Proteomics 2010, 10, 277–288
277
DOI 10.1002/pmic.200900440
RESEARCH ARTICLE
Mass spectrometric characterization of the Campylobacter jejuni adherence factor CadF reveals post-translational processing that removes immunogenicity while retaining fibronectin binding Nichollas E. Scott1, N. Bishara Marzook1, Ania Deutscher2, Linda Falconer2, Ben Crossett1, Steven P. Djordjevic2 and Stuart J. Cordwell1,3 1
School of Molecular and Microbial Biosciences, The University of Sydney, Sydney, Australia NSW Department of Primary Industries, Elizabeth Macarthur Agricultural Institute, Camden, Australia 3 Discipline of Pathology, School of Medical Sciences, The University of Sydney, Sydney, Australia 2
Campylobacter jejuni is a major gastrointestinal pathogen that colonizes host mucosa via interactions with extracellular matrix proteins, such as fibronectin (Fn). Fn-binding is mediated by a 37 kDa outer membrane protein termed Campylobacter adherence Factor (CadF). The outer membrane protein profile of a recent gastrointestinal C. jejuni clinical isolate (JHH1) was analysed using 2-DE and MS. Several spots were identified as products of the cadF gene. These included mass and pI variants of 34 and 30 kDa, as well as 24 kDa (CadF24) and 22 kDa (CadF22) mass variants. CadF variants were fully characterized by MALDI-TOF MS and MALDI-MS/MS. These data confirmed that CadF forms re-folding variants resulting in spots with lower mass and varying pI that are identical at the amino acid sequence level and are not modified posttranslationally. CadF22 and CadF24, however, were characterized as N-terminal, membraneassociated polypeptides resulting from cleavage between serine195 and leucine196, and glycine201 and phenylalanine202, respectively. These variants were more abundant in the virulent (O) isolate of C. jejuni NCTC11168 when compared with the avirulent (genome sequenced) isolate. Hexahistidine fusion constructs of full-length CadF (34 kDa), CadF24, and the deleted C-terminal OmpA domain (14 kDa; CadF14) were created in Escherichia coli. Recombinant CadF variants were probed against patient sera and revealed that only full-length CadF retained reactivity. Binding assays showed that CadF24 retained Fn-binding capability, while CadF14 did not bind Fn. These data suggest that the immunogenic epitope of CadF is cleaved to generate smaller Fnbinding polypeptides, which are not recognized by the host humoral response. CadF cleavage therefore may be associated with virulence in C. jejuni.
Received: June 23, 2009 Revised: September 15, 2009 Accepted: October 29, 2009
Keywords: Campylobacter adherence Factor / Campylobacter jejuni / Fibronectin binding / Immunogenicity / Microbiology / Outer membrane proteins
1
Introduction
Campylobacter jejuni is a Gram negative, micro-aerophilic, motile and spiral-shaped bacterium that is the most Correspondence: Dr. Stuart J. Cordwell, School of Molecular and Microbial Biosciences, Building GO8, The University of Sydney, Sydney 2006, Australia E-mail:
[email protected] Fax: 161-2-9351-4726 Abbreviations: CadF, Campylobacter adherence Factor; Fn, fibronectin; GS, genome sequenced
& 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
common cause of food- and water-borne illness world wide [1], infecting an estimated 1% of the population in the UK and USA annually [2]. Infection with C. jejuni is often associated with consumption of contaminated poultry [3] and displays symptoms ranging from a mild, non-inflammatory, watery diarrhoea to severe abdominal cramps, bloody diarrhoea, vomiting, fever, bacteremia and death in the immunocompromised [2]. These acute effects are typically self-limiting in healthy individuals, however some C. jejuni infections have been implicated in the development of long-term immune-mediated disease states, such as ´ the autoimmune-mediated neuropathy Guillain–Barre www.proteomics-journal.com
278
N. E. Scott et al.
Syndrome, Miller–Fisher Syndrome [4] and immunoproliferative small intestinal disease [5]. The pathogenic processes that lead to the development of disease are poorly understood [6]. Disease progression involves adaptation to the harsh gut environment, adherence to intestinal epithelial cells, followed by internalization, invasion and toxin production leading to host cell death [7]. Surface-exposed structures, including proteins, mediate many of these steps [8, 9]. Several adhesins have been identified in C. jejuni, including the major outer membrane protein ([10]), CapA [11], JlpA [12], the PEB antigens [13–16] and the Campylobacter adherence Factor (CadF) [17]. Such adhesins are of interest because they facilitate the initial steps needed for the development of disease and may also be useful as potential vaccine candidates [18]. A number of these proteins have also been shown to stimulate the humoral immune response in humans [14] and prior infection with C. jejuni is protective against subsequent C. jejuni challenge [19]. CadF is a C. jejuni adhesin required for binding to the extracellular matrix component fibronectin (Fn; [17]). CadF is present in all C. jejuni tested thus far, and has also been identified in C. coli [20]. CadF plays a central role in C. jejuni virulence since it is required for adhesion to, and invasion of, human gastrointestinal INT 407 cells [21], as well as for the colonization of avian host models [22]. CadF is also implicated in both human disease progression and persistence in the avian gastrointestinal track [3]. The site required for Fnbinding includes the linear surface-exposed amino acids 134 FRLS137 [23]. Disruption of this site, or protection via antiCadF antibodies, reduces C. jejuni binding to both Fn and colonization models [21, 23]. Previous work has shown that CadF, as well as the major outer membrane protein ([24], forms multiple bands when separated by SDS-PAGE [17]. This may be due to an artefactual heat modification during sample preparation and denaturation that results in re-folding, leading to the appearance of two mass variants separated by approximately 5 kDa (37 and 32 kDa; [17]). A recent comparison across multiple strains showed variation in the number of detectible CadF bands by Western blotting [20]. Interestingly, a majority of the strains that exhibit such variants were obtained from human faecal samples, suggesting that CadF may be modified in clinical strains to form novel polypeptides. Proteomic analysis of C. upsaliensis and C. helveticus has suggested that cleavage may also be a frequent event for certain proteins [25]. Surface-associated proteins in a variety of bacteria may be post-translationally processed to produce novel variants with potentially different functions. This is particularly true of Mycoplasma hyopneumoniae adhesins [26–29], although proteolytic processing has also been observed in the autotransporter involved in diffuse adherence of Escherichia coli [30]. Protein processing and remodelling therefore are likely to be an under-estimated PTM that may influence several functions, including virulence and immunogenicity. In this study, we have shown that the C. jejuni CadF protein is processed from the C-terminus into 24 kDa & 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Proteomics 2010, 10, 277–288
(CadF24) and 22 kDa (CadF22) variants in a recent clinical isolate, JHH1, and in NCTC11168. These processed proteins remain membrane-associated but do not react with patient serum, unlike native CadF. We also confirm that CadF is highly resistant to detergent extraction and is capable of refolding under denaturing conditions, resulting in artefactual lower mass variants of 30 kDa. CadF24/22 contain the four amino acid Fn-binding domain 134FRLS137 (24), and we showed that CadF24, unlike the removed 14 kDa C-terminal region (CadF14), remained capable of binding Fn. CadF processing may also be associated with virulence as CadF24 and CadF22 are more abundant in virulent (‘‘O’’; ‘‘original’’) compared with avirulent (‘‘GS’’, genome sequenced) NCTC11168. We conclude that CadF processing may provide antigenic variation and aid in evasion of the immune response, while retaining adhesin-like function.
2
Materials and methods
2.1 Bacterial strains and growth C. jejuni JHH1 was isolated from a patient with gastrointestinal campylobacteritis and supplied by the John Hunter Hospital, Newcastle, Australia [31]. The NCTC11168 virulent (O) and passaged avirulent (GS) isolates were kindly supplied by Victoria Korolik [32]. Cells were cultured on 20–40 parallel Skirrow’s agar (Oxoid, Adelaide, Australia) plates in a micro-aerophilic environment of 5% O2, 5% CO2 and 90% N2 at 371C for 48 h. Plates were flooded with 5 mL of sterile PBS and colonies removed from the agar plates with a cell scraper. Cells were washed three times in PBS and collected by centrifugation at 12 000 g. Cells were lyophilized and stored at 801C until required.
2.2 Preparation of membrane protein-enriched fractions and 2-DE C. jejuni membrane protein-enriched fractions were isolated by the modified sodium carbonate precipitation method [33] (using a Bio-Rad (Hercules, CA) ReadyPrepTM Protein Extraction Kit (Membrane II) as previously described [34]. 2-DE sample buffer (5 M urea, 2 M thiourea, 0.1% carrier ampholytes, 2% w/v CHAPS, 2% w/v sulfobetaine 3–10, 2 mM tributylphosphine; Bio-Rad) supplemented with 1% w/v amidosulfobetaine-14 was used to solubilize the precipitated membrane proteins. A 250 mg of protein was used to re-swell pre-cast 17 cm pH 4–7 IPG strip gels (BioRad). IEF was performed using an IEFCell (Bio-Rad) apparatus for a total of 80 kVh. IPG strips were reduced, alkylated and detergent-exchanged in equilibration buffer [6 M urea, 2% SDS, 20% v/v glycerol, 5 mM tributylphosphine, 2.5% v/v acrylamide monomer and 375 mM Tris/HCl (pH 8.8)] for 10 min, prior to loading the IPG strips onto the top of a pre-cast 12.5%T, 2.5%C polyacrylamide gel (20 cm2). Strips www.proteomics-journal.com
279
Proteomics 2010, 10, 277–288
were embedded in 0.5% agarose in cathode buffer (192 mM glycine, 25 mM Tris, 0.1% SDS). Second-dimension electrophoresis was carried out at 41C. Gels were fixed in 40% v/v methanol, 10% v/v acetic acid for 1 h and then stained overnight in Sypro Ruby (Bio-Rad). Gels were destained in 10% v/v methanol, 7% v/v acetic acid for 1 h and imaged using a Molecular Imager Fx (Bio-Rad). Gels were ‘‘double-stained’’ for a minimum of 24 h in Colloidal Coomassie Blue G-250 (0.1% w/v G-250 in 17% w/v ammonium sulphate, 34% v/v methanol and 3% v/v orthophosphoric acid) as previously described [35]. Gels were destained in 1% v/v acetic acid for a minimum of 1 h.
2.3 Western blotting Proteins from unstained 2-DE gels were transferred at 25 V for 2 h to PVDF membranes using a Trans-Blots SD Semi-Dry Electrophoretic Transfer Cell (Bio-Rad). Proteins transferred to PVDF membranes were probed with a 1/200 dilution of convalescent patient serum derived 5 weeks post-C. jejuni infection. Immunoreactive proteins were detected using a 1/1000 dilution of goat-anti-human immunoglobulin antibody, followed by incubation in 3,30 -diaminobenzidine tetrahydrochloride (Sigma, St. Louis MO). Images were obtained using a GS-800 Densitometer (Bio-Rad). Images from Sypro Ruby stained 2-DE gels (from within the same gel run) and immunoblotted PVDF membranes were overlapped using PD-Quest to facilitate identification of antigenic proteins.
2.4 Protein identification by MS 2-DE isolated protein spots were processed as previously described [35]. Briefly, spots were excised using a sterile scalpel blade and washed in a destain solution [60:40 solution of 40 mM ammonium bicarbonate (pH 7.8)/100% ACN] for 1 h at room temperature. The solution was removed from the wells and the gel pieces vacuum-dried for 1 h. The gel spots were rehydrated in 8 mL of trypsin solution [12 ng/mL1 (sequencing-grade modified trypsin (Promega, Madison, WI) in 40 mM ammonium bicarbonate)] at 41C for 1 h. Excess trypsin was removed and the gel pieces re-suspended in 25 mL of 40 mM ammonium bicarbonate and incubated overnight at 371C. Peptides were concentrated and desalted using C18 TM Perfect Pure Tips (Eppendorf, Hamburg, Germany) and eluted in matrix [CHCA (Sigma), 8 mg/mL in 70% v/v ACN/ 1% v/v formic acid] directly onto a target plate. Peptide mass maps were generated by MALDI-TOF MS using a Voyager DE-STR (Applied Biosystems, Framingham, MA). Mass calibration was performed using trypsin autolysis peaks, m/z 2211.11 and m/z 842.51 as internal standards. Data from peptide mass maps were used to perform searches of the NCBI, SWISS-PROT and TrEMBL databases, via the program MASCOT (www.matrixscience.com). Identification parameters included peptide mass accuracy within 50 ppm, one & 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
possible missed tryptic cleavage per peptide, and with the methionine sulfoxide and cysteine-acrylamide modifications checked. Identifications were based on MASCOT score and Evalues, the observed pI and Mr (kDa) of the protein, the number of matching peptide masses and the total percentage of the amino acid sequence that those peptides covered. CadF peptide sequences were confirmed using tandem MS on an Applied Biosystems Q-STAR XL equipped with o-MALDI source. Following acquisition of peptide mapping data, individual parent ions were selected for MS-MS and the instrument switched into product ion mode. Collision energy was set between 60–100 depending on the m/z of the parent ion. Data were acquired for up to 2 min and summed. Spectra were annotated in Analyst and searched against the NCBI database using the BLAST ‘‘search for short, nearly exact matches’’ algorithm.
2.5 Characterization of CadF pI variants In order to confirm chemical homogeneity or the presence of a PTM, CadF pI variants were analysed according to the ‘‘re-2-DE’’ method [36]. Briefly, the most intensely stained CadF spot corresponding to the full-length, completely denatured protein (34 kDa) was excised from triplicate Coomassie Blue stained gels. The gel spots were placed in destain solution for 1 h at room temperature with gentle shaking. Gel plugs were homogenized using a micro-pestle in low-bind tubes and 100 mL of 2-DE buffer added. The sample was then bath sonicated for 30 min. The 2-DE buffer was removed and mixed with additional 2-DE buffer to a final volume of 250 mL. The protein solution was then used to re-swell pre-cast 11 cm pH 4–7 IPG strip gels overnight. 2-DE was performed as described above; except that IEF was performed for 50 kVh and second dimension SDS-PAGE performed using 11 cm pre-cast 4-12% Bis-Tris Criterion gels (Bio-Rad). Gels were run at 200 V for 45 min.
2.6 Characterization of mass variants of CadF SDS-PAGE gels were used to confirm CadF denaturation artefacts according to the modified method of [37]. Identical spots of interest were excised from several fixed and stained 2-DE gels and pooled. Samples were homogenized using a micro-pestle in 50 uL of 2% w/v SDS. The solution was sonicated for 30 min. Eluted protein was then suspended in Laemmli buffer [24.8 mM Tris, 10 mM glycerol, 0.5% w/v SDS, 3.6 mM b-mercaptoethanol and 0.001% w/v bromophenol blue (pH 6.8)] prior to SDS-PAGE separation (‘‘nondenatured’’). To determine whether more severe conditions could remove CadF mass variants, the sample was also suspended in Laemmli buffer, supplemented with 2% SDS, and heated at 951C for 10 min prior to SDS-PAGE (‘‘denatured’’). 12% polyacrylamide resolving gels with a 5% polyacrylamide stacking gel were cast in 7 cm Mini-PROTEAN 3 www.proteomics-journal.com
280
N. E. Scott et al.
casting chambers (Bio-Rad). Gels were run in a MiniPROTEAN 3 electrophoresis chamber and were stained as described in Section 2.2.
Proteomics 2010, 10, 277–288
confirmed via DNA sequencing to contain a 35 amino acid N-terminal construct tag composed of a hexahistidine region, the XpressTM epitope and EK cleavage site (derived from pET100/D-TOPO) as outlined by the manufacturer, and the CadF construct of interest.
2.7 Intact protein MS Intact protein MS from 2-DE gel plugs was performed according to Luque-Garcia et al. [38]. Proteins were transferred to pure nitrocellulose membranes (Pall, East Hills NY). Membranes were stained with Ponceau-S (0.2% w/v PonceauS, 5% v/v acetic acid) for 5 min and washed in Milli-Q water until background staining was removed. Spots detected on nitrocellulose membranes corresponding to CadF variants were excised. Modified matrix solution (CHCA, 10 mg/mL in 70% v/v ACN/30% v/v methanol/1% v/v TFA) was added in the ratio 10 ml per 1 mm2. The solution was then bath sonicated for 10 min and 1 mL spotted onto a MALDI target plate for MS analysis.
2.8 DNA extraction Chromosomal DNA was extracted from C. jejuni JHH1 by phenol-chloroform, followed by dialysis against TE buffer as described previously [31]. Plasmid DNA was extracted from E. coli with a Qiagen mini-prep kit according to the manufacturer’s instructions (Qiagen, Valencia, CA).
2.10 Protein expression and purification All CadF constructs were expressed as hexahistidyl fusion proteins and purified by nickel affinity chromatography. Briefly, E. coli M15(pREP4) cells were grown to mid-log phase and induced with a final concentration of 1 mM IPTG. Cells were harvested by centrifugation (4000 g for 20 min) and then lysed in 8 M urea buffer (8 M urea, 0.01 M Tris, 0.1 M NaH2PO4, pH 8.0) with gentle rocking for 1 h. Cell debris was removed by centrifugation at 10 000 g for 30 min. To the supernatant, 0.25 volume of a 50% Ni-nitrilotriacetic acid slurry (Qiagen) was added and the solution allowed to mix gently for 1 h. The solution was loaded onto a glass column and washed twice with 8 M urea buffer (pH 6.3). Bound protein was eluted with low pH urea buffer (pH 5.9 and 4.5). Proteins were analysed for purity by SDS-PAGE and then dialyzed for 48 h with multiple buffer changes against PBS; 10mM sodium phosphate, 150 mM sodium chloride, pH 7.4, supplemented with first 0.1% w/v SDS and then 5% v/v glycerol. The concentration of the purified proteins was estimated by Bradford assay (Bio-Rad). MS was used to confirm the identity of the CadF constructs.
2.9 Creation of CadF constructs 2.11 Fn-binding assays Three hexahistidine fusion CadF constructs were created from JHH1 genomic DNA. To clone the specific sequences of interest, gene fragments were amplified via PCR with Taq polymerase (Qiagen). Primers used for amplification of the gene fragments are outlined in Table 1. These three constructs corresponded to full-length CadF (native protein following removal of the signal peptide; CadF34), the 24 kDa N-terminal domain (CadF24) and the C-terminal 14 kDa OmpA domain (CadF14; Fig. 1). CadF fragments were digested with the appropriate restriction enzymes and ligated into linearized pET100/D-TOPO (Invitrogen, Carlsbad, CA) as outlined by the manufacturer. Ligated plasmids were electroporated into E. coli M15(pREP4) cells with a Bio-Rad Gene Pulser (Bio-Rad) at 2.5 kV, 25 mF, and 200 O according to the manufacturer’s instructions. All plasmid constructs were
Table 1. List of primers used in this study
Name
Sequence
CadF1 CadF2 CadR1 CadR2
50 –CACCGATAACAATGTAAAATTTG–30 50 –CACCGGTTTTGATAAAACTAC–30 50 –TTATCTTAAAATAAATTTAGCATCCAC–30 50 –TTAAAAATGACCTTCCAAAGAAATAG–30
& 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Proteins were transferred to PVDF membrane as described above. Membranes were blocked in 5% skim milk in Tris saline buffer (TBS; 10 mM Tris, 0.15 M NaCl, pH 7.4) for
Figure 1. CadF hexahistidine fusion constructs in C. jejuni JHH1. The construct tag is shown as a dark gray box, N-terminus as a white box and the C-terminus as a light gray box. Three constructs were created corresponding to native full-length CadF (amino acids 2–303; CadF34), the N-terminal region identified on 2-DE gels from JHH1 membrane protein-enriched fractions (amino acids 2–201; CadF24), and the cleaved C-terminal region (amino acids 202–303; CadF14). The first 35 amino acids correspond to the construct tag of the pET100/D-TOPO expression vector (Invitrogen; as indicated by the dark box). The position and primers used to create these constructs (designated CadF1, F2, R1 and R2) are shown.
www.proteomics-journal.com
Proteomics 2010, 10, 277–288
1 h. Membranes were then incubated for 90 min in human Fn solution (Calbiochem; 30 mg/mL in 0.1% skim milk/ TBS), followed by three washes in 0.1% skim milk/TBS. Membranes were then probed with rabbit anti-human Fn antiserum (1/3000) for 1 h, followed by three further washes. HRP-conjugated sheep anti-rabbit immunoglobulin (1/1000) was used for detection, membranes were washed three further times prior to a final wash with 100 mM Tris (pH 7.6). Membranes were developed in 50 mL of 100 mM Tris supplemented with 7.5 mL H2O2 and 25 mg 3,30 -diaminobenzidine tetrahydrochloride for 30 min. Western blotting of purified CadF constructs was performed from SDS-PAGE gels as described above.
3
Results
3.1 Identification of CadF variants in C. jejuni JHH1 2-DE gels derived from membrane protein-enriched fractions and identification of separated proteins by peptide mass mapping from C. jejuni JHH1 revealed a number of spots corresponding to the CadF gene-product (Fig. 2). A series of CadF spots were identified at approximately 34 kDa (CadF34) and also at 30 kDa (CadF30), as well as two lower mass forms (approximately 24 kDa [CadF24] and 22 kDa [CadF22]) not present in pI variants. Western blotting of identical gels probed with patient serum revealed that CadF34/30 were immunogenic (Fig. 2) while the lower mass variants did not elicit a response.
3.2 Characterization of CadF pI and mass variants CadF34/30 each appear as three pI variants (Fig. 2). This suggests that CadF may be post-translationally modified. Interestingly, neither of the lower forms (CadF24/22) appears as multiple spots, suggesting that any modification must be located in the region that differs between the higher and lower mass variants. pI variants of CadF34/30 were subjected to digestion with trypsin, Asp-N and Glu-C for comparative MALDI-TOF MS to identify differences that could correspond to chemical modifications responsible for charge
281 variation (data not shown). No mass spectral differences could be found in any of the three pI variants found for these mass variants (six spots in total), despite over 85% sequence coverage for CadF following the combining of the three enzyme digests and tandem-MS (data not shown). The appearance of multiple pI isoforms with no differences in proteolytic mapping coverage suggested either: (i) a PTM in the region not covered by the three proteases; or (ii) that the gel process causes an artefactual charge variation. We investigated the multiple pI variants using the ‘‘re-2-DE’’ method [36]. Briefly, if a protein spot is chemically homogeneous, excision, elution and re-separation on a second 2-D gel should result in a single spot corresponding to that form. If the spot, however, is the result of an artefact, multiple pI variants will again appear on the second 2-DE gel. Individual pI variants from CadF34 were pooled from multiple gels (n 5 3), eluted and re-run on an 11 cm pH 4–7 2-DE gel (Fig. 3A). On each occasion, multiple spots resulted from the original, indicating that the pI variants result from the gel process. N-terminal sequencing using Edman chemistry showed that all four CadF mass variants (CadF34/30/24/22) shared the N-terminal sequence ‘‘ADNNVK’’ resulting from the removal of the first 16 amino acids corresponding to the bacterial signal sequence (data not shown). Trypsin digest followed by MALDI-TOF MS provided sequence coverage of 43% for both CadF34 and CadF30. For the lower mass variants, sequence coverage of 29% for CadF24 and 26% for CadF22 were obtained (Fig. 4). Peptides of m/z 1350.70, 1178.63, 2546.40 and 1106.55 were absent from the spectra derived from both CadF24/22. These peptides correspond to residues 193 TISLEGHFGFDK204, 205TTINPTFQEK214, 221VLDENER272 YDTILEGHTDNIGSR242 and TVGYGQDNPR281, confirming the N-terminal sequencing data showing the lower mass variants result from the loss of a C-terminal region. We also observed a unique peak of m/z 960.47 within the tryptic peptide map from CadF24 alone (Fig. 4). MALDI MS-MS revealed that this peak corresponds to residues 193 TISLEGHFG201 (Fig. 5) and is therefore likely to be the C-terminus of CadF24. Furthermore, a second cleavage event occurs to derive CadF22, since m/z 960.47 is not found within MALDI-MS spectra derived from trypsin digests of this form. We examined the mass range between m/z 350–1000 in an
Figure 2. 2-DE gel and Western blot of C. jejuni JHH1 showing CadF variants identified in this study. (A), 2-DE gel of membrane protein-enriched fraction; (B), 2-DE Western blot of membrane protein-enriched fraction against convalescent patient serum. CadF spots were identified using trypsin digest followed by MALDI-TOF MS. CadF spots clustered into four groups migrating in the second dimension as follows: 1, 34 kDa; 2, 30 kDa; 3, 24 kDa; and 4, 22 kDa.
& 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.proteomics-journal.com
282
N. E. Scott et al.
Proteomics 2010, 10, 277–288
(n 5 3) and separated on 7 cm 1-D SDS-PAGE gels. As an internal control, two proteins of similar mass were also excised from the original 2-DE gels (CjaC [Cj0734c] and CjaA [Cj0982c] with approximate molecular masses of 32 and 34 kDa, respectively). Separation of pooled CadF30 revealed two bands corresponding to 34 and 30 kDa (Fig. 3B), confirming that the 30 kDa variant results from a gel artefact. No differences were observed in peptide mass maps of these bands following trypsin digest (data not shown). CjaC and CjaA did not form multiple mass bands. We then attempted to determine whether more severe sample preparation conditions could remove the 30 kDa artefact from subsequent SDS-PAGE gels. We found that boiling purified 34 kDa CadF in the presence of 2% SDS could denature the protein completely and no 30 kDa CadF was observed (data not shown and Fig. 8).
Figure 3. (A) Re-2-DE gel of a purified CadF34 pI variant results in multiple pI isoforms. This indicates that CadF pI variants result from the gel-running process. (B) SDS-PAGE gel of CadF30 repurified from 2-DE gels. Both controls (CjaA and CjaC) formed single bands corresponding to the mass of spots seen within 2-DE gels, while re-purified CadF30 formed bands corresponding to 34 and 32 kDa.
3.3 Determination of intact masses of CadF variants by MALDI-MS To definitively prove that CadF34/30 were identical and to characterize the C-terminal cleavage site of CadF22, we compared the intact mass of CadF variants by MALDI-TOF
Figure 4. Peptide mass maps derived by MALDI-TOF MS following trypsin digest of CadF variants; CadF34; CadF30; CadF24; and CadF22. The 34 and 30 kDa forms generated identical mass spectra while the 24 and 22 kDa products showed the loss of m/z 1350.70, 1178.63, 2546.40 and 1106.55 ions. CadF24 contained a novel m/z 960.47 peak (boxed). Ion m/z 2582.23 corresponds to a tryptic peptide of m/z 2566.23 with oxidized methionine.
attempt to identify the site of this second cleavage but no spectral differences could be seen (data not shown). A summary of the MS analysis of CadF variants is shown in Fig. 6. Since we observed no differences in the trypsin, Asp-N or Glu-C peptide mass maps of CadF34 and CadF30, we investigated whether the 30 kDa variant was an artefact resulting from sample preparation and/or gel running. Individual CadF30 spots were pooled from multiple gels & 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
MS. We observed that the intact mass of both CadF34 and CadF30 corresponded to 34270 Da (Fig. 7). This confirms that CadF is capable of refolding in 2-DE buffer to create a gel anomaly, as has been seen in previous studies using SDS-PAGE (25). MALDI-TOF MS of intact CadF24 and CadF22 forms showed these spots corresponded to masses of 22420 and 21780 Da, respectively (Fig. 7). The mass difference between CadF34/30 and CadF24 was 11850 Da, corresponding to the loss of 102 amino acids from the www.proteomics-journal.com
Proteomics 2010, 10, 277–288
283
Figure 5. MALDI MS-MS of m/z 960.47 ion from CadF24 confirming the C-terminus. The peptide 199TISLEGHFG204 was identified by the b and y ion series. m/z 110 ion indicates the histidine immonium ion.
Figure 6. CadF protein sequence showing peptide identification. Amino acid sequence corresponding to MASCOT entry Q9X4B1_CAMJE modified to contain complete C-terminus found in entry C81294. Peptides identified in Fig. 4 are marked on the sequence. The cleavage site leading to CadF24 is noted with a and the removed C-terminal domain is shaded. The cleavage site leading to CadF22 is noted with a 1. The m/z 1974.9 peptide is underlined–this contains an oxidized methionine and an internal disulfide between Cys175 and Cys190 (data not shown). The Fnbinding site (118FRLS121) is highlighted in dark shading.
C-terminus, and agreeing with the tryptic peptide and MSMS data that suggested glycine201 is the C-terminal amino acid. CadF22 differs further in mass by 640 Da compared with CadF24, suggesting a second processing event, most likely between serine195 and leucine196.
3.4 Cad F24 binds Fn, but is not immunogenic To better understand the potential role of CadF24/22, we created three hexahistidine CadF fusion constructs (Fig. 1), representing full-length CadF (CadF34), CadF24, and the & 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
removed C-terminal 14 kDa domain (which we have termed CadF14). These were expressed in E. coli, purified, separated by SDS-PAGE and Western blotted against patient sera. Both Fnbinding and Western blotting experiments were conducted using denatured and non-denatured CadF (Fig. 8). Alteration in the preparation conditions did not alter the immunogenicity or Fn-binding of constructs (data not shown). Only the full-length CadF construct (both 34 and 30 kDa variants) was found to react with patient sera, while both CadF24 and CadF14 did not elicit a response (Fig. 8). Mass spectral analysis of CadF24/22 products revealed that they result from the loss of a large region of the C-terminus, however, the previously proposed Fn-binding region (134FRLS137) remains associated with these forms. To confirm that CadF24/22 retain functional viability, we undertook Fn-blotting experiments. Full-length recombinant CadF34 and CadF24 were both able to bind Fn (Fig. 8), while no binding could be seen for the CadF14 C-terminal domain. These data confirm that the processed CadF variants seen in membrane protein-enriched fractions of C. jejuni JHH1 remain capable of binding Fn, while not eliciting an immune response.
3.5 Cad F24=22 are more abundant in the virulent (O) isolate of C. jejuni NCTC11168 To determine any association of CadF processing with virulence, we utilized the genome reference strain NCTC11168, which is available as the initial virulent isolate (referred to as O) and as the genome sequenced, laboratory GS isolate. 2-DE analysis revealed the presence of both www.proteomics-journal.com
284
N. E. Scott et al.
Proteomics 2010, 10, 277–288
Figure 7. Intact protein MALDI-MS spectra of CadF variants: CadF34; CadF30; CadF24 and CadF22. CadF34/30 gave identical masses of m/z 34270 while CadF24 and CadF22 generated masses of m/z 22500 and 21870, respectively.
CadF24 and CadF22 in these isogenic strains (Fig. 9). Spot density analysis, however, derived from triplicate gel analysis (biological replicates), revealed that CadF24 and CadF22 were more abundant within O (63% or 1.6570.06-fold for CadF24 and 73% or 1.7370.02-fold for CadF22), compared with GS (Fig. 9). No significant abundance differences could be detected in CadF34 or CadF30 (Fig. 9).
4
Discussion
CadF has been shown to elicit a humoral immune response in humans [17], but this is the first time information about the location of the immunogenic epitope/s has been derived. Since C. jejuni-derived CadF24/22, recombinant CadF24 and CadF14 were all non-reactive against patient anti-serum, it is reasonable to hypothesize that the processed region, serine195 to phenylalanine202, is necessary for reactivity. The ability of the polypeptide sequence linking the N- and C-terminal domains to facilitate antigenicity and be cleaved suggests this region is exposed within the native protein. This is supported by the maintenance of immunogenicity within both fully denatured (CadF34) and partially folded (CadF30) CadF variants (Fig. 2). Antigenicity of CadF does not depend on protein folding as both CadF34 and CadF30 displayed reactivity proportional to protein abundance (Fig. 2). This suggests that the region of the sequence containing the cleavage site is the predominant target of the humoral response. This finding is in agreement with previous work which has demonstrated that immunogenic epitopes can be localized to specific regions within outer membrane proteins similar to CadF, such as E. coli [39] and Salmonella enterica OmpA [40] and OprF of Pseudomonas aeruginosa [41]. In the case of P. aeruginosa OprF, determination of the immunogenic region has enabled & 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
synthetic peptides to be generated that can provide protective immunity in a chronic pulmonary infection model [42]. While such a possibility is unknown in C. jejuni, we have demonstrated that CadF cleavage abolishes reactivity. This further suggests that removal of the C-terminal domain in vivo may provide an advantage in virulence, as Fn-binding is maintained in the non-immunogenic N-terminal region. The C-terminus of C. jejuni JHH1 CadF is removed to form two novel products with masses of 24 and 22 kDa, respectively. These variants were observed in multiple strains, including JHH1 and both isolates of NCTC11168. NCTC11168 provides an excellent model for understanding virulence in C. jejuni. The genome sequenced laboratorypassaged isolate (GS) has reduced virulence traits [43, 44], including epithelial cell adhesion, chicken colonization and even morphology when compared with the original clinical isolate (O), despite the fact that no genetic differences can be determined via typing methods [44]. Microarray profiling largely shows elevated transcript levels for genes involved in flagellar motility [43, 44], as well as genes involved in the tricarboxylic acid cycle and electron transport chain in NCTC11168-O [44]. The GS isolate displayed significantly reduced abundance of both CadF lower mass variants, although they could still be detected (Fig. 9). Furthermore, in the laboratory-passaged strain ATCC700297 these variants could not be detected (Supporting Information Fig. 1). Variability in CadF banding, particularly in strains isolated from human faeces, has also been detected elsewhere [20]. Interestingly, not all of the 34 kDa ‘‘native’’ CadF is processed and there does not appear to be an abundance difference for full-length CadF when compared between C. jejuni JHH1 and passaged strains [34], suggesting that cadF gene expression may be higher in clinical isolates to compensate for processed CadF. While this was also www.proteomics-journal.com
Proteomics 2010, 10, 277–288
Figure 8. Immune reactivity and Fn-binding assay of recombinant CadF constructs. Total protein stain of (A) non-denatured; and (B) denatured, CadF constructs. (C) Western blot against patient serum showing immunoreactivity of non-denatured CadF34/30; (D) Fn-binding assay showing denatured CadF34 and CadF24 bind Fn. Denatured CadF34 was also immunogenic, while non-denatured CadF34/30 bound Fn (data not shown). CadF constructs are denoted as CadF34 (full-length); CadF24 (N-terminal region); CadF14 (C-terminal region). CadF34 binds Fn and elicits an immune response, while processed CadF24 retains Fnbinding but is non-immunogenic. CadF14 does not elicit an immune response or bind Fn. Non-denatured CadF34 constructs showed the formation of two bands (labelled (i) and (ii) in panel (A) that were confirmed by MS analysis to be full-length CadF with the addition of the 35-residue N-terminal construct tag that results in an increase in observed molecular mass of 4 kDa.
285 CadF variability may be due to non-specific processing, as has been seen with other adhesins, such as E. coli AIDA-I, where not only is the cleaved product seen but also the mature protein [45]. The two cleavage sites identified here do not appear to share a recognition sequence but are clearly located in a region accessible to protease activity. Previous work on the proteome of C. jejuni JHH1 has identified an increased abundance of several proteases in this isolate compared with laboratory strains, including the carboxylterminal protease (Cj0511) and the HtrA serine protease (Cj1228c) [34]. An increased abundance of Cj1228c has recently been associated with robust chicken colonization and may reflect a requirement for protease activity in colonization [46]. Our findings raised the question of whether processing influences CadF function. The CadF24/22 products remain membrane-associated (they are present in membraneprotein enriched fractions [this study] and are not detected in cytoplasmic protein extracts [data not shown]), despite removal of the OmpA transmembrane domain, which is either lost into the medium or further processed, as we were unable to identify it in a large-scale analysis of the C. jejuni proteome. The predicted Fn-binding site, 134FRLS137, is present in all CadF forms identified in this study. We therefore employed Fn-binding assays to determine whether processed CadF retained the ability to bind Fn. Our data conclusively show that the processed N-terminal region (recombinant CadF24) strongly binds Fn and, at least qualitatively, with greater affinity than full-length CadF. Removal of the C-terminus therefore, does not affect Fnbinding and suggests the C-terminal OmpA domain confers another, as yet unknown, function. For example, E. coli OmpA has been implicated in the stabilization of the outer membrane by binding peptidoglycan [47], while S. enterica OmpA has been suggested to insert in the membrane to form a channel [40]. We were able to identify CadF variants that appeared to be altered in both mass and charge (CadF34/30). Interestingly, the
Figure 9. 2-DE gel comparison of membrane protein-enriched fractions from C. jejuni NCTC11168-O (A) and GS (B) showing CadF variants. CadF spots were identified using trypsin digest followed by MALDI-TOF MS.
observed in our comparison between O and GS NCTC11168, where no differences in spot abundance could be seen for either 34 or 30 kDa CadF, microarray profiling suggests cadF expression is largely unaltered between isolates [44]. & 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
formation of mass variants was also observed with purified full-length recombinant CadF (Fig. 8), further supporting the evidence that variation results from properties conferred by the protein itself. Tryptic peptide and intact protein mapping by MALDI-MS showed CadF34/30 were identical and most likely www.proteomics-journal.com
286
N. E. Scott et al.
resulted from gel artifacts. This may be caused by inefficient denaturation and refolding, except in the presence of high temperatures (Fig. 8 and [17]). Our data suggests that the Cterminus is responsible for this characteristic, as CadF24/22 variants do not form either pI isoforms or faster migrating spots. The formation of multiple pI variants on 2-DE gels is usually presumed to indicate the presence of a protein PTM, such as phosphorylation, glycosylation or deamidation. We anticipated that the difference in isoforms would be the result of deamidation, a modification typically seen in proteins targeted for degradation. Previous studies have shown that asparagines are the most likely targets, usually prior to a glycine (most common) or serine residue [48]. CadF contains a single doublet with a high probability for deamidation, 188 NG189, however this site was shown to be unmodified in all variants (contained on predicted tryptic peptide m/z 1974.9, which also contains an intra-molecular disulfide bond; data not shown). Lutter et al. [36] have previously shown that recombinant viscumin forms charge variants that do not result from PTM, but rather from conformational variants that exist in equilibrium during 2-DE sample preparation. We utilized their re-2-DE method to confirm that CadF charge variants result from conformational differences. These data supports the findings of Singh et al. who have suggested that the OmpA domain, which is found in the C-terminus of CadF, may confer multiple conformations [40]. This study has shown that the CadF is cleaved in a clinical isolate of C. jejuni to create shortened N-terminal variants that remain capable of binding Fn, yet unlike fulllength CadF, are no longer immunogenic. This processing is seen within other isolates but also appears to be less abundant in strains that have undergone laboratory adaptation. Our data also suggest that the immunogenic epitope of CadF probably resides in the polypeptide region connecting the Fn-binding domain to the OmpA domain. These data suggest that removal of the C-terminal domain may be important in aiding evasion of the human immune response while retaining protein function in C. jejuni virulence. This work was supported by the Australian Research Council (DP066422) and by access to the Sydney University Proteome Research Unit (SUPRU). NES was supported by an Australian Postgraduate Award. SJC is the recipient of a VELUX Visiting Professorship at the University of Southern Denmark. The authors have declared no conflict of interest.
Proteomics 2010, 10, 277–288 [3] Young, K. T., Davis, L. M., Dirita, V. J., Campylobacter jejuni: molecular biology and pathogenesis. Nat. Rev. Microbiol. 2007, 5, 665–679. [4] Hughes, R. A., Cornblath, D. R., Guillain–Barre syndrome. Lancet 2005, 366, 1653–1666. [5] Lecuit, M., Abachin, E., Martin, A., Poyart, C. et al., Immunoproliferative small intestinal disease associated with Campylobacter jejuni. N. Eng. J. Med. 2004, 350, 239–248. [6] Dorrell, N., Wren, B. W., The second century of Campylobacter research: recent advances, new opportunities and old problems. Curr. Opin. Infect. Dis. 2007, 20, 514–518. [7] Ketley, J. M., Pathogenesis of enteric infection by Campylobacter. Microbiology 1997, 143, 5–21. [8] Karlyshev, A. V., Ketley, J. M., Wren, B. W., The Campylobacter jejuni glycome. FEMS Microbiol. Rev. 2005, 29, 377–390. [9] Stintzi, A., Marlow, D., Palyada, K., Naikare, H. et al., Use of genome-wide expression profiling and mutagenesis to study the intestinal lifestyle of Campylobacter jejuni. Infect. Immun. 2005, 73, 1797–1810. [10] Moser, I., Schroeder, W., Salnikow, J., Campylobacter jejuni major outer membrane protein and a 59 kDa protein are involved in binding to fibronectin and INT 407 cell membranes. FEMS Microbiol. Lett. 1997, 157, 233–238. [11] Ashgar, S. S., Oldfield, N. J., Wooldridge, K. G., Jones, M. A. et al., CapA, an autotransporter protein of Campylobacter jejuni, mediates association with human epithelial cells and colonization of the chicken gut. J. Bacteriol. 2007, 189, 1856–1865. [12] Jin, S., Joe, A., Lynett, J., Hani, E. K. et al., JlpA, a novel surface-exposed lipoprotein specific to Campylobacter jejuni, mediates adherence to host epithelial cells. Mol. Microbiol. 2001, 39, 1225–1236. [13] Asakura, H., Yamasaki, M., Yamamoto, S., Igimi, S., Deletion of peb4 gene impairs cell adhesion and biofilm formation in Campylobacter jejuni. FEMS Microbiol. Lett. 2007, 275, 278–285. [14] Pei, Z. H., Ellison, R. T., III, Blaser, M. J., Identification, purification, and characterization of major antigenic proteins of Campylobacter jejuni. J. Biol. Chem. 1991, 266, 16363–16369. [15] Pei, Z., Burucoa, C., Grignon, B., Baqar, S. et al., Mutation in the peb1A locus of Campylobacter jejuni reduces interactions with epithelial cells and intestinal colonization of mice. Infect. Immun. 1998, 66, 938–943. [16] Rangarajan, E. S., Bhatia, S., Watson, D. C., Munger, C. et al., Structural context for protein N-glycosylation in bacteria: the structure of PEB3, an adhesin from Campylobacter jejuni. Protein Sci. 2007, 16, 990–995.
[1] Butzler, J. P., Campylobacter, from obscurity to celebrity. Clin. Microbiol. Infect. 2004, 10, 868–876.
[17] Konkel, M. E., Garvis, S. G., Tipton, S. L., Anderson, D. E., Jr., Cieplak, W., Jr., Identification and molecular cloning of a gene encoding a fibronectin-binding protein (CadF) from Campylobacter jejuni. Mol. Microbiol. 1997, 24, 953–963.
[2] Snelling, W. J., Matsuda, M., Moore, J. E., Dooley, J. S., Campylobacter jejuni. Lett. Appl. Microbiol. 2005, 41, 297–302.
[18] Wizemann, T. M., Adamou, J. E., Langermann, S., Adhesins as targets for vaccine development. Emerg. Infect. Dis. 1999, 5, 395–403.
5
References
& 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.proteomics-journal.com
Proteomics 2010, 10, 277–288 [19] Black, R. E., Levine, M. M., Clements, M. L., Hughes, T. P., Blaser, M. J., Experimental Campylobacter jejuni infection in humans. J. Infect. Dis. 1988, 157, 472–479. [20] Krause-Gruszczynska, M., van Alphen, L. B., Oyarzabal, O. A., Alter, T. et al., Expression patterns and role of the CadF protein in Campylobacter jejuni and Campylobacter coli. FEMS Microbiol. Lett. 2007, 274, 9–16. [21] Monteville, M. R., Yoon, J. E., Konkel, M. E., Maximal adherence and invasion of INT 407 cells by Campylobacter jejuni requires the CadF outer-membrane protein and microfilament reorganization. Microbiology 2003, 149, 153–165. [22] Ziprin, R. L., Young, C. R., Stanker, L. H., Hume, M. E., Konkel, M. E., The absence of cecal colonization of chicks by a mutant of Campylobacter jejuni not expressing bacterial fibronectin-binding protein. Avian Dis. 1999, 43, 586–589. [23] Konkel, M. E., Christensen, J. E., Keech, A. M., Monteville, M. R. et al., Identification of a fibronectin-binding domain within the Campylobacter jejuni CadF protein. Mol. Microbiol. 2005, 57, 1022–1035. [24] Bolla, J. M., Loret, E., Zalewski, M., Pages, J. M., Conformational analysis of the Campylobacter jejuni porin. J. Bacteriol. 1995, 177, 4266–4271. [25] Fagerquist, C. K., Amino acid sequence determination of protein biomarkers of Campylobacter upsaliensis and C. helveticus by ‘‘composite’’ sequence proteomic analysis. J. Proteome Res. 2007, 6, 2539–2549. [26] Burnett, T. A., Dinkla, K., Rohde, M., Chhatwal, G. S. et al., P159 is a proteolytically processed, surface adhesin of Mycoplasma hyopneumoniae: defined domains of P159 bind heparin and promote adherence to eukaryote cells. Mol. Microbiol. 2006, 60, 669–686. [27] Djordjevic, S. P., Cordwell, S. J., Djordjevic, M. A., Wilton, J., Minion, F. C., Proteolytic processing of the Mycoplasma hyopneumoniae cilium adhesin. Infect. Immun. 2004, 72, 2791–2802. [28] Jenkins, C., Wilton, J. L., Minion, F. C., Falconer, L. et al., Two domains within the Mycoplasma hyopneumoniae cilium adhesin bind heparin. Infect. Immun. 2006, 74, 481–487. [29] Wilton, J., Jenkins, C., Cordwell, S. J., Falconer, L. et al., Mhp493 (P216) is a proteolytically processed, cilium and heparin binding protein of Mycoplasma hyopneumoniae. Mol. Microbiol. 2009, 71, 566–582. [30] Benz, I., Schmidt, M. A., Diffuse adherence of enteropathogenic Escherichia coli strains--processing of AIDA-I. Zentralbl. Bakteriol. 1993, 278, 197–208. [31] Burnett, T. A., M, A. H., Kuhnert, P., Djordjevic, S. P., Speciating Campylobacter jejuni and Campylobacter coli isolates from poultry and humans using six PCR-based assays. FEMS Microbiol. Lett. 2002, 216, 201–209. [32] Day, C. J., Tiralongo, J., Hartnell, R. D., Logue, C. A. et al., Differential carbohydrate recognition by Campylobacter jejuni strain 11168: influences of temperature and growth conditions. PLoS ONE 2009, 4, e4927.
& 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
287 [33] Nouwens, A. S., Cordwell, S. J., Larsen, M. R., Molloy, M. P. et al., Complementing genomics with proteomics: the membrane subproteome of Pseudomonas aeruginosa PAO1. Electrophoresis 2000, 21, 3797–3809. [34] Cordwell, S. J., Len, A. C., Touma, R. G., Scott, N. E. et al., Identification of membrane-associated proteins from Campylobacter jejuni strains using complementary proteomics technologies. Proteomics 2008, 8, 122–139. [35] Cordwell, S. J., Acquisition and archiving of information for bacterial proteomics: from sample preparation to database. Methods Enzymol. 2002, 358, 207–227. [36] Lutter, P., Meyer, H. E., Langer, M., Witthohn, K. et al., Investigation of charge variants of rViscumin by twodimensional gel electrophoresis and mass spectrometry. Electrophoresis 2001, 22, 2888–2897. [37] Mackun, K., Downard, K. M., Strategy for identifying protein-protein interactions of gel-separated proteins and complexes by mass spectrometry. Anal. Biochem. 2003, 318, 60–70. [38] Luque-Garcia, J. L., Zhou, G., Sun, T. T., Neubert, T. A., Use of nitrocellulose membranes for protein characterization by matrix-assisted laser desorption/ionization mass spectrometry. Anal. Chem. 2006, 78, 5102–5108. [39] Puohiniemi, R., Karvonen, M., Vuopio-Varkila, J., Muotiala, A. et al., A strong antibody response to the periplasmic C-terminal domain of the OmpA protein of Escherichia coli is produced by immunization with purified OmpA or with whole E. coli or Salmonella typhimurium bacteria. Infect. Immun. 1990, 58, 1691–1696. [40] Singh, S. P., Williams, Y. U., Miller, S., Nikaido, H., The C-terminal domain of Salmonella enterica serovar typhimurium OmpA is an immunodominant antigen in mice but appears to be only partially exposed on the bacterial cell surface. Infect. Immun. 2003, 71, 3937–3946. [41] Gilleland, H. E., Jr., Hughes, E. E., Gilleland, L. B., MatthewsGreer, J. M., Staczek, J., Use of synthetic peptides to identify surface-exposed, linear B-cell epitopes within outer membrane protein F of Pseudomonas aeruginosa. Curr. Microbiol. 1995, 31, 279–286. [42] Gilleland, L. B., Gilleland, H. E., Jr., Synthetic peptides representing two protective, linear B-cell epitopes of outer membrane protein F of Pseudomonas aeruginosa elicit whole-cell-reactive antibodies that are functionally pseudomonad specific. Infect. Immun. 1995, 63, 2347–2351. [43] Carrillo, C. D., Taboada, E., Nash, J. H., Lanthier, P. et al., Genome-wide expression analyses of Campylobacter jejuni NCTC11168 reveals coordinate regulation of motility and virulence by flhA. J. Biol. Chem. 2004, 279, 20327–20338. [44] Gaynor, E. C., Cawthraw, S., Manning, G., MacKichan, J. K. et al., The genome-sequenced variant of Campylobacter jejuni NCTC 11168 and the original clonal clinical isolate differ markedly in colonization, gene expression, and virulence-associated phenotypes. J. Bacteriol. 2004, 186, 503–517. [45] Charbonneau, M. E., Berthiaume, F., Mourez, M., Proteolytic processing is not essential for multiple functions of
www.proteomics-journal.com
288
N. E. Scott et al. the Escherichia coli autotransporter adhesin involved in diffuse adherence (AIDA-I). J. Bacteriol. 2006, 188, 8504–8512.
[46] Seal, B. S., Hiett, K. L., Kuntz, R. L., Woolsey, R. et al., Proteomic analyses of a robust versus a poor chicken gastrointestinal colonizing isolate of Campylobacter jejuni. J. Proteome Res. 2007, 6, 4582–4591.
& 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Proteomics 2010, 10, 277–288 [47] Koebnik, R., Proposal for a peptidoglycan-associating alpha-helical motif in the C-terminal regions of some bacterial cell-surface proteins. Mol. Microbiol. 1995, 16, 1269–1270. [48] Wright, H. T., Sequence and structure determinants of the nonenzymatic deamidation of asparagine and glutamine residues in proteins. Protein Eng. 1991, 4, 283–294.
www.proteomics-journal.com
