DEVELOPMENTAL DYNAMICS 238:2073–2080, 2009
PATTERNS & PHENOTYPES
Male-Specific Expression of Aldh1a1 in Mouse and Chicken Fetal Testes: Implications for Retinoid Balance in Gonad Development Josephine Bowles,1,2 Chun-Wei Feng,1 Deon Knight,1 Craig A. Smith,3 Kelly N. Roeszler,3 Stefan Bagheri-Fam,4 Vincent R. Harley,4 Andrew H. Sinclair,2,3 and Peter Koopman1,2*
Balanced production and degradation of retinoids is important in regulating development of several organ systems in the vertebrate embryo. Among these, it is known that retinoic acid (RA), and the retinoidcatabolyzing enzyme CYP26B1 together regulate the sex-specific behavior of germ cells in developing mouse gonads. We report here that the gene encoding a cytosolic class-1 aldehyde dehydrogenase, ALDH1A1, a weak catalyst of RA production, is strongly expressed in a male-specific manner in somatic cells of the developing mouse testis, beginning shortly after Sry expression is first detectable. This expression pattern is conserved in the developing male gonad of the chicken and is dependent on the testis-specific transcription factor SOX9. Our data suggest that low levels of RA may be required for early developmental events in the testis, or that Aldh1a1 expression in the fetus may prefigure a later requirement for ALDH1A1 in regulating spermatogenesis postnatally. Developmental Dynamics 238:2073–2080, 2009. © 2009 Wiley-Liss, Inc. Key words: Aldh1a1; testis development; mouse testis; chicken testis; retinoic acid Accepted 21 May 2009
INTRODUCTION A major advance in our understanding of sex determination came with the discovery that, in mammals, the male pathway of development is triggered by expression of the Y-chromosomal gene, Sry (sex determining region of Chr Y; Gubbay et al., 1990; Sinclair et al., 1990; Koopman et al., 1991). Although this discovery provided researchers with a starting point, the details of how an “indifferent” gonad
assumes a male, rather than a female, developmental pathway are still far from clear. In an attempt to identify genes induced downstream of SRY in the pathway of testis or ovary development, we and many others have conducted expression screens designed to isolate genes expressed in a sex-specific manner in either male and female mouse gonads (Bowles et al., 2000; Grimmond et al., 2000; Menke and Page, 2002; McClive et al.,
2003; Nef et al., 2005; Beverdam and Koopman, 2006; Bouma et al., 2007). Among the many candidate gonad-development genes isolated is Aldh1a1, the expression of which is the subject of the present study. Aldh1a1 (aldehyde dehydrogenase family 1, subfamily A1, previously known as Aldh1, Raldh1, or Ahd-2) encodes a cytosolic retinaldehyde dehydrogenase (ALDH1A1, RALDH1, RALDH, Ahd-2, Ahd2, ALDH1, E1)
1 Division of Molecular Genetics and Development, Institute for Molecular Biosciences, The University of Queensland, Brisbane, Queensland, Australia 2 Australian Research Council Centre of Excellence in Biotechnology and Development, University of Newcastle, Callaghan NSW, Australia 3 Murdoch Children’s Research Institute and University of Melbourne Department of Paediatrics, Royal Children’s Hospital, Parkville, Victoria, Australia 4 Prince Henry’s Institute of Medical Research, Clayton, Victoria, Australia Grant sponsor; Australian Research Council (ARC); Grant sponsor: National Health & Medical Research Program; Grant number: ID334314. *Correspondence to: Peter Koopman, Division of Molecular Genetics and Development, Institute for Molecular Biosciences, The University of Queensland, Brisbane, Queensland 4072, Australia. E-mail:
[email protected]
DOI 10.1002/dvdy.22024 Published online 14 July 2009 in Wiley InterScience (www.interscience.wiley.com).
© 2009 Wiley-Liss, Inc.
2074 BOWLES ET AL.
that catalyses the final, irreversible step in retinoic acid (RA) production (Duester, 2000). At least three additional enzymes, ALDH1A2, ALDH1A3 and ALDH8A1, can catalyze RA production (Vasiliou et al., 2004), although the main regulator of RA synthesis during mouse embryogenesis appears to be ALDH1A2 (1999, 2002). Compared with ALDH1A2 and ALDH1A3, ALDH1A1 is much less efficient at generating all-trans RA (Haselbeck et al., 1999) and, compared with ALDH8A1, ALDH1A1 is less efficient in generating 9-cis RA (Vasiliou et al., 2004). Aldh1a7 (aldehyde dehydrogenase family 1, subfamily A7, previously known as Adh2-like or Aldh-pb) is very closely related to Aldh1a1 but has not been shown capable of synthesizing RA under physiological conditions (Hsu et al., 1999). RA is a key modulator of gene expression and cell differentiation, especially during development (Duester, 2000). The action of RA is mediated through nuclear retinoic acid receptors (RAR␣, -, and -␥) and retinoic X receptors (RXR␣, -, and -␥) that act as ligand-inducible transcription factors. It is believed that RXR/RAR heterodimers transduce the RA signal during mouse development and in the adult (Mark et al., 2006). Previous studies have suggested that the presence of RA in the developing male mouse gonad must be avoided if somatic and germ cells are to function normally. When exogenous RA is added to rat fetal testis in culture it can completely inhibit seminiferous cord formation (Cupp et al., 1999; Livera et al., 2000) and inhibit mesonephric cell migration, Sertoli cell differentiation and gonocyte survival (Li and Kim, 2004). In addition, in vitro and in vivo studies have demonstrated that germ cells in a developing mouse testis must be protected from the effects of RA to avoid premature entry into meiosis and apoptosis (Bowles et al., 2006; Koubova et al., 2006; MacLean et al., 2007). This is achieved by the actions of the cytochrome P450 enzyme CYP26B1 that is expressed strongly by somatic cells of the developing testis and acts to degrade endogenous RA. In this report, we show that Aldh1a1 is highly expressed in a male-specific manner in somatic cells of developing gonads of both mouse
and chicken, immediately after the initiation of sexual identity. Our findings suggest that early expression of Aldh1a1 contributes to retinoid balance during gonad development, or may prefigure the role of Sertoli cells in supporting spermatogenesis in puberty and adulthood.
RESULTS Aldh1a1 Is Highly Expressed by Somatic Cells in the Mouse Gonad The pathways by which indifferent gonads develop into testes or ovaries are not yet fully understood. We attempted previously to identify additional genes involved in these pathways by conducting expression screens, based on the principal of subtractive hybridization (Bowles et al., 2000; McClive et al., 2003). In both screens, Aldh1a1 was found to be more highly expressed in male gonad samples shortly after the male pathway is instigated by the expression of Sry. Using whole-mount in situ hybridization to urogenital ridge (gonad ⫹ mesonephros) samples dissected from mouse embryos at 11.5, 12.0, 12.5, and 13.5 days post coitum (dpc), Aldh1a1 expression was strong in male samples, but barely detectable in female samples until approximately 13.5 dpc (Fig. 1a– d). When section in situ hybridization was carried out, Aldh1a1 transcripts were detected in Sertoli cells lining the testicular cords (Fig. 1e), identified by expression of the gene encoding anti-Mu¨llerian hormone (Amh, Fig. 1f). Some additional cells in the interstitial spaces between the cords also expressed Aldh1a1 (Fig. 1e); these appeared to be a subset of Leydig cells, which express the gene encoding cholesterol sidechain cleavage enzyme (Scc, Fig. 1g). Analysis of the We stain of mice, which lack gonadal germ cells (Buehr et al., 1993), showed that the expression of Aldh1a1 was not dependant on the presence of germ cells in the male gonad (Fig. 1h). Quantitative reverse transcriptasepolymerase chain reaction (RT-PCR) analysis (Fig. 1i) confirmed the malespecific profile of Aldh1a1 expression. Moreover, the Aldh1a1 transcript is very highly represented (1.5%) in a
RIKEN full-length enriched cDNA library prepared from 15 dpc C57BL/6J testis tissue (dbEST:18005) (Carninci et al., 2005).
Onset of Aldh1a1 Expression Occurs Shortly After Male Sex Is Determined In situ hybridization and quantitative RT-PCR analyses suggested that Aldh1a1 is expressed in male mouse gonads very shortly after their sex is determined by the expression of Sry. We compared the timing of expression of Aldh1a1 with that of Sry by conducting in situ hybridizations in parallel on left and right urogenital ridge samples taken from a single embryo at 11.5 dpc. Aldh1a1 was robustly expressed during the short window of Sry expression (Fig. 1j). Curiously, the temporal pattern of expression of Aldh1a1 also coincided with that of Cyp26b1, encoding a RAdegradative enzyme, at this early stage (Fig. 1k). It appears that these two transcripts are also expressed in the same or very similar cells within the developing gonad: Sertoli cells and some interstitial cells (Fig. 1e– g; Bowles et al., 2006). It is more usual that RA synthesizing and RA degrading enzymes are expressed in complementary patterns, usually in adjacent tissues or fields of cells (Romand et al., 2006). We have previously shown that this is the case for Aldh1a2 and Cyp26b1 in the developing urogenital ridge: Cyp26b1 is strongly expressed in the developing testis, whereas Aldh1a2 is strongly expressed in the adjacent mesonerphros (Bowles et al., 2006).
Aldh1a1 Is Also MaleSpecifically Expressed in the Developing Chicken Gonad To determine whether the male-specific expression of Aldh1a1 is conserved in other species, and therefore likely to be functionally significant, we studied its expression in developing chicken gonads. In chickens, the mechanism of gonadal sex determination is not understood, but it is not initiated by SRY as it is in the mouse. However, the timing of sex determination is known and, as in the mouse male gonad, up-regulated Sox9 expression is observed around day 6.5
Aldh1a1 IN MOUSE AND CHICKEN FETAL TESTES 2075
Fig. 1. Expression of Aldh1a1 in developing male and female mouse gonads. a–d: Whole-mount in situ hybridization showing Aldh1a1 expression in male (left) and female (right) urogenital ridge (gonad ⫹ mesonephros) at 11.5 (a), 12.0 (b), 12.5 (c), and 13.5 dpc (d). e–g: In situ hybridization to testis sections at 13.5 dpc using probes for Aldh1a1 (e), Sertoli cell marker Amh (f), and Leydig cell marker Cyp11a1 (g). Scale bars ⫽ 100 m. h: In situ hybridization to male urogenital ridge tissues from We mutant (left) and wild-type (right) embryos at 13.5 days post coitum (dpc) showing Aldh1a1 expression. i: Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis (SYBR) of relative expression levels of Aldh1a1 expression in male and female mouse gonadal tissues at various time points (dpc). Expression was normalized against 18S rRNA and the highest level of Aldh1a1 expression was set as 100%. j,k: Comparison of expression of Aldh1a1 (left) and Sry (right) in urogenital ridges taken from the same embryo at 11.5 dpc (k).
(Kent et al., 1996). By whole-mount in situ hybridization, we found that Aldh1a1 was male-specifically expressed in chicken gonads beginning by at least day 8.5 (Fig. 2). As was the case for the mouse, virtually no expression of Aldh1a1 was detectable in the developing chick ovaries.
Male-Specific Expression of Aldh1a1 Is Induced Downstream of Sox9 in the Mouse The transcription factor Sox9 is up-regulated male-specifically and shortly after the onset of Sry expression and, like
Sry, is able to induce all aspects of male gonadal development (Bishop et al., 2000; Vidal et al., 2001; Qin and Bishop, 2005). Therefore, all male-determining functions of Sry are thought to be mediated by Sox9. To determine whether Aldh1a1 acts upstream or downstream of Sox9, we studied its expression in
2076 BOWLES ET AL.
Fig. 2. Expression of ALDH1A1 in embryonic chicken gonads. a–j: ALDH1A1 expression was assessed by whole-mount in situ hybridization in male (a– e) and female (f–j) gonad ⫹ mesonephros samples at days 6.5 (a,f), 8.5 (b,g), 10.5 (c,h), 12.5 (d,i), and 14.5 (e,j). Gonads are either outlined or heavily stained and gonad (g) and mesonephros (m) are indicated in panel g.
gonads of mice carrying a Sox9 hypomorphic allele. Aldh1a1 expression was much lower in the Sox9-mutant gonads than in wild-type littermates, indicating that its up-regulation occurs in the male gonad downstream of Sox9 (Fig. 3a). Up-regulation of Cyp26b1 expression in the male gonad also appeared to be dependent on Sox9 expression. The Sox9-dependent expression of Aldh1a1 observed in the mouse is consistent with the male-specific expression of Aldh1a1 in the chicken, because Sry
Fig. 3.
does not exist in nonmammalian vertebrates.
Aldh1a7 Is Also Expressed in Mouse Gonads Surprisingly, Aldh1a1-null mice show no obvious gonadal or fertility defects (Fan et al., 2003; Matt et al., 2005). Another site of strong Aldh1a1 expression is the dorsal retina, and it was expected that a retinal phenotype would be found in the Aldh1a1-null
Fig. 3. Quantitative analyses of expression. a: Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis (Taqman) of Sox9, Aldh1a1, and Cyp26b1 expression in knockout (KO) and wild-type (WT) samples taken at various stages of development (ts, tail somite) from a mouse line where Sox9 is almost completely deleted in gonadal tissues (Barrionuevo et al., 2006). Male (M) and female (F) urogenital ridge tissues were analyzed. Expression was normalized against Actb and the highest level of expression for each gene was set as 100%. Each bar represents the analysis of a single biological sample and the error bar indicates the variability (standard deviation) between technical replicates. b: Quantitative RT-PCR analysis (SYBR) of endogenous levels of expression of Aldh1a1 and Aldh1a7 (combined), Aldh1a3 and Aldh1a7 in wild-type 12.5 dpc male (M) and female (F) gonad only samples. This analysis allows comparison of expression levels between the sexes for each primer pair, but it is not valid to compare expression levels between different genes. Expression is relative to 18S rRNA and the highest level of expression for each assay was set as 100%. Each bar represents the analysis of three independent pools of gonadal tissues and the error bar indicates variability (standard deviation) among biological replicates. c: Quantitative RT-PCR analysis (Taqman) of Aldh1a1 in urogenital ridge samples taken at 13.5 dpc from Cyp26b1-null (⫺/⫺) and WT (⫹/⫹) littermate embryos (n ⫽ 3 for M⫹/⫹ and M⫺/⫺ genotypes and n ⫽ 2 for F⫹/⫹ genotype). Expression is shown relative to the endogenous control gene Actb. The level of statistical significance is shown for the comparison between WT and null male samples. In each case, error bars represent one standard deviation.
Aldh1a1 IN MOUSE AND CHICKEN FETAL TESTES 2077
mice, but none was reported (Fan et al., 2003). It is now known that, in that tissue, the function of Aldh1a1 is compensated for by Aldh1a3. Aldh1a3 is expressed at only low levels in male and female gonads at 12.5 dpc (data not shown), but there is no sex-specific expression (Fig. 3b) suggesting that Aldh1a3 is unlikely to compensate for Aldh1a1 in this system. In support of this, no defects in reproductive organs were noted in Aldh1a1/Aldh1a3 double-knockout mice (Matt et al., 2005). Similarly, Aldh1a8 is expressed at very low levels and non-sex specifically in the developing mouse gonads (data not shown). Aldh1a2 is not expressed at appreciable levels in the developing gonads but rather in the adjacent mesonephric tissue (Bowles et al., 2006). Aldh1a1 (NM_013467) is almost identical in sequence to Aldh1a7 (NM_011921), and the two genes are located adjacent to each other on chromosome 19 with transcripts encoded in opposite directions. The in situ probe used in this study would likely detect transcripts of both Aldh1a1 and Aldh1a7 if present, and it would not be possible to design an in situ probe that is specific for either gene. Therefore, a specific quantitative RT-PCR approach was used to discriminate between Aldh1a1 and Aldh1a7 expression. Aldh1a7 was 12.6-fold more highly expressed in the male gonad than in the female at 12.5 dpc (Fig. 3b), consistent with the possibility that ALDH1A7 could compensate functionally for ALDH1A1 in the Aldh1a1 knockout. This would be possible only if the function of ALDH1A1 is something other than RA production, however, because ALDH1A7 does not catalyze production of RA (Hsu et al., 1999). A further caveat to this hypothesis is that, in the Aldh1a1 KO, Aldh1a7 has been demonstrated to be two- to three-fold down-regulated, at least in bone marrow cells. This is likely to be an unanticipated effect of the neomycin resistance cassette remaining in the genome, adjacent to Aldh1a7 (Levi et al., 2009).
Aldh1a1 Expression May Be a Response to Low Levels of RA in the Male Gonad It is known that the presence of RA can negatively regulate the expression
of Aldh1a1 (Elizondo et al., 2000). In addition, it has been shown that depriving the Leydig-like cell line TM3 of serum—and hence RA—rapidly induces Aldh1a1 expression (Lopez-Fernandez and del Mazo, 1997). In the developing testis of the mouse, the RA-degrading enzyme CYP26B1 acts to clear the gonad of endogenous RA to ensure that germ cells do not enter meiosis during embryonic life (Bowles et al., 2006; Koubova et al., 2006). Hence, it is possible that high malespecific levels of Aldh1a1 expression in the developing testis are a response to this depletion of RA. It has been demonstrated also that, when CYP26B1 is not present in the male developing gonad, RA levels rise approximately three-fold (MacLean et al., 2007). We tested the possibility that Aldh1a1 might be regulated, in part, by RA levels in the gonad by examining its expression in Cyp26bknockout embryos and their wild-type littermates (Fig. 3c). In Cyp26b-null male gonads, Aldh1a1 expression levels were similar to those seen in the wild-type female gonads, and lower than the level of expression in wildtype male gonads at 13.5 dpc. These observations support the hypothesis that high expression of Aldh1a1 in the developing male gonad is a feedback response to depletion of RA in that tissue.
DISCUSSION We show here that Aldh1a1 is expressed at high levels and in a remarkably male-specific pattern from an early stage in developing mouse testes. This pattern of expression is conserved between mouse and chicken, suggesting that it might have a functional significance in vertebrate gonad development. In view of the known function of this enzyme in retinoid metabolism, and the apparent sensitivity of its gene expression to levels of RA in the gonad, a role in regulating retinoid balance during gonadal development seems likely. What might be the role of ALDH1A1 in the developing testis? This question is particularly vexed in view of previous studies establishing a role for retinoic acid in regulating germ cell entry into meiosis in the developing ovary and the importance of
reducing RA levels in the developing testis by means of CYP26B1 to prevent early meiosis, and hence entry into the oogenic pathway, in the male. The source of the high levels of RA in the fetal ovary is the adjacent mesonephric ducts and tubules, which express ALDH1A2 (Bowles et al., 2006; Bowles and Koopman, 2007). It is possible that a low-level, localized source of RA is necessary to ensure correct development in the male gonad, for example, in the newly specified preSertoli cells, and that the weak catalyst of RA production, ALDH1A1, might fulfill that purpose. Because previous studies have demonstrated that exogenously added RA actually disrupts normal testicular development at this early stage (Cupp et al., 1999; Livera et al., 2000; Li and Kim, 2004), any endogenous production of RA driven by Aldh1a1 would presumably have to be at low levels. Aldh1a1 expression is generally associated with regions of the embryo where morphogenesis requires low RA levels (Haselbeck et al., 1999), consistent with this possibility. Further support for this hypothesis is provided by our observation that, in the absence of CYP26B1, which leads to a three-fold elevation of endogenous RA levels (MacLean et al., 2007), Aldh1a1 expression decreases in the mouse fetal testis. Feedback inhibition of the Aldh1a1 promoter by RA has been reported previously (Elizondo et al., 2000). Falling RA concentration is unlikely to be the primary driver of Aldh1a1 expression because, in the chick, CYP26B1 expression does not become male-specific until later during development (Smith et al., 2008). Alternatively, it is possible that ALDH1A1 plays a role other than RA biosynthesis during testis development, perhaps functioning as a general detoxifying enzyme (Niederreither et al., 2002). ALDH enzymes exhibit broad substrate specificity and their expression is associated with metabolism of xenobiotics and with drug resistance (Alnouti and Klaassen, 2008). Further studies will be required to evaluate this possibility. Whatever role might be ascribed to ALDH1A1 in gonadal development, no obvious defect in testis development or fertility was reported when
2078 BOWLES ET AL.
Aldh1a1 was deleted in mice (Fan et al., 2003; Matt et al., 2005). Of the many genes identified as being male-specifically expressed, or upregulated in the developing testis relative to the ovary, Aldh1a1 is arguably of particular potential interest in reproductive biology. It is well known that Vitamin A (retinol) is essential for male reproduction and it is likely that at least some of this dependence is mediated by RA (Vernet et al., 2006a; Bowles and Koopman, 2007; Zhou et al., 2008). Postnatally, Aldh1a1 expression is not detectable at 1 day post natum (dpn), but it is strongly expressed in Sertoli cells at 5 dpn and then weakly at 10 and 20 dpn (Vernet et al., 2006b). Because the gene encoding the more efficient enzyme ALDH1A2 is expressed only weakly in Sertoli cells at 5 dpn, it appears that ALDH1A1 is the main RAsynthesizing enzyme at this critical time. The timing and cell-specificity of this expression pattern suggests that RA produced in situ by Aldh1a1 may be largely responsible for initiating the first wave of spermatogenesis at puberty in mice. Hence, it may be instructive to examine in detail whether the initiation of fertility in Aldh1a1null mice is delayed or otherwise compromised. It is interesting to note that a later analysis of the Aldh1a1 knockout demonstrated far less evidence of meiotic initiation at 5 dpn, as indicated by Stra8 (stimulated by retinoic acid gene 8) expression, than did wildtype controls (Vernet et al., 2006a). In view of these observations, the expression of Aldh1a1 in mouse and chicken fetal gonads may reflect a situation where regulation of the postnatal Sertoli cell seminiferous epithelial cycle is prefigured early in development (Timmons et al., 2002). The remarkable conservation and high level of expression of Aldh1a1 in the early developing testis indicate that a closer examination of the reproductive phenotype of the Aldh1a1 null mouse is warranted.
EXPERIMENTAL PROCEDURES Mouse Embryos All wild-type, X-linked green fluorescent protein (GFP; Hadjantonakis et
al., 1998) and We/We mice (Buehr et al., 1993) used were on a random-bred outbred Swiss albino background (Quackenbush strain). Noon of the day on which the mating plug was observed was designated 0.5 days post coitum (dpc). Tissues used for wholemount in situ hybridization, section in situ hybridization, and quantitative expression analysis of Aldh1a1 and Cyp26b1 (cytochrome P450, family 26, subfamily b, polypeptide 1, previously known as CP26, P450RAI-2, retinoic acid B1) were from embryos of the Quackenbush strain. Embryos containing Sox9-mutant gonads (Barrionuevo et al., 2006) and Cyp26b1-null gonads (Yashiro et al., 2004) were of a mixed C57BL/6J and129 background. Sox9 (SRY-box containing gene 9) mutant gonads still express low levels of SOX9, because they are generated using a conditional Sox9 deletion line and a line in which CRE recombinase is expressed under the control of the Krt19 (keratin 19, previously known as Cytokeratin 19) promoter (Barrionuevo et al., 2006). When necessary, embryo sexing was carried out by analysis of tail tissue for the presence of Zfy as described (Koopman et al., 1991). All animal work was conducted treated according to protocols approved by Institutional Animal Ethics Committees.
Chicken Embryos Fertile chicken eggs (White Leghorn ⫻ Australop cross) were incubated at 37.8°C under humid conditions. Embryos were staged according to the standard morphological criteria (Hamburger and Hamilton, 1992). Chicken embryos were sexed by PCR, using W (female)-specific Xho1 primers and 18S rRNA primers as internal controls, as described previously (Clinton et al., 2001).
Dissection, RNA Isolation, and cDNA Synthesis Gonads plus mesonephros complexes were dissected from embryos and subjected to RNA synthesis (Qiagen RNeasy mini or micro kits, including DNase treatment) and cDNA synthesis (Applied Biosystems [ABI], HighCapacity cDNA Archive kit).
In Situ Hybridization In situ hybridization was performed as described for mouse (Hargrave et al., 2006) and chicken (Smith et al., 2008). The mouse Aldh1a1 probe used for in situ hybridization spans nucleotides 1447-2032 of the mouse Aldh1a1 transcript, and encodes part of exon 12, exon 13, and the entire 3⬘ untranslated region (UTR; NM_013467). This probe will also detect expression of the highly related gene Aldh1a7. The chicken ALDH1A1 probe was a gift of Malcolm Maden, King’s College London (Reijntjes et al., 2003). Probes for the Sertoli cell marker Amh (antiMullerian hormone), the Leydig cell marker Cyp11a (cytochrome P450, family 11, subfamily a, polypeptide 1, previously known as cholesterol sidechain cleavage, Scc, P450scc), and Sry and Cyp26b1 have been described (Koopman et al., 1990; Munsterberg and Lovell-Badge, 1991; Martineau et al., 1997; Bowles et al., 2006). The identity of all clones was confirmed by sequencing.
Quantitative RT-PCR Relative cDNA levels were analyzed by the comparative cycle time (Ct) method of quantitative RT-PCR (qRTPCR) with reactions including Taqman PCR master mix (ABI) and 1 ⫻ Taqman gene expression sets or SYBR master mix (ABI) and standard PCR primers (Sigma). Duplicate (Taqman) or triplicate (SYBR) assays were carried out on an ABI Prism 7000 Sequence Detector System, and the mean relative level of expression and associated standard deviations were calculated. Endogenous control primers, used to normalize gene expression levels, were Actb (actin beta, previously known as -actin; for Taqman analyses) and 18S rRNA (for SYBR analyses). Statistical significance of changes in relative gene expression was assessed by unpaired Student’s two-tailed t-test analysis. Taqman gene expression sets were as follows: Aldh1a1, Mm00657317_ m1; Sox9, Mm00448840_m1; Cyp26b1, Mm00558507_m1; and Actb endogenous control, 4352933E (ABI). For analysis using SYBR, primers were: 18S rRNA, 5⬘ GATCCATTGGAGGGCAAGTCT and 5⬘ CCAAGATCCAACTACGAGCTTTTT and Aldh1a1, 5⬘ CCTTG-
Aldh1a1 IN MOUSE AND CHICKEN FETAL TESTES 2079
CATTGTGTTTGCAGATG and 5⬘ GCTCGCTCAACACTCCTTTTC. The Taqman assay for Aldh1a1 will not amplify the highly related gene Aldh1a7, whereas the primers for Aldh1a7 in the SYBR assay are unlikely to amplify the Aldh1a1 transcript because of sequence mismatches at the 3⬘ end of one primer. To estimate the relative expression levels of Aldh1a1 and Aldh1a7 (combined), common forward (5⬘GATAAGGTGCTTTCCATTGTAG3⬘) and reverse primers (5⬘-GGGAGGCATTTCATTTGAC-3⬘) were used. These amplify a 200-bp fragment from Aldh1a1 (1790 to 1990 in NM_013467) and a 214-bp fragment from Aldh1a7 (1803 to 2017 in NM_011921). To estimate the relative expression of Aldh1a7 alone in male and female gonad samples, a specific reverse primer was used in combination with the forward primer shown above (5⬘-CACAACACTCAGAGGAATAACC-3⬘, nucleotides 1948 to 1969). Nucleotides shown in bold are not present in the Aldh1a1 transcript and correspond to a 14-bp insertion in the 3⬘ UTR of the Aldh1a7 transcript. Primers for the detection of Aldh1a3 (aldehyde dehydrogenase family 1, subfamily A3, previously known as ALDH6, RALDH3, retinaldehyde dehydrogenase 3, V1) were 5⬘-AACGACTGGCACGAATCCAAGAG-3⬘ and 5⬘TTGTCCACATCGGGCTTATCTCC3⬘. For these qRT-PCR analyses, Tm was 51°C rather than 60°C, SYBR green mix (ABI) was used, and 18S rRNA was used to normalize.
ACKNOWLEDGMENTS We thank Malcom Maden for the chick Aldh1a1 probe, Andras Nagy for the X-linked GFP mouse line, and Hiroshi Hamada for the Cyp26b1 knockout mouse line. We thank Anne Hardacre and the IMB animal facility staff for assistance in animal care. P.K. is a Federation Fellow of the ARC. A.H.S., P.K., and V.R.H. were funded by the National Health & Medical Research Program.
REFERENCES Alnouti Y, Klaassen CD. 2008. Tissue distribution, ontogeny, and regulation of aldehyde dehydrogenase (Aldh) enzymes mRNA by prototypical microsomal en-
zyme inducers in mice. Toxicol Sci 101: 51– 64. Barrionuevo F, Bagheri-Fam S, Klattig J, Kist R, Taketo MM, Englert C, Scherer G. 2006. Homozygous inactivation of Sox9 causes complete XY sex reversal in mice. Biol Reprod 74:195–201. Beverdam A, Koopman P. 2006. Expression profiling of purified mouse gonadal somatic cells during the critical time window of sex determination reveals novel candidate genes for human sexual dysgenesis syndromes. Hum Mol Genet 15:417– 431. Bishop CE, Whitworth DJ, Qin Y, Agoulnik AI, Agoulnik IU, Harrison WR, Behringer RR, Overbeek PA. 2000. A transgenic insertion upstream of sox9 is associated with dominant XX sex reversal in the mouse. Nat Genet 26:490 – 494. Bouma GJ, Affourtit JP, Bult CJ, Eicher EM. 2007. Transcriptional profile of mouse pre-granulosa and Sertoli cells isolated from early-differentiated fetal gonads. Gene Expr Patterns 7:113–123. Bowles J, Koopman P. 2007. Retinoic acid, meiosis and germ cell fate in mammals. Development 134:3401–3411. Bowles J, Bullejos M, Koopman P. 2000. A subtractive gene expression screen suggests a role for vanin-1 in testis development in mice. Genesis 27:124 –135. Bowles J, Knight D, Smith C, Wilhelm D, Richman J, Mamiya S, Yashiro K, Chawengsaksophak K, Wilson MJ, Rossant J, Hamada H, Koopman P. 2006. Retinoid signaling determines germ cell fate in mice. Science 312:596 – 600. Buehr M, McLaren A, Bartley A, Darling S. 1993. Proliferation and migration of primordial germ cells in We/We mouse embryos. Dev Dyn 198:182–189. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, Oyama R, Ravasi T, Lenhard B, Wells C, Kodzius R, Shimokawa K, Bajic VB, Brenner SE, Batalov S, Forrest AR, Zavolan M, Davis MJ, Wilming LG, Aidinis V, Allen JE, Ambesi-Impiombato A, Apweiler R, Aturaliya RN, Bailey TL, Bansal M, Baxter L, Beisel KW, Bersano T, Bono H, Chalk AM, Chiu KP, Choudhary V, Christoffels A, Clutterbuck DR, Crowe ML, Dalla E, Dalrymple BP, de Bono B, Della Gatta G, di Bernardo D, Down T, Engstrom P, Fagiolini M, Faulkner G, Fletcher CF, Fukushima T, Furuno M, Futaki S, Gariboldi M, Georgii-Hemming P, Gingeras TR, Gojobori T, Green RE, Gustincich S, Harbers M, Hayashi Y, Hensch TK, Hirokawa N, Hill D, Huminiecki L, Iacono M, Ikeo K, Iwama A, Ishikawa T, Jakt M, Kanapin A, Katoh M, Kawasawa Y, Kelso J, Kitamura H, Kitano H, Kollias G, Krishnan SP, Kruger A, Kummerfeld SK, Kurochkin IV, Lareau LF, Lazarevic D, Lipovich L, Liu J, Liuni S, McWilliam S, Madan Babu M, Madera M, Marchionni L, Matsuda H, Matsuzawa S, Miki H, Mignone F, Miyake S, Morris K, Mottagui-Tabar S, Mulder N, Nakano N, Nakauchi H, Ng P, Nilsson R, Nishiguchi S, Nishikawa S, Nori F, Ohara O, Okazaki Y, Orlando V, Pang KC, Pavan WJ,
Pavesi G, Pesole G, Petrovsky N, Piazza S, Reed J, Reid JF, Ring BZ, Ringwald M, Rost B, Ruan Y, Salzberg SL, Sandelin A, Schneider C, Schonbach C, Sekiguchi K, Semple CA, Seno S, Sessa L, Sheng Y, Shibata Y, Shimada H, Shimada K, Silva D, Sinclair B, Sperling S, Stupka E, Sugiura K, Sultana R, Takenaka Y, Taki K, Tammoja K, Tan SL, Tang S, Taylor MS, Tegner J, Teichmann SA, Ueda HR, van Nimwegen E, Verardo R, Wei CL, Yagi K, Yamanishi H, Zabarovsky E, Zhu S, Zimmer A, Hide W, Bult C, Grimmond SM, Teasdale RD, Liu ET, Brusic V, Quackenbush J, Wahlestedt C, Mattick JS, Hume DA, Kai C, Sasaki D, Tomaru Y, Fukuda S, Kanamori-Katayama M, Suzuki M, Aoki J, Arakawa T, Iida J, Imamura K, Itoh M, Kato T, Kawaji H, Kawagashira N, Kawashima T, Kojima M, Kondo S, Konno H, Nakano K, Ninomiya N, Nishio T, Okada M, Plessy C, Shibata K, Shiraki T, Suzuki S, Tagami M, Waki K, Watahiki A, Okamura-Oho Y, Suzuki H, Kawai J, Hayashizaki Y. 2005. The transcriptional landscape of the mammalian genome. Science 309:1559 –1563. Clinton M, Haines L, Belloir B, McBride D. 2001. Sexing chick embryos: a rapid and simple protocol. Br Poult Sci 42:134 –138. Cupp AS, Dufour JM, Kim G, Skinner MK, Kim KH. 1999. Action of retinoids on embryonic and early postnatal testis development. Endocrinology 140:2343–2352. Duester G. 2000. Families of retinoid dehydrogenases regulating vitamin A function: production of visual pigment and retinoic acid. Eur J Biochem 267:4315– 4324. Elizondo G, Corchero J, Sterneck E, Gonzalez FJ. 2000. Feedback inhibition of the retinaldehyde dehydrogenase gene ALDH1 by retinoic acid through retinoic acid receptor alpha and CCAAT/enhancer-binding protein beta. J Biol Chem 275:39747–39753. Fan X, Molotkov A, Manabe S, Donmoyer CM, Deltour L, Foglio MH, Cuenca AE, Blaner WS, Lipton SA, Duester G. 2003. Targeted disruption of Aldh1a1 (Raldh1) provides evidence for a complex mechanism of retinoic acid synthesis in the developing retina. Mol Cell Biol 23:4637– 4648. Grimmond S, Van Hateren N, Siggers P, Arkell R, Larder R, Soares MB, de Fatima Bonaldo M, Smith L, TymowskaLalanne Z, Wells C, Greenfield A. 2000. Sexually dimorphic expression of protease nexin-1 and vanin-1 in the developing mouse gonad prior to overt differentiation suggests a role in mammalian sexual development. Hum Mol Genet 9:1553–1560. Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. 1990. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346:245– 250.
2080 BOWLES ET AL.
Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A. 1998. Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mech Dev 76:79 –90. Hamburger V, Hamilton HL. 1992. A series of normal stages in the development of the chick embryo. 1951. Dev Dyn 195: 231–272. Hargrave M, Bowles J, Koopman P. 2006. In situ hybridization of whole-mount embryos. Methods Mol Biol 326:103–113. Haselbeck RJ, Hoffmann I, Duester G. 1999. Distinct functions for Aldh1 and Raldh2 in the control of ligand production for embryonic retinoid signaling pathways. Dev Genet 25:353–364. Hsu LC, Chang WC, Hoffmann I, Duester G. 1999. Molecular analysis of two closely related mouse aldehyde dehydrogenase genes: identification of a role for Aldh1, but not Aldh-pb, in the biosynthesis of retinoic acid. Biochem J 339(pt 2): 387–395. Kent J, Wheatley SC, Andrews JE, Sinclair AH, Koopman P. 1996. A male-specific role for SOX9 in vertebrate sex determination. Development 122:2813–2822. Koopman P, Munsterberg A, Capel B, Vivian N, Lovell-Badge R. 1990. Expression of a candidate sex-determining gene during mouse testis differentiation. Nature 348:450 – 452. Koopman P, Gubbay J, Vivian N, Goodfellow P, Lovell-Badge R. 1991. Male development of chromosomally female mice transgenic for Sry. Nature 351:117–121. Koubova J, Menke DB, Zhou Q, Capel B, Griswold MD, Page DC. 2006. Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proc Natl Acad Sci U S A 103:2474 –2479. Levi BP, Omer HY, Duester G, Morrison SJ. 2009. Aldehyde dehydrogenase 1a1 is dispensable for stem cell function in the mouse hematopoietic and nervous systems. Blood 113:1670 –1680. Li H, Kim KH. 2004. Retinoic acid inhibits rat XY gonad development by blocking mesonephric cell migration and decreasing the number of gonocytes. Biol Reprod 70:687– 693. Livera G, Rouiller-Fabre V, Durand P, Habert R. 2000. Multiple effects of retinoids on the development of Sertoli, germ, and Leydig cells of fetal and neonatal rat testis in culture. Biol Reprod 62:1303–1314. Lopez-Fernandez LA, del Mazo J. 1997. The cytosolic aldehyde dehydrogenase
gene (Aldh1) is developmentally expressed in Leydig cells. FEBS Lett 407: 225–229. MacLean G, Li H, Metzger D, Chambon P, Petkovich M. 2007. Apoptotic extinction of germ cells in testes of Cyp26b1 knockout mice. Endocrinology 148:4560 – 4567. Mark M, Ghyselinck NB, Chambon P. 2006. Function of retinoid nuclear receptors: lessons from genetic and pharmacological dissections of the retinoic acid signaling pathway during mouse embryogenesis. Annu Rev Pharmacol Toxicol 46:451– 480. Martineau J, Nordqvist K, Tilmann C, Lovell-Badge R, Capel B. 1997. Malespecific cell migration into the developing gonad. Curr Biol 7:958 –968. Matt N, Dupe V, Garnier JM, Dennefeld C, Chambon P, Mark M, Ghyselinck NB. 2005. Retinoic acid-dependent eye morphogenesis is orchestrated by neural crest cells. Development 132:4789 – 4800. McClive PJ, Hurley TM, Sarraj MA, van den Bergen JA, Sinclair AH. 2003. Subtractive hybridisation screen identifies sexually dimorphic gene expression in the embryonic mouse gonad. Genesis 37: 84 –90. Menke DB, Page DC. 2002. Sexually dimorphic gene expression in the developing mouse gonad. Gene Expr Patterns 2:359 –367. Munsterberg A, Lovell-Badge R. 1991. Expression of the mouse anti-mullerian hormone gene suggests a role in both male and female sexual differentiation. Development 113:613– 624. Nef S, Schaad O, Stallings NR, Cederroth CR, Pitetti JL, Schaer G, Malki S, Dubois-Dauphin M, Boizet-Bonhoure B, Descombes P, Parker KL, Vassalli JD. 2005. Gene expression during sex determination reveals a robust female genetic program at the onset of ovarian development. Dev Biol 287:361–377. Niederreither K, Subbarayan V, Dolle P, Chambon P. 1999. Embryonic retinoic acid synthesis is essential for early mouse post-implantation development. Nat Genet 21:444 – 448. Niederreither K, Vermot J, Fraulob V, Chambon P, Dolle P. 2002. Retinaldehyde dehydrogenase 2 (RALDH2)- independent patterns of retinoic acid synthesis in the mouse embryo. Proc Natl Acad Sci U S A 99:16111–16116. Qin Y, Bishop CE. 2005. Sox9 is sufficient for functional testis development producing fertile male mice in the absence of Sry. Hum Mol Genet 14:1221–1229.
Reijntjes S, Gale E, Maden M. 2003. Expression of the retinoic acid catabolising enzyme CYP26B1 in the chick embryo and its regulation by retinoic acid. Gene Expr Patterns 3:621– 627. Romand R, Dolle P, Hashino E. 2006. Retinoid signaling in inner ear development. J Neurobiol 66:687–704. Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf AM, Lovell-Badge R, Goodfellow PN. 1990. A gene from the human sex-determining region encodes a protein with homology to a conserved DNAbinding motif. Nature 346:240 –244. Smith CA, Roeszler KN, Bowles J, Koopman P, Sinclair AH. 2008. Onset of meiosis in the chicken embryo; evidence of a role for retinoic acid. BMC Dev Biol 8:85. Timmons PM, Rigby PW, Poirier F. 2002. The murine seminiferous epithelial cycle is pre-figured in the Sertoli cells of the embryonic testis. Development 129:635– 647. Vasiliou V, Pappa A, Estey T. 2004. Role of human aldehyde dehydrogenases in endobiotic and xenobiotic metabolism. Drug Metab Rev 36:279 –299. Vernet N, Dennefeld C, Guillou F, Chambon P, Ghyselinck NB, Mark M. 2006a. Prepubertal testis development relies on retinoic acid but not rexinoid receptors in Sertoli cells. EMBO J 25:5816 –5825. Vernet N, Dennefeld C, Rochette-Egly C, Oulad-Abdelghani M, Chambon P, Ghyselinck NB, Mark M. 2006b. Retinoic acid metabolism and signaling pathways in the adult and developing mouse testis. Endocrinology 147:96 –110. Vidal VP, Chaboissier MC, de Rooij DG, Schedl A. 2001. Sox9 induces testis development in XX transgenic mice. Nat Genet 28:216 –217. Yashiro K, Zhao X, Uehara M, Yamashita K, Nishijima M, Nishino J, Saijoh Y, Sakai Y, Hamada H. 2004. Regulation of retinoic acid distribution is required for proximodistal patterning and outgrowth of the developing mouse limb. Dev Cell 6:411– 422. Zhou Q, Nie R, Li Y, Friel P, Mitchell D, Hess RA, Small C, Griswold MD. 2008. Expression of stimulated by retinoic acid gene 8 (Stra8) in spermatogenic cells induced by retinoic acid: an in vivo study in vitamin A-sufficient postnatal murine testes. Biol Reprod 79:35– 42.
