Mammalian Hyaluronidase Induces Ovarian Granulosa Cell Apoptosis ...

0013-7227/08/$15.00/0 Printed in U.S.A.

Endocrinology 149(11):5835–5847 Copyright © 2008 by The Endocrine Society doi: 10.1210/en.2008-0175

Mammalian Hyaluronidase Induces Ovarian Granulosa Cell Apoptosis and Is Involved in Follicular Atresia Adriana M. Orimoto, Karine Dumaresq-Doiron, Jin-Yi Jiang, Nongnuj Tanphaichitr, Benjamin K. Tsang, and Euridice Carmona Maisonneuve-Rosemont Hospital Research Center (A.M.O., K.D.-D., E.C.), Montreal, Quebec, Canada H1T 2M4; Department of Medicine (E.C.), University of Montreal, Montreal, Quebec, Canada H3T 1J4; Chronic Disease Program (J.-Y.J., N.T., B.K.T.), Ottawa Health Research Institute, Ottawa, Canada K1Y 4E9; and Departments of Obstetrics and Gynecology (N.T., B.K.T.), Cellular and Molecular Medicine (B.K.T.), and Biochemistry, Microbiology, and Immunology (N.T.), University of Ottawa, Ottawa, Canada K1H 8M5 During ovarian folliculogenesis, the vast majority of follicles will undergo atresia by apoptosis, allowing a few dominant follicles to mature. Mammalian hyaluronidases comprise a family of six to seven enzymes sharing the same catalytic domain responsible for hyaluronan hydrolysis. Interestingly, some of these enzymes have been shown to induce apoptosis. In the ovary, expression of three hyaluronidases (Hyal-1, Hyal-2, and Hyal-3) has been documented. However, their precise cellular localization and role in ovarian regulation have not yet been defined. We herein investigated the possible involvement of these enzymes in ovarian atresia. First, we established a mouse model for ovarian atresia (gonadotropin withdrawal by anti-equine chorionic gonadotropin treatment) and showed that the mRNA levels of Hyal-1, Hyal-2, and Hyal-3 were significantly increased in apoptotic granulosa cells as well as in atretic follicles. Second, using ovaries of

M

AMMALIAN HYALURONIDASES (EC 3.2.1.35) are endo-␤-N-acetyl-hexosaminidases, which hydrolyze hyaluronic acid (HA), and to a lesser extent chondroitin and chondroitin sulfate, to generate mostly tetrasaccharides. Six hyaluronidase-like sequences have been described in the human genome, with approximately 35% identity with each other. They are clustered in groups of three on the chromosome 3p21.3 (Hyal1, Hyal2, and Hyal3) and the chromosome 7q31.3 (Hyal4, PH20/Spam1, and Hyalp1) (1, 2). The orthologous mouse genes are found on correlated regions on chromosomes 9F1-F2 and 6A2 (1, 3). In addition, the seventh gene has recently been reported in the mouse chromosome 6A2, Hyal5, which is not present in the human genome (4 – 6). Another difference between the mouse and human hyaluronidase genes is that Hyalp1 is a pseudogene in humans due to the presence of a premature stop codon, whereas the expression of the mouse Hyalp1 normally yields a functional enzyme (1, 2, 5, 7). Interestingly, the tissue distribution of these enzymes appears to be related to their chromosomal grouping. Hyal-1, Hyal-2, and Hyal-3, clustered in one chro-

First Published Online July 24, 2008 Abbreviations: DIG, Digoxigenin; eCG, equine chorionic gonadotropin; EGFP, enhanced green fluorescent protein; FBS, fetal bovine serum; HA, hyaluronic acid; PARP, poly-ADP-ribose polymerase. Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.

normally cycling mice, we demonstrated the correlation of Hyal-1 mRNA and protein expression with cleavage of caspase-3. In addition, we showed that expression of all three hyaluronidases induced apoptosis in transfected granulosa cells. Significantly, the induction of apoptosis by hyaluronidases was independent of catalytic activity, because enzymatically inactive Hyal-1 mutant (D157A/E159A) was as efficient as the wild-type enzyme in apoptosis induction. The activation of the extrinsic apoptotic signaling pathway was involved in this induction, because increased levels of cleaved caspase-8, caspase-3, and poly-ADP-ribose polymerase (PARP) were observed upon hyaluronidase ectopic expression. Our present findings provide a better understanding of the role of hyaluronidases in ovarian functions, showing for the first time their involvement in follicular atresia. (Endocrinology 149: 5835–5847, 2008)

mosome, are ubiquitously expressed, whereas the other three to four hyaluronidases clustered in another chromosome are expressed mainly in the male reproductive system (4, 6, 8 –10). In the ovary, expression of Hyal-1, Hyal-2, and Hyal-3 has been shown by Northern blotting and RT-PCR (4, 8). However, their precise location and the role in ovarian function have yet to be described, and these are the topics of our present investigation. Among these seven mammalian hyaluronidases, Hyal-1, Hyal-2, and PH20/Spam1 have been well characterized. Hyal-1 and Hyal-2 are the main somatic hyaluronidases responsible for HA turnover and have several physiological and pathological roles (for review see Refs. 1, 11, and 12). PH20/Spam1 is known as the testis/sperm hyaluronidase involved in secondary zona pellucida binding and responsible for the dispersion of the cumulus-oocyte complex via hydrolysis of hyaluronan networks that connect the cumulus cell layers (6, 13, 14). Due to a change in one amino acid from the conserved catalytic residues, Hyal-4 is suggested to be a chondroitinase enzyme instead of a hyaluronan-degrading enzyme (1, 2, 15). However, this notion has not yet been substantiated. Hyal-3 has also recently been reported to be devoid of hyaluronan enzymatic activity (16, 17). In mice, Hyal-5 and Hyalp1 have similar properties as PH20/Spam1 in male reproduction (4, 7). Interestingly, some of these hyaluronidases can induce apoptosis under certain conditions. It has been reported that overexpressed Hyal-1 or Hyal-2 as

5835

5836

Endocrinology, November 2008, 149(11):5835–5847

well as exogenous PH20 increase the sensitivity of lung and prostate cancer cell lines to TNF-␣ cytotoxicity (18, 19), a response antagonized by TGF-␤ (18, 20). Hyaluronidases act by inducing the expression and phosphorylation of the proapoptotic protein WOX1 (a WW domain-containing oxidoreductase) (19 –21). Phosphorylated WOX1 binds to activated p53, and the complex translocates to the mitochondria and nuclei to mediate apoptosis (22, 23). Apoptosis is an essential process in ovarian follicle development and functions. In the fetus, apoptosis occurs mainly in the oocyte, but in the adult, it occurs in the supporting cells (granulosa and theca cells) of growing follicles. In fact, during folliculogenesis, most of the follicles (99%) undergo atresia by apoptosis (24). Atresia is the phenomenon by which follicles that are not selected to ovulate are eliminated. It is widely accepted that gonadotropins play an important role in determining the fate of a follicle and that whether a follicle will grow or undergo atresia depends on the relative expression of cell death and survival genes (25–27). Several death and survival pathways are known to play a role in the induction of granulosa cell apoptosis (for review see Refs. 26 and 27). The activation of the extrinsic death receptor pathway (Fas/Fas ligand system and TNF receptors) leads to activation of caspase-8 and -3, whereas the activation of the intrinsic (mitochondrial) pathway results in up-regulation of proapoptotic protein p53, mitochondrial cytochrome c release, and activation of caspase-9 and -3, concurrently with down-regulation of X-linked inhibitor of apoptosis. In the present work, we investigated whether hyaluronidase is proapoptotic in granulosa cells and is involved in follicular atresia. We demonstrated that somatic hyaluronidases are mainly expressed in granulosa cells and that their expression levels are elevated during apoptosis induction as well as in atretic follicles. This is the first evidence showing the specific cellular localization of somatic hyaluronidases in the ovary and the potential role of these enzymes in follicular atresia. Our results suggested that hyaluronidases are expressed under gonadotropin regulation, and we showed that these enzymes could induce apoptosis in cultured granulosa cells, although this induction was not dependent on their intrinsic enzymatic activity. Materials and Methods Animals ICR (CD-1) male and female mice, purchased from Harlan (Indianapolis, IN), were mated at the Animal Facility of the MaisonneuveRosemont Hospital Research Center to produce sexually immature female mice (17–18 d old) for our experiments. A set of 3- and 7-wk-old mice were also used in our studies. Animals were maintained in a temperature-controlled room with a 10-h dark, 14-h light cycle and were provided with food and water ad libitum. Protocols for the use and killing (by cervical dislocation) of animals were approved by the Animal Care Committee of the Maisonneuve-Rosemont Hospital Research Center.

Mouse model for ovarian atresia Ovarian follicular atresia was induced in mice according to a procedure described previously for rats (28). Immature female mice were injected ip with 2.5 IU equine chorionic gonadotropin (eCG) (also known as pregnant mare serum gonadotropin; Sigma-Aldrich Canada, Oakville, Ontario, Canada) and 24 h later with 100 ␮l anti-eCG IgG antiserum (dilution 1:100 in PBS). Control mice were those injected

Orimoto et al. • Role of Hyaluronidase in Follicular Atresia

likewise with eCG but were subsequently injected with normal rabbit serum (1:100 in PBS) instead of anti-eCG antiserum. Anti-eCG antiserum was produced at the Ottawa Health Research Institute as described previously (29). The antibody with the highest titer (around 8 million) was used in the present study to obtain the best eCG withdrawal with minimal serum volume injected. Mice were killed at different time intervals (6, 12, or 24 h) after serum injection, and ovaries were excised, cleared of adhering fat, and fixed in Bouin’s solution (Lab Chem Inc., Pittsburgh, PA) for histology or 4% buffered paraformaldehyde for in situ hybridization or placed in complete RPMI medium containing HEPES (see below) for granulosa cell collection.

Histology and follicle counting Ovaries fixed in Bouin’s solution were dehydrated through increasing concentrations of ethanol, treated with xylene, and embedded in paraffin. The whole ovary was serially sectioned (5 ␮m thick), and all sections were mounted on microscope slides and stained with hematoxylin/eosin. Every 20 sections (100-␮m interval between sections), starting from the beginning through the entire ovary, were viewed under a microscope, and antral follicles showing oocyte nuclei were counted. This procedure avoided the counting of the same antral follicle twice because the average size of a mouse oocyte in this type of follicle is 70 ␮m (30). Primordial and primary follicles were excluded from our counting because these types of follicles did not respond to eCG treatment. Follicles were classified according to Pedersen and Peters (31, 32). Small antral (⬍200 ␮m diameter) and antral follicles (⬎200 ␮m diameter) were considered apoptotic when five or more pyknotic nuclei were observed in granulosa cell layers (33). Micrographs of representative sections were photographed using an Axio-Imager Z1, camera Axiocam, and the software Axio-Vision version 4 for image acquisition (all from Carl Zeiss, Jena, Germany). Follicle counting was performed in ovaries collected from five to six different mice for each animal group.

Digoxigenin (DIG)-labeled in situ hybridization PCR products of around 300 bp corresponding to exons 3 and 4 of mouse Hyal-1, Hyal-2, and Hyal-3 cDNAs (see Table 1) were subcloned into pCRII (TA cloning kit Dual Promoter; Invitrogen, Burlington, Ontario, Canada) and used to produce the RNA probes. Antisense and sense RNA probes were generated using appropriate RNA polymerases and were labeled with DIG-11-UTP, using an in vitro transcription Riboprobe System (Roche Applied Science, Indianapolis, IN) following the manufacturer’s protocol. Probes were immediately used or stored at ⫺80 C for no more than 2 d. Excised ovaries, fixed in 4% buffered paraformaldehyde, were incubated in 30% buffered sucrose, mounted in cryomatrix, and stored at ⫺80 C until use. Frozen tissue sections (10 ␮m thick) were placed onto Super-Frost microscope slides (Fisher Scientific, Pittsburgh, PA), air dried, and fixed in 4% paraformaldehyde in diethylpyrocarbonate-treated PBS. After acetylation (0.25% acetic anhydride and 0.1 m triethanolamine, pH 8.0), sections were incubated (2 h) in hybridization buffer (50% formamide, 5⫻ saline sodium citrate, 5⫻ Denhardt’s solution, 250 ␮g/ml baker’s yeast RNA, and 500 ␮g/ml herring sperm DNA). The probes were denatured, diluted to 400 ng/ml in hybridization buffer, and applied to the sections on the slides for 20 h at 72 C. Slides were then washed in 0.2⫻ saline sodium citrate at 72 C (2 h) and at room temperature (5 min), blocked in 10% fetal bovine serum (FBS), and incubated with alkaline phosphatase-anti-DIG antibody 关Roche; 1:3000 in 0.1 m Tris-HCl, 0.15 m NaCl (pH 7.5) containing 1% FBS兴. Positive hybridization (dark blue/ purple color) was visualized after the reaction with the alkaline phosphatase substrate nitroblue-tertrazolium/5-bromocresyl-3-indolylphosphate solution (Sigma-Aldrich Canada). Slides were mounted in 50% glycerol/PBS, and images were captured with the Carl Zeiss microscope. These experiments were repeated at least three times using ovaries collected from different mice for each animal group and each probe.

Cleaved caspase-3 immunohistochemistry Frozen ovarian sections (10 ␮m thick, serially sectioned from in situ hybridization experiments) were placed onto Super-Frost glass slides, dried, and fixed in 4% paraformaldehyde as described above. After washing in PBS, sections were incubated overnight at 4 C with anti-



5837

TABLE 1. Oligonucleotide primers used for specific amplifications of mouse Hyal-1, Hyal-2, Hyal-3, and ␤-actin in various experimental approaches Primer name

Mouse Hyal-1 GI 145966880 Hyal-1 Real F Hyal-1 Real R Hyal-1 ISH F Hyal-1 ISH R FL Hyal-1 F FL Hyal-1 R Mouse Hyal-2 GI 45331201 Hyal-2 Real F Hyal-2 Real R Hyal-2 ISH F Hyal-2 ISH R FL Hyal-2 F FL Hyal-2 R Mouse Hyal-3 GI 30842787 Hyal-3 Real F Hyal-3 Real R Hyal-3 ISH F Hyal-3 ISH R FL Hyal-3 F FL Hyal-3 R Mouse ␤-actin GI 145966868 ␤-Actin Real F ␤-Actin Real R

Sequence 5⬘–3⬘

Location on GI

GCTCAGACAAAACAAGTACCAAGGA GAGAGCCTCAGGATAACTTGGATG CATTAAAGCATACATGGATTCCACA CTTGTCACACCACTTGCCTCTC GGACAGAATCCGGCCAAGA GTGTGTGCAGTTGGGTGCA

1119 –1143 1465–1483 1156 –1180 1423–1444 48 – 66 1465–1483

CTTATCTCTACCATCGGTGAGAGTG GCAGCTGAGTTAGGTAATTCTTGA CAGCTGCTGGTTCCCTACATAGTC ATTTCCAGCTGCCCCCTTATAGT GGTAACACTTCCTGTAGCC ATATCCAGGGGGAGAGATC

1045–1069 1145–1168 1162–1185 1439 –1461 93–111 1542–1560

TGAGCTTCTCTAGCTCTGAGGAAA ATGACATCGCTGGTGACTGCAA CTTTAGGCCCCTATGTGATCAATGT GGGAAAGTCCCATAAGCTAAACAAA GTCTCCATCTCTGTGGCATGAT TATGTTGGGCTCAGGGTTTAG

1015–1038 1115–1136 1072–1096 1371–1396 31–52 1276 –1296

ATCGTGGGCCGCCCTAGGCACCA TCCATGTCGTCCCAGTTGGTAACAA

179 –201 303–327

Product size (bp)

169 288 1435 123 299 1467 121 324 1256 148

F, Forward; FL, full-length sequence; ISH, in situ hybridization; R, reverse; Real, real-time RT-PCR.

cleaved caspase-3 IgG (1:200; Cell Signaling Technology, Danvers, MA), and the reactivity between the antibody-antigen was detected using the Vectastain Universal Elite ABC kit (Vector Laboratories, Burlingame, CA) and 3,3⬘-diaminobenzidine SigmaFast tablets (Sigma-Aldrich Canada) as the peroxidase substrate. The procedures given by the manufacturer were followed for this detection. Sections were not counterstained, and positive signal was revealed as a black/dark brown color. Slides were mounted in 50% glycerol/PBS, and images were captured with the Carl Zeiss microscope. Experiments were repeated at least three times using ovaries from different animals for each group.

Granulosa cell collection and culture Ovaries were excised after the injections of eCG plus anti-eCG antibody or normal serum (see above) and placed in RPMI 1640 medium (Invitrogen) supplemented with 10% FBS, 0.5% penicillin/streptomycin (10,000 U/ml penicillin G sodium and 10,000 ␮g/ml streptomycin sulfate; Invitrogen), 0.25% fungizone (250 ␮g/ml amphotericin B; Invitrogen), and 10 mm HEPES (pH 7.3). Ovaries were placed in 35-mm culture dishes, and granulosa cells were harvested by follicle puncture, using a 28.5-gauge needle as previously described for rat granulosa cell isolation (28). After follicle puncture, granulosa cell suspension and ovary pellets were collected in a tube and were thoroughly mixed by pipetting up and down. This suspension was let sit for 3 min to allow the big pieces (ovarian tissue, cumulus-oocyte complex, and follicular membrane) to sink to the bottom of the tube. The supernatant (granulosa cell suspension) was transferred to a new tube, washed in PBS, and resuspended in the appropriate solution for apoptosis analysis, RNA extraction, or immunoblotting. In another set of experiments granulosa cells were collected from untreated mice of 3 or 7 wk of age. Granulosa cells were cultured as previously described (34), with some modifications. Briefly, ovaries were collected 24 h after eCG injection (5 IU), and granulosa cells were collected by follicle puncture as described above. About 0.4 million viable cells 关assessed by Trypan Blue (Invitrogen) exclusion兴 were plated in each well of a six-well plate in complete RPMI medium and cultured for 24 h under a humidified atmosphere of 95% air and 5% CO2. The culture medium was replaced to remove all nonattached cells and fragments. Attached cells were cultured for an additional 18 h, so that they reached 50 – 60% confluence, suitable for transient transfection (see below).

Real-time RT-PCR RNA was extracted from freshly collected granulosa cells by the Trizol reagent (Invitrogen), following manufacturer’s instructions. An aliquot of 1 ␮g total RNA was reverse transcribed using random primers and SuperScript II reverse-transcriptase (both from Invitrogen) in a total volume of 20 ␮l. Aliquots (1 ␮l) of this RT reaction were used for each real-time PCR, using specific primers for each hyaluronidase and ␤-actin (see Table 1) and the Platinum SYBR Green qPCR supermix UDG (Invitrogen). All samples were subjected to real-time PCR in triplicates. Fluorescence was captured using the iCycler iQ real-time detection system (Bio-Rad Laboratories, Hercules, CA). Amplifications were carried out by 45 cycles of 95 C for 30 sec, 64 C for 30 sec, and 72 C for 45 sec, followed by a melting curve of 70 cycles of 0.5 C increase per cycle starting at 60 C. After each run, aliquots of the PCR product from one of the triplicates were subjected to agarose gel electrophoresis to verify the specificity of the reaction. PCR products were also cloned into the TA cloning vector pCRII (Invitrogen) and sequenced using M13 forward primer on an ABI PRISM 3100 genetic analyzer (Applied Biosystems, Foster City, CA). For comparison of transcript levels between samples, standard curves of serial dilutions of cDNA samples of each hyaluronidase were used to calculate the relative abundance of each gene. Values were then normalized to the relative amounts of ␤-actin cDNA, which were obtained from a similar standard curve. Experiments were repeated at least three times using granulosa cells isolated from different animals for each group.

Apoptosis analysis Granulosa cells either freshly collected or harvested from cell culture were fixed in 10% buffered formalin (ACP Chemicals, Montreal, Quebec, Canada) and stored at 4 C. On the analysis day, granulosa cells were centrifuged, and the pellet was stained with Hoechst 33258 (Sigma; 62.5 ng/␮l in 10% buffered formalin) and immediately applied onto slides for fluorescence DNA imaging, using a Leitz Diaplan fluorescence microscope (Leica Microsystems GmbH, Wetzlar, Germany). Apoptotic cells were identified by their typical nuclear morphology (see Fig. 1B). Around 1000 cells were counted in randomly selected areas. To avoid experimental bias, the counter was blind to the sample identity.

5838


Plasmid construction, site-directed mutagenesis, and granulosa cell transfection Full-length mouse Hyal-1 and Hyal-2 cDNAs were obtained by RT-PCR, using mouse kidney total RNA as template and the Moloney murine leukemia virus reverse transcriptase (Invitrogen). Mouse testis RNA was used as template for Hyal-3 cDNA. Based on sequences deposited at GenBank (GI no. 145966880 for Hyal-1, GI no. 45331201 for Hyal-2, and GI no. 30842787 for Hyal-3), primers were designed to amplify the entire coding region of the enzyme from initiating ATG until stop codon (see Table 1). PCR products were TA cloned in pCR II vector (Invitrogen) and were completely sequenced on an ABI PRISM 3100 genetic analyzer (Applied Biosystems). To produce hyaluronidases fused to enhanced green fluorescent protein (EGFP), new sets of primers were designed for amplification of the entire coding region of these enzymes without their stop codons but with appropriate sequences for restriction endonuclease sites, which were strategically used for cloning the hyaluronidase sequence into pEGFPN1 (Clontech Laboratories Inc., Mountain View, CA) with the EGFP sequence in the reading frame. Correct plasmid construction was analyzed by restriction endonuclease analysis and DNA sequencing. Site-directed mutagenesis was performed by standard procedures, using PCR amplification by Pfx polymerase (Invitrogen) and template digestion with DpnI. For the double mutant D157A/E159A of mouse Hyal-1, the aspartic acid (GAT) and the glutamic acid (GAG) codons were replaced by the alanine codons GCT and GCG (underlined), respectively, using sense and antisense primers of the following sequence: 5⬘-CTGGCAGTCATTGCTTGGGCGGCTTGGCGCCCAC-3⬘. Positive constructs, screened by differential restriction patterns, were resequenced to confirm nucleotide replacement. For transfection, granulosa cells cultured as described above were transiently transfected with 0.5 ␮g Hyal1-EGFP, Hyal1-mutant-EGFP, Hyal2-EGFP, or Hyal3-EGFP plasmids or empty pEGFPN1 vector in medium without supplements using the Lipofectamine and Plus reagents from Invitrogen (according to the manufacturer’s instruction). After 4 h transfection, the medium was replaced by complete RPMI medium, and cells were cultured for 24 h for protein expression. Transfection efficiency was analyzed by the presence of GFP fluorescence within the cells by fluorescence microscopy. At the end of the experiments, floating cells were collected from the medium by centrifugation and combined to attached cells harvested by trypsin-EDTA treatment (0.25% trypsin with 1 mm EDTA; Invitrogen). Cells were then washed in PBS and used for apoptosis analysis, immunoblotting, and hyaluronidase activity assays. Transfection experiments were repeated six to eight times for each plasmid.

Immunoblotting Granulosa cells harvested from cell culture were resuspended in saline containing 1 mm phenylmethylsulfonyl fluoride and a protease inhibitor cocktail (Complete-Mini from Roche). Cell suspensions were briefly sonicated, and their protein content was determined by the BioRad protein assay. Suspensions were stored at ⫺80 C. Samples (lysates of approximately 1 ⫻ 106 cells; ⬃50 ␮g protein) were subjected to 10% SDS-PAGE (35), under reducing conditions, and electrotransferred onto nitrocellulose membranes (36). Nonspecific binding to the membrane was blocked with 5% dehydrated skim milk in Tris-buffered saline 关20 mm Tris-HCl, 150 mm NaCl (pH 7.4)]. Membranes were then incubated with primary antibodies (4 C, overnight), washed in Tris-buffered saline containing 0.1% Tween, and incubated with horseradish peroxidaseconjugated secondary antibodies. The following primary IgG antibodies were used in our work: anti-EGFP (1:2000, mouse antibody; Chemicon International, Temecula, CA), anti-actin (pan Ab-5, 1:1500, mouse antibody; Lab Vision Corp., Fremont, CA), anti-WWOX (N-19, 1:200, goat antibody; Santa Cruz Biotechnology, Santa Cruz, CA), anti-p53 (DO-1, 1:1000, mouse antibody; Santa Cruz Biotechnology), anti-poly-ADPribose polymerase (anti-PARP, 1:300, rabbit antibody; Cell Signaling Technology), anti-caspase-9 (1:300, rabbit antibody; Cell Signaling Technology), anti-cleaved caspase-8 (1:300, rabbit antibody; Santa Cruz Biotechnology), and anti-cleaved caspase-3 (1:300, rabbit antibody; Cell Signaling Technology). These antibodies were tested in our conditions to be specific for their target proteins. Peroxidase-conjugated antimouse IgG (1:1000, goat antibody; Sigma), antirabbit IgG (1:3000, goat antibody; Bio-Rad), or antigoat IgG (1:4000, rabbit antibody; Sigma) were used as


secondary antibodies. Protein-antibody recognition was detected by Western Lightning Chemiluminescence Reagent Plus (PerkinElmer, Boston, MA), according to the manufacturer’s instructions. For Hyal-1 immunoblotting experiments, we followed a procedure recently described (37). Granulosa cells collected from 3- or 7-wk-old mice were resuspended in lysis buffer (10 mm imidazole, 0.25 m sucrose) and briefly sonicated, and their protein content was determined. Samples (containing 50 ␮g proteins) were used for immunoblotting as described above. Primary antibody was the monoclonal antibody ID10 (0.5 ␮g/ml), kindly donated to us by Dr. Barbara Triggs-Raine (University of Manitoba). This ID10 antibody has been shown previously to recognize mouse Hyal-1 but not Hyal-2 or Hyal-3 (3). Secondary antibody was the peroxidase-conjugated Trueblot ULTRA antimouse IgG (1:1000; eBioscience Inc., San Diego, CA).

Hyaluronidase activity assays Assays for hyaluronidase activity in an aqueous solution were performed by incubating (37 C, 24 h) extracts of transfected granulosa cells (made in saline containing protease inhibitors and having 10 ␮g proteins) with 20 ␮g HA (from human umbilical cord; Sigma) in a 50-␮l vol of a final concentration of 100 mm sodium formate, 150 mm NaCl (pH 3.7). An aliquot (25 ␮l) of the reaction solution was electrophoresed (150 V, 4 C) on a 12% native polyacrylamide gel (in 100 mm Tris-borate, 20 mm EDTA, pH 8.0), using 2 m sucrose for sample loading (38). The gel was then immediately stained in the dark for 1 h with 0.005% Stains-All (Sigma) made in 15 mm Tris-HCl (pH 8.8), 5% formamide, and 25% isopropanol and washed with water. HA bands were readily visualized, because the staining solution used did not react with the polyacrylamide gel. Gels were immediately scanned on an HP PSC 1510 scanner (Hewlett-Packard Canada Co., Mississauga, Ontario, Canada). This assay was repeated at least three times using cell extracts from different transfection experiments. Zymography was performed as previously described (39) but with some modifications. Briefly, extracts of transfected granulosa cells, made in the imidazole lysis buffer (see above), with total proteins of about 30 ␮g, were separated by native PAGE (20 mA, 4 C) on an 8% gel containing 0.20 mg/ml human umbilical cord HA. The gel was then briefly equilibrated in the assay buffer 关100 mm sodium formate, 150 mm NaCl (pH 3.7)兴 and subsequently incubated overnight in the same buffer at 37 C. After incubation, gels were treated with 0.01 mg/ml Pronase (SigmaAldrich) in a 20 mm Tris buffer (pH 8.0) for 4 h, rinsed with distilled water, and stained sequentially with 0.5% Alcian blue and 0.1% Coomassie blue R, both in 30% methanol-7% acetic acid. Gels were destained until clearing bands of digested HA were evident and scanned on the HP scanner. Gel zymography was repeated three times using cell extracts from different transfection experiments.

Statistical analyses Data were mostly analyzed using two-tailed Student’s t test (simple pairwise comparisons). However, data from transfection experiments (see Fig. 6) were analyzed by one-way ANOVA followed by the HolmSidak post hoc test (multiple comparisons vs. control group). Differences were considered statistically significant when P ⬍ 0.05. Analyses were performed using SigmaStat (version 3.1; Systat, San Jose, CA).

Results Anti-eCG antibody treatment induces ovarian follicular atresia and granulosa cell apoptosis in the mouse

To investigate the regulation of mouse hyaluronidases in granulosa cells upon apoptosis induction, we established a mouse model for ovarian follicular atresia stimulation based on the previously described rat model of gonadotropin withdrawal (28). Our results demonstrated that this approach can also be applied to the mouse. Granulosa cells collected 12 and 24 h after anti-eCG treatment of eCG-primed mice had significantly higher number of apoptotic nuclei, containing condensed and fragmented chromatin (see arrows on right panel


of Fig. 1B), than normal rabbit serum-treated animals (P ⬍ 0.005, Fig. 1A). Morphologically, treatment of immature female mice with eCG resulted, as expected, in follicle maturation with the majority of antral follicles (⬎200 ␮m diameter) being healthy (Fig. 1C-a) and only 10% being atretic (Fig. 1D). In contrast, injection of anti-eCG antibody into eCGprimed female mice induced atresia (Fig. 1C-b; see an example of the presence of pyknotic nuclei in the high-magnification picture) in almost all antral follicles (Fig. 1D). Small antral follicles (⬍200 ␮m diameter) were not affected by the anti-eCG treatment (Fig. 1D), and follicles without an antral cavity were not included in the analysis.


5839

Atretic follicles and apoptotic granulosa cells have increased expression levels of somatic hyaluronidases

Having established a model to study atresia in the mouse, mRNA abundance of Hyal-1, Hyal-2, and Hyal-3 in the ovary was analyzed by real-time RT-PCR and in situ hybridization. As shown in Fig. 2, granulosa cells collected from eCGprimed mice injected with anti-eCG antibody for 24 h had significantly higher mRNA levels for Hyal-2 (P ⬍ 0.05) and Hyal-3 (P ⬍ 0.01) than those injected with normal rabbit serum (controls). In contrast, Hyal-1 mRNA expression in the anti-eCG-treated animals was the same as that in the control

FIG. 1. Mouse model for the induction of ovarian follicular atresia. A, Apoptosis levels of granulosa cells of control 关white bars, eCG (24 h) plus 1:100 normal rabbit serum兴 and anti-eCG-treated 关gray bars, eCG (24 h) plus 1:100 rabbit anti-eCG serum兴 mice. Granulosa cells were collected at 6, 12, and 24 h after the anti-eCG injection time. Bars represent percentages of apoptotic nuclei counted in each group and are expressed as mean ⫾ SEM (n ⫽ 6 – 8 animals per group). Asterisks denote significant differences between control and anti-eCG-treated mice (P ⬍ 0.005). B, Representative images of Hoechst staining of granulosa cells collected from control and anti-eCG-treated (24 h) mice. Arrows indicate apoptotic nuclei in the anti-eCG-treated group, the chromatin of which appeared condensed and fragmented. C, Histological sections of ovaries stained with hematoxylin/eosin collected from control (a) and anti-eCG-treated (b) mice at 24 h after serum/antiserum injection. Image on the right in each panel represents high magnification of the boxed area in the corresponding ovarian section (left). Bar, 50 ␮m. Arrow indicates pyknotic nuclei and detached granulosa cells from one example of atretic antral follicle. D, Distribution of healthy and atretic antral follicles in the ovary sections from control (white bars) and anti-eCG-treated (gray bars) mice 24 h after serum injection. Bars represent the ratio of the number of each antral follicle type counted (i.e. early antral and antral follicles, healthy or atretic) over the total number of antral follicles counted expressed as mean ⫾ SEM (n ⫽ 5– 6 ovaries from different animals per group). Asterisks denote significant differences between control and anti-eCG-treated groups (P ⬍ 0.001).

5840



FIG. 2. Expression levels of somatic hyaluronidases in ovarian granulosa cells. Expression levels of Hyal-1, Hyal-2, and Hyal-3 in granulosa cells of control (white bar) and anti-eCG-treated (gray bar) mice (see Fig. 1 legend for details) were analyzed by real-time RTPCR using primers shown in Table 1. Values were normalized to the ␤-actin housekeeping gene and expressed as mean ⫾ SEM (n ⫽ 3– 4 animals per group). Asterisks denote significant differences between control and anti-eCGtreated groups (P ⬍ 0.05 for Hyal-1 and Hyal-2; P ⬍ 0.01 for Hyal-3).

mice at this time point. However, the increased level of this mRNA in the anti-eCG-treated mice was in fact observed 6 h after the anti-eCG treatment (P ⬍ 0.05; Fig. 2, left panel). Differential mRNA expression for these enzymes was also observed in situ in the ovary sections of eCG-primed mice with and without subsequent anti-eCG treatment. DIG-labeled RNA probes of around 300 bp, recognizing mRNA regions of exons 3 and 4 of the different hyaluronidases (see Table 1), were used for in situ hybridization. The 24-h time point after anti-eCG treatment was used for Hyal-2 and Hyal-3 in situ analyses, but for Hyal-1, we decided to use the 12-h interval to compromise between elevated levels of apoptotic granulosa cells (Fig. 1A) and Hyal-1 mRNA expression (Fig. 2). Positive staining of Hyal-1, Hyal-2, and Hyal-3, revealed by the dark blue/purple color of the alkaline phosphatase substrate, was detected specifically in granulosa cells (Fig. 3, A–C). In eCG-treated mice, positive staining of these enzymes was observed in small but not large antral follicles (Fig. 3, A-a, B-a, and C-a). Upon atresia induction by antieCG treatment (12 or 24 h), positive staining in granulosa cells increased and was also observed in large antral follicles (Fig. 3, A-b, B-b, and C-b). This pattern of staining was coincidental with the increased number of atretic antral follicles in anti-eCG-treated mice (Fig. 1D). Variation in the staining pattern of same size follicles was probably related to the differences in the signaling events of the follicular cells. It was interesting to notice that even though similar levels of Hyal-1 mRNA in granulosa cells were detected in eCG-primed-only mice and in eCG-primed/anti-eCGtreated mice (12 h, Fig. 2), distinct in situ localization patterns for this enzyme were observed in these two sets of mice (Fig. 3A). Hyaluronidase expression correlates with atretic follicles and apoptotic granulosa cells in normally cycling mice

To verify whether our findings would apply to physiological conditions, we analyzed the hyaluronidase expression in normal ovaries of immature (3wk old) and mature (7 wk old) mice. Under normal physiological conditions, atresia

predominantly occurs in small antral follicles that are beginning the process of granulosa cell differentiation (40 – 42). Gonadotropins are also known to suppress apoptosis in the ovary (40, 43, 44). Therefore, atretic small antral follicles should be more abundant in ovaries of immature female mice than in those of mature animals. Indeed, our results show that granulosa cells collected from 3-wk-old mice had significantly higher degrees of apoptosis than those collected from 7-wk-old mice (Fig. 4A). Using this physiological situation, we examined the Hyal-1 mRNA expression in situ and its protein level in granulosa cell lysates. Expression of cleaved caspase-3 protein (an apoptosis effector) was also investigated simultaneously. Our results demonstrated that both Hyal-1 and cleaved caspase-3 protein levels in granulosa cells were increased in 3-wk-old mice, compared with those in 7-wk-old animals (Fig. 4B). These increases corresponded with the higher degree of the granulosa cell apoptosis in the 3-wk-old animals (Fig. 4A). The two Hyal-1 protein bands observed (50 and 55 kDa) were presumably from a different glycosylation level of this enzyme (17). The in situ hybridization results supported those of the protein expression; the level of Hyal-1 mRNA (localized predominantly in small antral follicles) was higher in the younger mice (Fig. 4, C and D). In parallel, cleaved caspase-3 protein detection by immunocytochemistry (specific black/ dark brown color in isolated granulosa cells; arrows in the high-resolution panel in the far right, Fig. 4, C and D) was also higher in the 3-wk-old mice. Unfortunately, parallel immunocytochemical staining of Hyal-1 could not be performed, because the antibody against this enzyme cannot function in this procedure (B. Triggs-Raine, personal communication). In conclusion, in both our eCG/anti-eCG antibodytreated animal model and normally cycling mice, hyaluronidase expression was closely associated with follicle atresia and granulosa cell apoptosis. Our next step was to investigate whether these enzymes could induce granulosa cell apoptosis.



5841

FIG. 3. In situ hybridization localization of Hyal-1, Hyal-2, and Hyal-3 transcripts in the mouse ovary. Frozen sections of ovaries collected 12 h (A) or 24 h (B and C) after serum injection from control (a) and anti-eCG-treated (b) mice were hybridized with Hyal-1 (A), Hyal-2 (B), or Hyal-3 (C) antisense RNA probes. Note that positive staining, visualized as a dark blue/purple-blue color, was mainly localized to granulosa cells. Note the increase in staining intensity on sections from the anti-eCG-treated mice. Insets on each panel represent higher-magnification pictures of the corresponding boxed area in the ovarian sections. Bar, 100 ␮m. Note positive staining in small but not large antral follicles of eCG-treated mice (insets on a) and in both follicle types of anti-eCG-treated animals (insets on b). Background level staining is shown in D for ovarian sections of anti-eCG-treated mice hybridized with sense RNA probes for Hyal-1, Hyal-2, and Hyal-3. Images are representative of experiments performed at least three times using ovaries collected from different animals.

Ectopic expression of somatic hyaluronidases induces apoptosis in mouse granulosa cells in vitro

To further demonstrate that hyaluronidases were capable of inducing apoptosis in granulosa cells, we transfected primary granulosa cells with EGFP-fused Hyal plasmids. Green fluorescence was detected in about 20 –25% of the transfected cells for all the constructs, but intensity of the signal was stronger in the case of Hyal-1 and Hyal-3 than that of Hyal-2 (data not shown). These results were confirmed by immunoblotting of the protein bands using anti-EGFP antibody. Figure 5A shows that Hyal-1 and Hyal-3 could effectively be expressed in granulosa cells, although the expression of Hyal-3 was at a lower degree. In contrast, the level of Hyal-2 expression was much lower than the other two enzymes (Fig. 5A). It is possible that a

longer culture period would be necessary to obtain a better in vitro expression of Hyal-2 in our experimental conditions. Nevertheless, the expected molecular masses for the predicted fused proteins (75 kDa for Hyal-1 and Hyal-2; 70 kDa for Hyal-3) were consistently obtained. Enzymatic activity was additionally monitored to ensure the proper folding of the proteins. Because Hyal-1 is a highly active hyaluronidase at acidic pH (11, 45) and Hyal-3 has been reported to be devoid of enzymatic activity (16, 17), proper protein folding was monitored using enzyme assays previously reported for Hyal-1 activity (17, 37). First, using HA zymography, a clear band of digested HA can be visualized in the lane where cell lysates of Hyal-1/EGFP transfectants were loaded (Fig. 5B). The difference in the migration pattern between the positive

5842



FIG. 4. Expression pattern of Hyal-1 and cleaved caspase-3 in ovaries of normal 3- and 7-wk-old mice. A, Granulosa cells were collected by follicle puncture from ovaries of 3-wk-old (gray bar) or 7-wk-old (striped bar) mice, and apoptosis was measured by Hoechst nuclear staining as shown in Fig. 1B. Bars represent percentage of apoptotic nuclei counted in each group and are expressed as mean ⫾ SEM (n ⫽ 6 –7 animals per group). An asterisk denotes a significant difference between 3- and 7-wk-old animals (P ⬍ 0.001). B, Isolated granulosa cell lysates obtained from 3or 7-wk old mice were subjected to SDS-PAGE and immunoblotting using anti-Hyal-1, anti-cleaved caspase-3, and anti-␤-actin antibodies. Mouse liver lysates were used as a positive control for Hyal-1 detection. Molecular masses of the expected protein bands are shown on the left side. Images are representative of experiments performed at least three times using granulosa cell lysates of different animals. Note the higher intensity of the Hyal-1 and cleaved caspase-3 protein bands in extracts from 3- vs. 7-wk-old mice, as opposed to similar intensity for the ␤-actin housekeeping protein. C and D, Frozen ovaries, collected from 3-wk-old (C) and 7-wk-old (D) mice, were serially sectioned and used for Hyal-1 in situ hybridization (upper panels) or cleaved caspase-3 immunohistochemistry (lower panels). Higher-magnification pictures of the corresponding boxed area (left) in the ovarian sections are shown in the right panels. Arrows indicate the black/dark brown cellular staining of cleaved caspase-3 in an atretic follicle. Images are representative of paired stained sections from experiments performed on three different sets of animals.

control (Hyal-1 from mouse liver lysate) and Hyal-1-transfected granulosa cells was due to the fusion of the latter to the EGFP protein. In contrast, Hyal-3/EGFP transfectants contained no activity under our incubation conditions (pH 3.7) (Fig. 5B). The enzyme activity of granulosa cell Hyal-1/EGFP transfectants was also shown in the aqueous solution assay; HA with a molecular mass range of 50 –250 kDa was digested

to glycosaminoglycans of much smaller sizes (ranging from 10 –30 kDa) (Fig. 5C). Note that the appearance of these glycosaminoglycans of smaller sizes was concurrent with a decreased level of undigested HA of higher molecular masses. In contrast, control cell lysate from pEFGPN1 transfectants (labeled EGFP in Fig. 5C) could not digest the HA glycosaminoglycans.



5843

Apoptosis was then evaluated on harvested transfected cells by Hoechst nuclear staining. Figure 6 shows that all three expressed hyaluronidases significantly increased granulosa cell apoptosis (P ⬍ 0.001 for Hyal-1/EGFP and Hyal3/EGFP and P ⬍ 0.05 for Hyal-2/EGFP). The level of apoptosis induction was higher for Hyal-1 and Hyal-3 than for Hyal-2 (Fig. 6), with various extents proportional to the expression level of these enzymes revealed by immunoblotting (Fig. 5A). This finding indicated a correlation between the level of hyaluronidase expression and the process of apoptosis and corroborated our in vivo observations on the association of the hyaluronidase expression with apoptotic granulosa cells and atretic follicles (Figs. 2– 4). Induction of granulosa cell apoptosis by hyaluronidase is not dependent on enzymatic activity toward hyaluronan

The HA polysaccharide has been reported for its antiapoptotic properties. In contrast, some small HA fragments are proapoptotic compounds (for review see Refs. 12 and 46). To determine whether induction of granulosa cell apoptosis by hyaluronidase was dependent on its activity toward HA, we generated a catalytic inactive mutant of hyaluronidase. We used Hyal-1 for these studies because of its known strong catalytic activity toward HA (1, 11, 12, 45). Crystallography and modeling studies have shown that a pair of acidic amino acids (Asp and Glu) are the main catalytic residues for mammalian hyaluronidases (2, 15, 47, 48). Using site-directed mutagenesis, Asp157 and Glu159 of Hyal-1 (nomenclature according to the deduced amino acid composition obtained from the mouse Hyal-1 cDNA sequence, GI no. 145966880) were substituted with alanine. Our immunoblotting results showed that this Hyal-1 mutant was effectively expressed in transfected granulosa cells, with an expression level often higher than the wild-type enzyme (Fig. 5A). Figure 5, B and

FIG. 5. Expression and enzyme activity of hyaluronidases in transfected granulosa cells. Transient transfection of Hyal-1, Hyal-2, or Hyal-3 cDNA fused to EGFP as well as of the Hyal-1 cDNA mutant (Asp157Ala/Glu159Ala) was performed in primary granulosa cell culture as described in Materials and Methods. Control cells were transfected with plasmid expressing EGFP (pEGFPN1). A, Transfected granulosa cell lysates were subjected to SDS-PAGE and immunoblotting using the anti-EGFP antibody. Molecular masses of the EGFP protein bands are shown on the right side. Anti-␤-actin antibody was used as gel loading control. B, HA zymography. Cell lysates of granulosa cell transfectants were subjected to native PAGE containing HA. After gel incubation in the assay buffer and HA staining in the Alcian/Coomassie blue, clearing bands of digested HA can be visualized on lysates of Hyal-1/EGFP transfectants and the positive control (mouse liver) but not on Hyal-3/EGFP, Hyal-1 mutant, or EGFP (negative control) transfectants. C, Aqueous activity assay. Cell lysates of transfected granulosa cells were incubated with the substrate, HA, and the reaction mixture was then subjected to PAGE followed by incubation with Stains-All solution. MWM, Molecular weight marker. Note the decrease in intensity of HA high-molecularmass broad band (nondigested HA) and the concurrent appearance of a smear of small-molecular-mass products (digested HA) in the reaction containing Hyal-1-transfected cell lysates but not in the one of Hyal-1 mutant or controls.

FIG. 6. Induction of ovarian granulosa cell apoptosis by somatic hyaluronidases Hyal-1, Hyal-2, Hyal-3, and enzymatically inactive Hyal-1 mutant. Granulosa cells transfected with Hyal-1, Hyal-2, or Hyal-3 cDNA fused to EGFP (light gray bars) as well as with Hyal-1 mutant cDNA (dark gray bar) or control plasmid pEGFP-N1 (white bar) were harvested after 24 h for Hoechst nuclear morphology analysis. Healthy and apoptotic cells were counted randomly, and apoptotic cells were plotted as percentages of total cells counted. Bars represent mean ⫾ SEM of six to eight different transfection experiments. Asterisks denote significant differences between control and hyaluronidase-expressing cells: *, P ⬍ 0.05; **, P ⬍ 0.001.

5844


C, demonstrates that this double mutant was completely devoid of enzymatic activity toward HA when compared with wild-type mouse Hyal-1. Significantly, this enzymatically inactive Hyal-1 mutant was able to induce granulosa cell apoptosis, at degrees higher than the wild-type enzyme (Fig. 6), which can be correlated to its higher expression level in granulosa cells (Fig. 5A). These results and those showing apoptosis induction by Hyal-3 (Fig. 6), which contained no enzymatic activity (Fig. 5A) (16, 17), strongly suggested that the hyaluronan processing (or the hyaluronidase enzymatic activity) was not relevant to cell apoptosis. Nonetheless, the close association between the hyaluronidase expression and cell apoptosis remained. Induction of granulosa cell apoptosis by hyaluronidase is associated with caspase-8 and caspase-3 activation and PARP cleavage

To discern the molecular mechanisms by which hyaluronidases induce apoptosis, the activation of proteins in specific signaling pathways was analyzed by immunoblotting in transfected granulosa cells (Fig. 7). These mechanisms were investigated after expression of wild-type and enzymatically inactive mutant Hyal-1 and wild-type Hyal-3 in granulosa cells. Hyal-2 transfectants were not used for the study due to the low enzyme expression level. It has been reported that mammalian hyaluronidases induce apoptosis through p53

FIG. 7. Activation of the extrinsic apoptotic signaling pathway by hyaluronidases. Cell lysates from transfected granulosa cells were subjected to SDS-PAGE and immunoblotting using specific antibodies against the proteins shown on the left. Molecular masses of the expected protein bands are also shown on the left. Arrows indicate protein bands having higher chemoluminescent intensities for hyaluronidase-transfected cell lysates when compared with controls, i.e. cleaved PARP, caspase-8, and caspase-3. Images are representative of experiments performed at least three times for each plasmid used.


and WOX1 activation in prostate and lung cancer cell types (19, 21, 49). However, our immunoblotting results revealed no increase in p53 or WOX1 expression levels after ectopic expression of hyaluronidases in ovarian granulosa cells (Fig. 7). Increases in the cleavage of caspase-9 were also not observed, indicating that the intrinsic apoptotic pathway was not involved. In contrast, the extrinsic apoptotic pathway seemed to be activated by hyaluronidases in granulosa cells, because the levels of the cleaved products of caspase-8, caspase-3, and PARP were evidently higher in cells transfected by Hyal-1, Hyal-3, and Hyal-1 inactive mutant, when compared with those in control EGFP-transfected granulosa cells (Fig. 7). These results further confirmed that Hoechst nuclear staining observed in transfected granulosa cells (Fig. 6) were signals of cell apoptosis and demonstrated that the extrinsic apoptotic signaling pathway was activated by hyaluronidases in cultured granulosa cells independently of enzyme activity. Discussion

The presence of hyaluronidases in the human and mouse ovary has been previously described (4, 8). However, to date, there is no information on the precise cellular localization and the roles of these enzymes in the ovary. In the present work, we showed for the first time that somatic hyaluronidases were specifically expressed in granulosa cells and were closely associated with the induction of granulosa cell apoptosis. This is the first evidence showing that hyaluronidases, in particular those encoded by genes clustered in human chromosome 3p21.3 and mouse 9F1-F2 (Hyal-1, Hyal-2, and Hyal-3), have a role in female reproduction, more specifically in follicular atresia. To our knowledge, physiological roles of hyaluronidases in reproduction have been described only for PH-20, Hyal-5, and Hyalp1 (encoded by genes clustered in human chromosome 7q31.3 and mouse 6A) (4, 6 –10, 13, 14); they exist on the sperm surface and play a significant role in sperm-fertilizing ability by dispersing the cumulus layers of the ovulated cumulus-oocyte complex. This allows sperm to reach the egg zona pellucida. Our results add hyaluronidases as new players in ovarian folliculogenesis. In the present work, we have also established a mouse model for ovarian follicular atresia induction and showed that the mRNA expression of somatic hyaluronidases is increased during atresia. Our mouse model for atresia induction was adapted from the rat model, in which the actions of eCG were blocked by the administration of an anti-eCG antibody (28). Our results in the mouse system are consistent with those in the rat, in which increased levels of granulosa cell apoptosis and atretic antral follicles were observed upon gonadotropin withdrawal (28). In our model, antral follicles were uniformly affected by anti-eCG treatment, in contrast to small antral follicles that were not affected (Fig. 1D). These results could be explained by the fact that the small antral follicles assessed in this study (⬍200 ␮m, antral cavity not well defined) had not yet been responsive to FSH, and they were rather under the influence of the TGF␤ superfamily intraovarian regulators (50, 51). Therefore, these follicles would be less responsive to the anti-eCG effects. The fact that granulosa cell apoptosis occurs after anti-eCG treatment (Fig.


1A) further confirms that our mouse model is an appropriate system to be used for studying events related to follicular atresia at the cellular level. Using this model, we demonstrated that hyaluronidases were regulated by gonadotropin and may have impact on the destiny of the antral follicle (growth vs. atresia). Expression levels of these enzymes increased in granulosa cells after induction of atresia (Fig. 2). In situ hybridization experiments revealed that they were mainly expressed in granulosa cells (Fig. 3). In contrast, they were not present in theca or stroma cells. The present work is the first one to show the specific cellular localization of hyaluronidases in the ovary. In eCGprimed mice, although expression of Hyal-1, Hyal-2, and Hyal-3 was observed in small antral follicles, these expression levels were considerably lower than those in follicles of eCG- plus anti-eCG-treated mice. In addition, large antral follicles of the anti-eCG-treated mice showed the hyaluronidase expression (Fig. 3). Taken together, these results indicated that hyaluronidase expression was closely related to increased granulosa cell apoptosis and ovarian follicular atresia. Our findings were physiologically relevant because higher levels of hyaluronidase expression was observed where apoptotic granulosa cells and atretic follicles were most prevalent, i.e. in ovaries of 3-wk-old prepubertal mice, as compared with ovaries of sexually mature 7-wk-old (Fig. 4, A and B). Furthermore, we demonstrated the correlation of Hyal-1 expression with that of cleaved caspase-3, the ultimate apoptosis effector. Interestingly, in normally cycling female mice, hyaluronidase expression was still specifically localized to granulosa cells and preferentially to small antral follicles and was not present in the corpus luteum (Fig. 4, C and D). We suggest that somatic hyaluronidases are involved in follicular atresia in the early phases of folliculogenesis and that expression of these enzymes is repressed in gonadotropin-responsive follicles. It is also possible that these enzymes may be directly involved in follicular atresia by inducing granulosa cell apoptosis. Induction of apoptosis by hyaluronidases has been previously described for certain cancer cell types, especially in prostate and lung cancer cell lines, as well as murine fibrosarcoma (18 –21, 49). In these reports, cells were either treated with exogenous hyaluronidase (PH-20) (18, 19, 49) or subjected to overexpression of Hyal-1 or Hyal-2 (20, 21). Increased levels of apoptosis were consistently observed, and the signaling pathway activated appears to involve increased levels of expression and phosphorylation of a proapoptotic protein called WOX1 (19, 21). This protein is known to activate p53 translocation to the nucleus for the induction of cell death (22, 23). In the present work, we showed that ectopic expression of all three different somatic hyaluronidases (Hyal-1, Hyal-2, and Hyal-3) induced granulosa cell apoptosis (Fig. 6). To our knowledge, this is the first demonstration of apoptosis induction by Hyal-3 and the first indication that this phenomenon is not limited to cancer cells. The extent of apoptosis induction was proportional to the expression level of these enzymes (Figs. 5A and 6), corroborating our in vivo observations of increased hyaluronidase expression in follicles induced to undergo atresia after gonadotropin withdrawal as well as in atretic follicles of normally cycling mice


5845

(Figs. 2– 4). However, we did not observe WOX1 or p53 up-regulation by hyaluronidases in transfected granulosa cells but noted an activation of the extrinsic apoptotic pathway (Fig. 7). Nonetheless, the possibility that phosphorylation or intracellular translocation of p53 and WOX1 might have occurred in our conditions still needs to be investigated. Significantly, the cleavage of caspase-8, caspase-3, and PARP (the substrate of caspase-3) were more pronounced in granulosa cells transfected with Hyal-1-EGFP or Hyal-3-EGFP than in the control cells (transfected with EGFP) (Fig. 7). These findings indicate that different apoptotic signaling pathways might be activated by hyaluronidases in normal cells as opposed to cancer cells, the latter involving the p53 pathway. It is well documented that cancer cells have altered balance in survival vs. death signaling pathways, especially the p53 pathway (52–54). This characteristic might explain the difference in the apoptotic pathway activated by hyaluronidases in normal vs. cancerous cells. Previous reports indicate that the kinetics and specific activities of various mammalian hyaluronidases are different, despite the fact that all of them have conserved active site residues (2, 15, 48). Hyal-1 is a very potent acidic enzyme that degrades hyaluronan into tetrasaccharides (1, 11, 12, 45), whereas Hyal-2 hydrolyzes hyaluronan up to 20-kDa fragments and has a broader range of pH activity (1, 11, 12, 55), and Hyal-3 has recently been reported to be devoid of hyaluronan activity (16, 17). These observations together with our results showing that all three enzymes were capable of inducing cell apoptosis corroborate our suggestion that enzymatic activity of hyaluronidases might not be relevant to the apoptosis induction. Indeed, our results showed that the enzymatically inactive mutant of Hyal-1, produced by sitedirected mutagenesis of the two acidic residues (Asp157 and Glu159) involved in HA hydrolysis (47, 48), could still induce the same level of apoptosis as the wild-type enzyme in the granulosa cell culture (Fig. 6). The mutation of these two amino acids should not affect the three-dimensional structure of Hyal-1, based on the previous results described for PH-20 and Hyal-2 (56, 57). Our results also suggested that the presence of small hyaluronan glycans might not be important for apoptosis induction. Furthermore, our studies implicated that the signaling pathway activated by Hyal-1 inactive mutant was the same as wild-type Hyal-1 or Hyal-3, i.e. the extrinsic apoptotic pathway through activation of caspase-8 and caspase-3 (Fig. 7). These results are consistent with the notion that the extrinsic apoptotic pathway is also activated by an enzymatically inactive splice variant of human Hyal-1 (Hyal-1 v1, lacking 30 amino acids corresponding to exon 2) in bladder cancer cell lines (58). In this study, the authors have demonstrated a direct interaction of splice variant Hyal-1 with the wild-type enzyme and suggested that this binding would activate the extrinsic pathway. In the present work, we showed that Hyal-1 and Hyal-3 and the inactive Hyal-1 mutant were able to activate the extrinsic apoptotic pathway in ovarian granulosa cells. It is possible that direct binding of hyaluronidases to specific protein partners would trigger the apoptotic signaling pathway. Interestingly, the crystal structure of Hyal-1 reveals the presence of a distinct C-terminal EGF-like domain, which is also present in Hyal-3 (48). EGF-like domains are known to

5846


be involved in protein-protein interactions (for review see Ref. 59), and have been shown to play a role in both cell growth (60 – 62) and apoptosis (63– 65). It is possible that the EGF-like C-terminal domain of hyaluronidase might participate in the induction of granulosa cell apoptosis and studies are ongoing in our laboratory to determine this possibility. Acknowledgments We thank Dr. Mike Wade (Environmental Health Sciences Division, Health Canada, Ottawa) for greatly helping us with the statistical analyses and Mr. Christian Charbonneau (Immunology and Oncology Research Institute, University of Montreal) for technical assistance on imaging of tissue sections using the Axio-Imager Z1 Zeiss microscope. Received February 6, 2008. Accepted July 16, 2008. Address all correspondence and requests for reprints to: Euridice Carmona, Hoˆpital Maisonneuve-Rosemont, Centre de Recherche, 5415, boulevard de l’Assomption, Montreal, Quebec, Canada H1T 2M4. E-mail: [email protected]. This work was supported by the Natural Sciences and Engineering Research Council (Grant 262142-04) and the Maisonneuve-Rosemont Hospital Foundation (start-up funds) to E.C. and Canadian Institutes of Health Research (Grant MOP10369 to B.K.T. and Grant MOP84420 to N.T.). Disclosure Statement: The authors have nothing to disclose.

References 1. Csoka AB, Frost GI, Stern R 2001 The six hyaluronidase-like genes in the human and mouse genomes. Matrix Biol 20:499 –508 2. Stern R, Jedrzejas MJ 2006 Hyaluronidases: their genomics, structures, and mechanisms of action. Chem Rev 106:818 – 839 3. Shuttleworth TL, Wilson MD, Wicklow BA, Wilkins JA, Triggs-Raine B 2002 Characterization of the murine hyaluronidase gene region reveals complex organization and cotranscription of Hyal1 with downstream genes, Fus2 and Hyal3. J Biol Chem 277:23008 –23018 4. Kim E, Baba D, Kimura M, Yamashita M, Kashiwabara S, Baba T 2005 Identification of a hyaluronidase, Hyal5, involved in penetration of mouse sperm through cumulus mass. Proc Natl Acad Sci USA 102:18028 –18033 5. Zhang H, Shertok S, Miller K, Taylor L, Martin-DeLeon PA 2005 Sperm dysfunction in the Rb(6.16)- and Rb(6.15)-bearing mice revisited: involvement of Hyalp1 and Hyal5. Mol Reprod Dev 72:404 – 410 6. Martin-DeLeon PA 2006 Epididymal SPAM1 and its impact on sperm function. Mol Cell Endocrinol 250:114 –121 7. Miller KA, Shao M, Martin-DeLeon PA 2007 Hyalp1 in murine sperm function: evidence for unique and overlapping functions with other reproductive hyaluronidases. J Androl 28:67–76 8. Csoka AB, Scherer SW, Stern R 1999 Expression analysis of six paralogous human hyaluronidase genes clustered on chromosomes 3p21 and 7q31. Genomics 60:356 –361 9. Lin Y, Kimmel LH, Myles DG, Primakoff P 1993 Molecular cloning of the human and monkey sperm surface protein PH-20. Proc Natl Acad Sci USA 90:10071–10075 10. Zhang H, Morales CR, Badran H, El-Alfy M, Martin-DeLeon PA 2004 Spam1 (PH-20) expression in the extratesticular duct and accessory organs of the mouse: a possible role in sperm fluid reabsorption. Biol Reprod 71:1101–1107 11. Stern R 2003 Devising a pathway for hyaluronan catabolism: are we there yet? Glycobiology 13:105R–115R 12. Stern R, Asari AA, Sugahara KN 2006 Hyaluronan fragments: an informationrich system. Eur J Cell Biol 85:699 –715 13. Hunnicutt GR, Primakoff P, Myles DG 1996 Sperm surface protein PH-20 is bifunctional: one activity is a hyaluronidase and a second, distinct activity is required in secondary sperm-zona binding. Biol Reprod 55:80 – 86 14. Cherr GN, Yudin AI, Overstreet JW 2001 The dual functions of GPI-anchored PH-20: hyaluronidase and intracellular signaling. Matrix Biol 20:515–525 15. Jedrzejas MJ, Stern R 2005 Structures of vertebrate hyaluronidases and their unique enzymatic mechanism of hydrolysis. Proteins 61:227–238 16. Harada H, Takahashi M 2007 CD44-dependent intracellular and extracellular catabolism of hyaluronic acid by hyaluronidase-1 and -2. J Biol Chem 282: 5597–5607 17. Hemming R, Martin DC, Slominski E, Nagy JI, Halayko AJ, Pind S, TriggsRaine B 2008 Mouse Hyal3 encodes a 45–56 kDa glycoprotein whose overexpression increases hyaluronidase 1 activity in cultured cells. Glycobiology 18:280 –289 18. Chang NS 1997 Hyaluronidase enhancement of TNF-mediated cell death is reversed by TGF-␤1. Am J Physiol 273:C1987–C1994


19. Chang NS, Pratt N, Heath J, Schultz L, Sleve D, Carey GB, Zevotek N 2001 Hyaluronidase induction of a WW domain-containing oxidoreductase that enhances tumor necrosis factor cytotoxicity. J Biol Chem 276:3361–3370 20. Chang NS 2002 Transforming growth factor-␤1 blocks the enhancement of tumor necrosis factor cytotoxicity by hyaluronidase Hyal-2 in L929 fibroblasts. BMC Cell Biol 3:8 21. Lokeshwar VB, Cerwinka WH, Isoyama T, Lokeshwar BL 2005 HYAL1 hyaluronidase in prostate cancer: a tumor promoter and suppressor. Cancer Res 65:7782–7789 22. Chang NS, Doherty J, Ensign A, Lewis J, Heath J, Schultz L, Chen ST, Oppermann U 2003 Molecular mechanisms underlying WOX1 activation during apoptotic and stress responses. Biochem Pharmacol 66:1347–1354 23. Chang NS, Doherty J, Ensign A, Schultz L, Hsu LJ, Hong Q 2005 WOX1 is essential for tumor necrosis factor-, UV light-, staurosporine-, andp53-mediated cell death, and its tyrosine 33-phosphorylated form binds and stabilizes serine 46-phosphorylated p53. J Biol Chem 280:43100 – 43108 24. Tilly JL, Ratts VS 1996 Biological and clinical importance of ovarian cell death. Contemp Obstet Gynecol 41:59 – 86 25. Tsafriri A, Braw RH 1984 The regulation of ovarian follicle growth, demise and the ovulatory response. Oxf Rev Reprod Biol 6:226 –265 26. Jiang JY, Cheung CK, Wang Y, Tsang BK 2003 Regulation of cell death and cell survival gene expression during ovarian follicular development and atresia. Front Biosci 8:D222–D237 27. Hussein MR 2005 Apoptosis in the ovary: molecular mechanisms. Hum Reprod Update 11:162–177 28. Boone DL, Carnegie JA, Rippstein PU, Tsang BK 1997 Induction of apoptosis in equine chorionic gonadotropin (eCG)-primed rat ovaries by anti-eCG antibody. Biol Reprod 57:420 – 427 29. Kim JM, Boone DL, Auyeung A, Tsang BK 1998 Granulosa cell apoptosis induced at the penultimate stage of follicular development is associated with increased levels of Fas and Fas ligand in the rat ovary. Biol Reprod 58:1170 – 1176 30. Griffin J, Emery BR, Huang I, Peterson CM, Carrell DT 2006 Comparative analysis of follicle morphology and oocyte diameter in four mammalian species (mouse, hamster, pig, and human) J Exp Clin Assist Reprod 3:2 31. Pedersen T, Peters H 1968 Proposal for the classification of oocytes and follicles in the mouse ovary. J Reprod Fertil 17:555–557 32. Peters H 1969 The development of the mouse ovary from birth to maturity. Acta Endocrinol 62:98 –116 33. Erickson GF, Kokka S, Rivier C 1995 Activin causes premature superovulation. Endocrinology 136:4804 – 4813 34. Kim JM, Yoon YD, Tsang BK 1999 Involvement of the Fas/Fas ligand system in p53-mediated granulosa cell apoptosis during follicular development and atresia. Endocrinology 140:2307–2317 35. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680 – 685 36. Towbin H, Gordon JJ 1984 Immunoblotting and dot immunobinding: current status and outlook. Immunol Methods 72:313–340 37. Martin DC, Atmuri V, Hemming RJ, Farley J, Mort JS, Byers S, HombachKlonisch S, Stern R, Triggs-Raine BL 2008 A mouse model of human mucopolysaccharidosis IX exhibits osteoarthritis. Hum Mol Genet 17:1904 –1915 38. Ikegami-Kawai M, Takahashi T 2002 Microanalysis of hyaluronan oligosaccharides by polyacrylamide gel electrophoresis and its application to assay of hyaluronidase activity. Anal Biochem 311:157–165 39. Miura RO, Yamagata S, Miura Y, Harada T, Yamagata T 1995 Analysis of glycosaminoglycan-degrading enzymes by substrate gel electrophoresis (zymography). Anal Biochem 225:333–340 40. Chun SY, Eisenhauer KM, Minami S, Billig H, Perlas E, Hsueh AJW 1996 Hormonal regulation of apoptosis in early antral follicles: follicle-stimulating hormone as major survival factor. Endocrinology 137:1447–1456 41. Hsueh AJW, Billig H, Tsafriri A 1994 Ovarian follicular atresia: a hormonally controlled process. Endocr Rev 15:707–724 42. Hirshfield AN 1991 Development of follicles in the mammalian ovary. Int Rev Cytol 124:43–101 43. Tilly JL, Tilly KI 1995 Inhibitors of oxidative stress mimic the ability of follicle-stimulating hormone to suppress apoptosis in cultured rat ovarian follicles. Endocrinology 136:242–252 44. Chun SY, Billig H, Tilly J, Furuta I, Tsafriri A, Hsueh AJW 1994 Gonadotropin suppression of apoptosis in cultured preovulatory follicles: mediatory role of endogenous insulin like growth factor-1. Endocrinology 136:1845–1853 45. Frost GI, Csoka TB, Wong T, Stern R 1997 Purification, cloning, and expression of human plasma hyaluronidase. Biochem Biophys Res Commun 236: 10 –15 46. Toole BP 2004 Hyaluronan: from extracellular glue to pericellular cue. Nat Rev Cancer 4:528 –539 47. Markovic-Housley Z, Miglierini G, Soldatova L, Rizkallah PJ, Muller U, Schirmer T 2000 Crystal structure of hyaluronidase, a major allergen of bee venom. Structure 8:1025–1035 48. Chao KL, Muthukumar L, Herzberg O 2007 Structure of human hyaluronidase-1, a hyaluronan hydrolyzing enzyme involved in tumor growth and angiogenesis. Biochemistry 46:6911– 6920 49. Chang NS, Carey G, Pratt N, Chu E, Ou M 1998 p53 overexpression and


50. 51. 52. 53. 54. 55.

56. 57.

58.

59.

downregulation of inter-␣-inhibitor are associated with hyluronidase enhancement of TNF cytotoxicity in L929 fibroblasts. Cancer Lett 131:45–54 Knight PG, Glister C 2003 Local roles of TGF-␤ superfamily members in the control of ovarian follicle development. Anim Reprod Sci 78:165–183 Lin S-Y, Morrison JR, Phillips DJ, de Kretser DM 2003 Regulation of ovarian function by the TGF-␤ superfamily and follistatin. Reproduction 126:133–148 Soussi T, Wiman KG 2007 Shaping genetic alterations in human cancer: the p53 mutation paradigm. Cancer Cell 12:303–312 Bourdon JC 2007 p53 and its isoforms in cancer. Br J Cancer 97:277–282 Zambetti GP 2007 The p53 mutation “gradient effect” and its clinical implications. J Cell Physiol 213:370 –373 Lepperdinger G, Strobl B, Kreil G 1998 HYAL2, a human gene expressed in many cells, encodes a lysosomal hyaluronidase with a novel type of specificity. J Biol Chem 273:22466 –22470 Arming S, Strobl B, Wechselberger C, Kreil G 1997 In vitro mutagenesis of PH-20 hyaluronidase from human sperm. Eur J Biochem 247:810 – 814 Vigdorovich V, Miller AD, Strong RK 2007 Ability of hyaluronidase 2 to degrade extracellular hyaluronan is not required for its function as a receptor for jaagsiekte sheep retrovirus. J Virol 81:3124 –3129 Lokeshwar VB, Estrella V, Lopez L, Kramer M, Gomez P, Soloway MS, Lokeshwar BL 2006 HYAL1-v1, an alternatively spliced variant of HYAL1 hyaluronidase: a negative regulator of bladder cancer. Cancer Res 66:11219 –11227 Wouters MA, Rigoutsos I, Chu CK, Feng LL, Sparrow DB, Dunwoodie SL


60.

61.

62. 63.

64.

65.

5847

2005 Evolution of distinct EGF domains with specific functions. Protein Sci 14:1091–1103 Wang YD, De Vos J, Jourdan M, Couderc G, Lu ZY, Rossi JF, Klein B 2002 Cooperation between heparin-binding EGF-like growth factor and interleukin-6 in promoting the growth of human myeloma cells. Oncogene 21:2584 –2592 Price-Schiavi SA, Andrechek E, Idris N, Li P, Rong M, Zhang J, Carothers Carraway CA, Muller WJ, Carraway KL 2005 Expression, location, and interactions of ErbB2 and its intramembrane ligand Muc4 (sialomucin complex) in rat mammary gland during pregnancy. J Cell Physiol 203:44 –53 Yee AJ, Akens M, Yang BL, Finkelstein J, Zheng PS, Deng Z, Yang B 2007 The effect of versican G3 domain on local breast cancer invasiveness and bony metastasis. Breast Cancer Res 9:R47 Iwamoto R, Handa K, Mekada E 1999 Contact-dependent growth inhibition and apoptosis of epidermal growth factor (EGF) receptor-expressing cells by the membrane-anchored form of heparin-binding EGF-like growth factor. J Biol Chem 274:25906 –25912 Chlenski A, Liu S, Baker LJ, Yang Q, Tian Y, Salwen HR, Cohn SL 2004 Neuroblastoma angiogenesis is inhibited with a folded synthetic molecule corresponding to the epidermal growth factor-like module of the follistatin domain of SPARC. Cancer Res 64:7420 –7425 Wallner K, Li C, Shah PK, Wu KJ, Schwartz SM, Sharifi BG 2004 EGF-like domain of tenascin-C is proapoptotic for cultured smooth muscle cells. Arterioscler Thromb Vasc Biol 24:1416 –1421

Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.