Trenholme. 1992. High-level quinolone resistance in clinical isolates of Campylobacter jejuni. J. Infect. Dis. 165:667–670. Stucki, U., J. Frey, J. Nicolet, and A. P. Burnens. 1995. Identification of Campylobacter jejuni on the basis of a species-specific gene that encodes a membrane protein. J. Clin. Microbiol. 33:855–859. Taylor, D. E., and A. Chau. 1996. Tetracycline resistance mediated by ribosomal protection. Antimicrob. Agents Chemother. 40:1–5. Taylor, D. E., and A. S.-S. Chau. 1997. Cloning and nucleotide sequence of the gyrA gene from Campylobacter fetus subsp. fetus ATCC 27374 and characterization of ciprofloxacin-resistant laboratory and clinical isolates. Antimicrob. Agents Chemother. 41:665–671. Taylor, D. E., Z. Ge, D. Purych, T. Lo, and K. Hiratsuka. 1997. Cloning and sequence analysis of two copies of a 23S rRNA gene from Helicobacter pylori and association of clarithromycin resistance with 23S rRNA mutations. Antimicrob. Agents Chemother. 41:2621–2628. Taylor, D. N., and J. M. Blaser. 1991. Campylobacter infections, p. 151–172. In A. S. Evans and P. S. Brachman (ed.), Bacterial infections in humans. Plenum Publishing Corp., New York, N.Y. Tremblay, C., and C. Gaudreau. 1998. Antimicrobial susceptibility testing of 59 strains of Campylobacter fetus subsp. fetus. Antimicrob. Agents Chemother. 42:1847–1849. Trieber, C. A., and D. E. Taylor. 2000. Mechanisms of antibiotic resistance in Campylobacter. In I. Nachamkin and M. J. Blaser (ed.), Campylobacter, 2nd ed. ASM Press, Washington, D.C. Vacher, S., A. Me´nard, E. Bernard, and F. Me´graud. 2003. PCR-restriction fragment length polymorphism analysis for detection of point mutations associated with macrolide resistance in Campylobacter spp. Antimicrob. Agents Chemother. 47:1125–1128. Van Looveren, M., G. Daube, L. De Zutter, J. M. Dumont, C. Lammens, M. Wijdooghe, P. Vandamme, M. Jouret, M. Cornelis, and H. Goossens. 2001. Antimicrobial susceptibilities of Campylobacter strains isolated from food animals in Belgium. J. Antimicrob. Chemother. 48:235–240. Wang, G., and D. E. Taylor. 1998. Site-specific mutations in the 23S rRNA gene of Helicobacter pylori confer two types of resistance to macrolidelincosamide-streptogramin B antibiotics. Antimicrob. Agents Chemother. 42:1952–1958. Wang, Y., W. M. Huang, and D. E. Taylor. 1993. Cloning and nucleotide sequence of the Campylobacter jejuni gyrA gene and characterization of quinolone resistance mutations. Antimicrob. Agents Chemother. 37:457– 463. Wang, Y., and D. E. Taylor. 1990. Natural transformation in Campylobacter species. J. Bacteriol. 172:949–955. Weisblum, B. 1995. Erythromycin resistance by ribosome modification. Antimicrob. Agents Chemother. 39:577–585. Xia, H. X., M. Buckley, C. T. Keane, and C. A. O’Morain. 1996. Clarithromycin resistance in Helicobacter pylori: prevalence in untreated dyspeptic patients and stability in vitro. J. Antimicrob. Chemother. 37:473–481. Yan, W., and D. E. Taylor. 1991. Characterization of erythromycin resistance in Campylobacter jejuni and Campylobacter coli. Antimicrob. Agents Chemother. 35:1989–1996.
