Math1 controls cerebellar granule cell differentiation by ... - Development

Research article

903

Math1 controls cerebellar granule cell differentiation by regulating multiple components of the Notch signaling pathway Roi Gazit1,*,†, Valery Krizhanovsky1,* and Nissim Ben-Arie1,2,‡ 1Cell and Animal Biology, The Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel 2Roland Center for Neurodegenerative Diseases, The Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem

91904, Israel *These authors contributed equally to the work †Present address: The Lautenberg Center for General and Tumor Immunology, Hadassah Medical School, Jerusalem, Israel ‡Author for correspondence (e-mail: [email protected])

Accepted 12 November 2003 Development 131, 903-913 Published by The Company of Biologists 2004 doi:10.1242/dev.00982

Summary Cerebellar granule cells (CGC) are the most abundant neurons in the mammalian brain, and an important tool for unraveling molecular mechanisms underlying neurogenesis. Math1 is a bHLH transcription activator that is essential for the genesis of CGC. To delineate the effects of Math1 on CGC differentiation, we generated and studied primary cultures of CGC progenitors from Math1/lacZ knockout mice. Rhombic lip precursors appeared properly positioned, expressed CGC-specific markers, and maintained Math1 promoter activity in vivo and in vitro, suggesting that Math1 is not essential for the initial stages of specification or survival of CGC. Moreover, the continuous activity of Math1 promoter in the absence of MATH1, indicated that MATH1 was not necessary for the activation of its own expression. After 6, but not 3, days in culture, Math1 promoter activity was downregulated in control cultures, but not in cells from Math1 null mice, thus implying that Math1 participates in a negative regulatory feedback loop that is dependent on increased levels of MATH1 generated through the positive autoregulatory

feedback loop. In addition, Math1 null CGC did not differentiate properly in culture, and were unable to extend processes. All Notch signaling pathway receptors and ligands tested were expressed in the rhombic lip at embryonic date 14, with highest levels of Notch2 and Jag1. However, Math1-null rhombic lip cells presented conspicuous downregulation of Notch4 and Dll1. Moreover, of the two transcriptional repressors known to antagonize Math1, Hes5 (but not Hes1) was downregulated in Math1null rhombic lip tissue and primary cultures, and was shown to bind MATH1, thus revealing a negative regulatory feedback loop. Taken together, our data demonstrate that CGC differentiation, but not specification, depends on Math1, which acts by regulating the level of multiple components of the Notch signaling pathway.

Introduction

(Edmondson et al., 1988; Fishman and Hatten, 1993; Hatten and Heintz, 1995). The later stages of CGC development – EGL formation and migration towards the IGL – have been extensively studied (reviewed by Goldowitz and Hamre, 1998; Hatten and Heintz, 1995; Millen et al., 1999; Wang and Zoghbi, 2001), in contrast to the earlier stages of precursor specification and differentiation, which are less characterized. Math1 (Atoh1 – Mouse Genome Informatics) encodes a murine basic helix-loop-helix (bHLH) transcription activator (Akazawa et al., 1995; Ben-Arie et al., 1996), orthologous to the Drosophila atonal. In the developing cerebellum, Math1 is expressed in mitotic CGC at the rhombic lip and in the outer EGL (Akazawa et al., 1995; Ben-Arie et al., 1997; Ben-Arie et al., 2000; Ben-Arie et al., 1996; Helms et al., 2000). Genomic disruption has proven that Math1 is essential for proper development of CGC, as Math1 null mice lack the EGL (Ben-Arie et al., 1997; Ben-Arie et al., 2000). However, overexpression of Math1 resulted in cerebellar abnormalities without extra neurogenesis (Helms et al., 2001; Isaka et al.,

The highly ordered cytoarchitecture and the relative simplicity of cerebellar development make it one of the best studied systems for neurogenesis. Most of the cerebellar neurons (e.g. Purkinje cells, deep cerebellar nuclei and interneurons) arise at a ventricular zone located at the edge of the fourth ventricle (Hatten and Heintz, 1995). Precursors of the cerebellar granule cells (CGC) are born in a second proliferative zone, the rhombic lip, where they proliferate and later migrate via a rostral movement over the surface of the embryonic cerebellum (Altman and Bayer, 1997; Gilthorpe et al., 2002; Wingate, 2001). Consequently, these CGC precursors yield the external granule/germinate layer (EGL) of the cerebellum, a displaced germinal zone, where proliferation continues and peaks at postnatal day 7 (P7) in mouse (Altman and Bayer, 1997; Hatten et al., 1997; Hatten and Heintz, 1995). Postmitotic cells congregate in the inner EGL, and then migrate into the cerebellar cortex along Bergman radial glia towards their final destination: the cerebellar internal granule layer (IGL)

Key words: Rhombic lip, Cerebellum, Cerebellar granule cells, Neurite, Notch, Delta, Jagged, Hes, Knockout, Mouse

904

Development 131 (4)

1999), arguing against a proneural role for Math1 in the developing nervous system of the mouse. The Notch signaling pathway is a crucial mechanism for controlling cell specification and differentiation in both invertebrates and vertebrates (Artavanis-Tsakonas et al., 1999; Beatus and Lendahl, 1998; de la Pompa et al., 1997; Frisen and Lendahl, 2001; Gaiano and Fishell, 2002; Justice and Jan, 2002). Notch signaling components, such as the receptors Notch1 and Notch2, the ligands Delta1 (Dll1 – Mouse Genome Informatics), Dll3, Jag1 and Jag2, the DNA-binding protein interactor Cbf1 (Rbpsuh – Mouse Genome Informatics), and the effectors Hes1 and Hes5 were found to be expressed in the EGL of neonatal mice (Irvin et al., 2001; Kusumi et al., 2001; Solecki et al., 2001; Tanaka et al., 1999). Moreover, activation of Notch and overexpression of its effector Hes1, maintained the proliferation of CGC EGL precursors (Solecki et al., 2001). Loss of Notch1 was shown to result in a premature onset of neurogenesis, which resulted in a reduced number of neurons in the adult cerebellum (Lutolf et al., 2002). Similarly, the importance of Hes1 and Hes3 in cerebellar development was identified in knockout mice (Hirata et al., 2001). Links between Notch signaling pathway and Math1 were identified in various tissues. Math1 was shown to be essential for the generation of inner ear hair cells (Bermingham et al., 1999; Chen et al., 2002; Kawamoto et al., 2003; Shou et al., 2003; Zheng and Gao, 2000). Moreover, activation of Notch via Jag2 was shown to inhibit expression of Math1 in cochlear progenitor cells, possibly through the activity of Hes5 (Lanford et al., 2000). Indeed, upregulation of Math1 in Hes1 and Hes5 mutant cochleae suggested that Hes genes regulate hair cell differentiation by antagonizing Math1 expression (Zine and de Ribaupierre, 2002). Notch pathway components were similarly found to be variably expressed in the mouse small intestine (Schroder and Gossler, 2002). Notably, in the small intestine of Math1-null mice, which lack secretory cells, the expression of Dll3 was halved, while Dll1, Hes1, Notch1, Notch2, Notch3 and Notch4 expression was unaffected (Yang et al., 2001). In this study we aimed to deepen our insight into CGC neurogenesis, by taking advantage of Math1-null mice, in which this process is arrested. The development of CGC precursors in Math1-null mice was followed by examination of Math1 promoter activity. Rhombic lip cells were then cultured and analyzed for their survival, specification and differentiation in vitro. Our data show that lack of Math1 did not affect the viability of CGC or their specification. Rather, CGC progenitors were abnormal in their differentiation, as evident molecularly (by the continuous activation of Math1 promoter) and morphologically (by their inability to extend processes in culture). Among all Notch receptors and ligands expressed in the rhombic lip, Notch4 and Dll1 showed the most pronounced downregulation in Math1-null mice. Moreover, by testing two Notch effectors we have discovered that the expression of Hes5, but not Hes1, is Math1 dependent, and that MATH1 can bind directly Hes5, thus demonstrating a novel negative autoregulatory loop of Math1 expression. The feedback mechanism requires an accumulation of MATH1, and therefore provides an explanation for the delayed downregulation of Math1 in cultured cells. Taken together, our data reveal that Math1 controls cerebellar granule cell differentiation as well as its own expression, at least in part, through the Notch signaling pathway.

Research article

Materials and methods Math1 null mice The generation of Math1-null allele mice has been previously described (Ben-Arie et al., 2000). In this line, the entire coding region of Math1 has been removed, and replaced by a pSAβgal/PGK-neo cassette, such that lacZ expression is driven by the endogenous control elements of Math1. As Math1β-gal/β-gal mice are not viable, heterozygous mice were mated to obtain all Math1 genotypes. The morning of vaginal plug appearance was considered as embryonic day (E) 0.5. Experiments were conducted according to an ethical approval from the Hebrew University of Jerusalem, according to the Israeli laws. X-Gal staining Whole embryos or tissue staining was previously described (Ben-Arie et al., 2000). To stain cultured cells the wells were washed twice in PBS, fixed by 0.05% gluteraldehyde in PBS for 5 minutes at room temperature, and washed three times in PBS. Staining was performed at 37°C for about 10 hours, in solution of 1 mg/ml X-Gal, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide and 1 mM MgCl2 in PBS. After postfixation in 4% paraformaldehyde in PBS, cells were counterstained by Nuclear Fast Red (Aldrich) and clarified in 75% Glycerol in PBS. Rhombic lip primary cultures Culturing of cerebellar granule cells is based on a previously described procedure (Alder et al., 1996; Hatten et al., 1998). Briefly, embryos were collected in ice-cold CMF-PBS (Hatten et al., 1998), and the cerebellum isolated under a dissecting microscope by two incisions across the mesencephalon/metencephalon border and across the fourth ventricle. The rhombic lip tissue was pealed off with fine forceps, placed in CMF-PBS and stored on ice. Dissociation was performed by incubation of the tissue in 0.08% Trypsin (Biological Industries, Beit-Haemek, Israel), 0.02% EGTA, 0.05 mg/ml DNaseI (Sigma) in CMF-PBS, for 15 minutes at 37°C; which was then changed to 0.05 mg/ml DNaseI, 0.45% Glucose in ice cold Eagle’s basal medium (BME). The tissue was triturated by passing through a pipettor tip, centrifuged at 700 g at 4°C for 5 minutes, and pellets resuspended in 50 µl granule cell medium (Hatten et al., 1998) supplemented by 5% fetal calf serum and 10% horse serum (Biological Industries, Beit-Haemek, Israel). Cells were diluted to 1200-1300 cell/µl before plating into Terasaki Micro Plate (#100601-3, Robbins, Sunnyvale, CA). Normally, four or five wells were plated from each embryo (22×103 cells/well). Cultures were grown in 95% air/5% CO2 humidified incubator, at 37°C. Half the medium was changed on the next day after plating and every other day thereafter. Quantification of β-galactosidase activity Liquid assay for the lacZ reporter activity was performed using the All-in-One Mammalian β-Galactosidase Assay Kit (Pierce, Rockford, IL). Cultured rhombic lip cells grown in Terasaki plates were washed with PBS, lysed by the addition of 29 µl M-PER (Pierce, Rockford, IL) per well and incubated for 5 minutes. An aliquot of 20 µl was transferred into a 96-well plate, and 180 µl All-in-One reagent added. Reaction was carried out at 37°C for 6 hours and color development was measured every hour at 405 nm. A second aliquot of 8 µl was used for protein quantification; using Protein-Assay Reagent (BioRad, Hercules, CA). Immunohistochemical analysis of primary cultures Cultured cells were fixed by 4% paraformaldehyde in PBS for 15 minutes at room temperature, washed three times with PBS, and blocked by 5% normal goat serum, 2% BSA, 0.1% Triton X-100 in PBS for 1 hour at room temperature. Primary antibodies were diluted in blocking buffer and incubated overnight at 4°C, then for 1 hour at

Math1 and Notch in cerebellar development room temperature. The antibodies used were: mouse anti-β-tubulin (1:10, DSHB, E7), rabbit anti-NF160 (1:100, Sigma, N4142), mouse anti-phosphorylated neurofilaments (1:5, DSHB, RT97) and mouse anti-NCAM (1:5, DSHB, 5B8). Cells were washed four times with 0.1% Triton X-100 in PBS; before the addition of secondary antibodies conjugated to FITC or Biotin (Sigma), and incubated for 2 hours at room temperature, after which they were washed three times with PBS. For Biotin-conjugated antibodies StreptAvidin-TexasRed (Vector Laboratories, Burlingame, CA) was used for visualization. Counterstaining by DAPI was performed before mounting with 1% n-propyl-galate (Sigma) in 90% glycerol. Pictures were taken under an Axioskop2 microscope (Zeiss, Germany), using a DP10 digital camera (Olympus, Germany). Images were assembled using NIH ImageJ software (http://rsb.info.nih.gov/nih-image/index.html). For quantification of processes the cultures were grown for 6 days, fixed, blocked and stained with mouse anti-β-tubulin as above. Then, cells were washed, incubated for 2 hours at room temperature with a secondary antibody conjugated to peroxidase (Jackson ImmunoResearch, West Grove, PA) and washed. The cells were then lysed by CytoBuster (Novagene, Milwaukee, WI) and the content of each two wells combined. A colorimetric reactions was initiated by the addition of 1mg/ml ABTS (2,2′-Azino-bis(3ethylbenzothiazoline-6-sulfonic acid, diammonium salt)), 0.003% H2O2 (Sigma), 28 mM citric acid and 44 mM Na2HPO4. The O.D (405 nm) was measured every 15 minutes to ensure that the values are within the linear range. RT-PCR analysis RNA was extracted as described (Chirgwin et al., 1979). Cultured cells were lysed with 25 µl/well of lysis buffer (4 M guanidine thiocyanate, 25 mM sodium citrate, 17 mM N-laurylsarcosine) for 5 minutes at room temperature and kept at –70°C. After genotyping lysates were thawed and mixed with 1 µl β-mercaptoethanol, 12.5 µl 2M sodium acetate pH 4.0, 125 µl acidic phenol, 25 µl chloroformisoamyl alcohol (49:1). The aqueous phase was extracted twice using chloroform-isoamyl alcohol, precipitated by isopropanol with glycogen as a carrier, washed by 70% ethanol, dried, dissolved in 25 µl water, and DNaseI treated using the DNA-free kit (Ambion, Austin, Texas). Reverse transcription was carried out by RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas MBI, Vilnius, Lithuania). PCR amplifications were performed using FastStart Taq DNA polymerase (Roche, Germany), 0.2 mM dNTPs, 1.5 mM MgCl2 and 1 µM each primer. The thermocycling parameters for Zic1, Zipro1 and β-actin (set A) were: 94°C/4 minutes, 40 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, and 72°C for 3 minutes; and for Hes1, Hes5 and β-actin (set B): 94°C for 4 minutes; 34 cycles of 94°C for 30 seconds, 68°C for 120 seconds and 68°C for 5 minutes. Real-time amplifications were performed on Rotor-Gene machine (Corbett Research, Australia) using 2 mM MgCl2 and ×0.3 SYBR I Green. Thermocycling conditions were 94°C for 4 minutes, then 45 cycles of 96°C for 25 seconds, 60°C for 20 seconds, 72°C for 30 seconds; 72°C for 1 minute. Amplification of a single product was verified by melting curves, and the correct product size by gel separation. For quantification, calibration curves were run simultaneously with experimental samples and Ct calculations were performed by the Rotor-Gene software. The primers used were as follows: Zic1, (F) GGCCAACCCCAAAAAGTC, (R) CGTTAAAATTCGAAGAGAGCG; Zipro1, (F) CCAGACTCCAAAGCGGTTCTGAG, (R) AGTGTCATGGTACCCAAATTG; β-actin (A), (F) TGTTACCAACTGGGACGACA, (R) TGTTACCAACTGGGACGACA; β-actin (B), (F) GTGGGCCGCTCTAGGCACCAA, (R) CTCTTTGATGTCACGCACGATTTC; Hes1, (F) AGCTGGAGAGGCTGCCAAGGTTT, (R) ACATGGAGTCCGAAGTGAGCGAG; Hes5, (F) TTAAGCAAGTGACTTCTGCGAAGTTC, (R) GGCCATGTGGACCTTGAGGT-

905

GAG; Notch1, (F) AGAGATGTGGGATGCAGGAC, (R) CACACAGGGAACTTCACCCT; Notch2, (F) TGTACCAGATCCCAGAGATGC, (R) GTCAGATGCAGAGTGTGGTGA; Notch3, (F) AATCCTGTAGCTGTTCCCCTC, (R) CTGGGCTAGGTGTTGAGTCAG; Notch4, (F) ATCACAGGATGACTGGCCTC, (R) ACTCGTACGTGTCGCTTCCT; Dll1, (F) CTGAGGTGTAAGATGGAAGCG, (R) CAACTGTCCATAGTGCAATGG; Dll3, (F) CACCAGTAGCTGCCTGAACTC, (R) GTTAGAGCCTTGGAAACCAAG; Dll4, (F) CCTCTAGGCAAGAGTTGGTCC, (R) TAGAAAGGCCAGTGCTTCTGA; Jag1, (F) TGACATGGATAAACACCAGCA, (R) GCAGCCCACTGTCTGCTATAC; Jag2, (F) ATTGTAGCAAGGTATGGTGCG, (R) GCACAGTTGTTGTCCAAATGA. Electrophoretic mobility shift assay (EMSA) Full length Math1 and E47 cDNAs were cloned into pGEX-3X and pET28(a) expression vectors, respectively. MATH1/GST and E47/6xHIS fusion proteins were purified from IPTG-induced BL21 bacteria by agarose-Glutathione (Sigma, USA) or Co Talon Affinity Resin (Clontech, USA), respectively. For EMSA, two oligonucleotides CAGGAGCCCTGCCAGGCAGCTGGTGGCATTCTCCA and GTGGAGAATGCCACCAGCTGCCTGGCAGGGCTCCTG were annealed and labeled by Klenow enzyme in the presence of [α-32P]dCTP. A positive control probe was E1 according to (Akazawa et al., 1995). EMSA was carried out as previously described (Ben-Porath et al., 1999).

Results CGC precursors are present in the rhombic lip in Math1β-gal/β-gal mice, but do not proceed to generate the EGL after E14.5 Targeted deletion of Math1 (Math1–/–) or a total replacement of the coding region by a reporter gene (Math1β-gal/β-gal) was shown to cause lack of the EGL at the time of birth (Ben-Arie et al., 1997; Ben-Arie et al., 2000). Here, we further examined Math1β-gal/+ (which displayed a normal phenotype and could serve as controls) and Math1β-gal/β-gal mice by whole-mount XGal staining of the brain. As seen in Fig. 1A-D, by E14.5 CGC precursors occupy the cerebellar rhombic lip, as revealed by Math1/lacZ activity (lacZ expression under Math1 endogenous control elements). Similar staining pattern in Math1β-gal/+ (Fig. 1A,C) and Math1β-gal/β-gal (Fig. 1B,D) indicated that in Math1-null mice CGC precursors were born and reached a state of differentiation that required Math1 expression. At E16.5, Math1β-gal/+ displayed staining all over the surface of the developing cerebellum (Fig. 1E), consistent with the formation of EGL by a rostromedial migration of CGC progenitors from the rhombic lip (Altman and Bayer, 1997; Gilthorpe et al., 2002; Hatten and Heintz, 1995). By contrast, in Math1β-gal/β-gal there were less Math1/lacZ-positive cells at the cerebellar surface, although the rhombic lip continued to include surviving progenitors (Fig. 1F). At both stages, the rhombic lip was smaller in Math1-null embryos when compared with the heterozygous littermate. This was in agreement with the previous histological analysis of sectioned cerebella and proliferation rate measured by BrdU incorporation (Ben-Arie et al., 1997; Ben-Arie et al., 2000) and suggested that CGC progenitors were viable even without Math1 expression. Moreover, examination of the entire brain revealed no ectopic migration in Math1-null mice, excluding such an explanation for the lack of EGL.

906

Development 131 (4)

Fig. 1. Existing rhombic lip precursors fail to form an EGL in Math1β-gal/β-gal cerebellum. Whole-mount X-Gal staining of brains from E14.5 (A-D) and E16.5 (E,F) mice. Expression of a lacZ reporter under the endogenous control of Math1 promoter is seen in the rhombic lip of E14.5 Math1β-gal/+ (Het, A,C) and Math1β-gal/β-gal (Null, B,D). Stained progenitors are seen in both genotypes, although the rhombic lip seems smaller in Math1 null cerebellum. At E16.5, lacZ expression is detected in CGC progenitors migrating over the cerebellar surface to generate the EGL in Math1β-gal/+ (E) but not in a Math1β-gal/β-gal littermate (F). The rhombic lip was dissected out from E14.5 Math1β-gal/+ brain and subjected to X-Gal staining (G). The large proportion of stained cells indicates that the isolated tissue is enriched with CGC progenitors. RT-PCR on the isolated rhombic lip verifies the expression of lacZ, Math1 and Zipro1 (H). + and – indicate the presence and absence of reverse transcriptase, respectively. (A,B,E,F) Dorsal views; (C,D) Lateral views. rl, rhombic lip; IV, fourth ventricle of the brain, EGL, external granule layer. Scale bars: 1 mm.

Math1 null CGC survive normally in primary cultures To investigate the origin of the EGL agenesis in Math1-null mice, we attempted to separate the complex processes they normally undergo in vivo, by examining the CGC progenitors in vitro. In addition, culturing allowed us to follow cells isolated from the rhombic lip, which is a transient structure that disappears during normal embryogenesis. Based on the spatiotemporal expression pattern of Math1/lacZ (Fig. 1), we chose to examine CGC precursors at E14.5, as an advanced stage in which the rhombic

Research article lip progenitors are present in both Math1β-gal/β-gal and Math1β-gal/+, and the abnormal phenotype is only emerging. A typical example of a dissected rhombic lip from Math1β-gal/+ cerebellum, which was subsequently stained by X-Gal, showed that an enriched source of Math1/lacZ-expressing cells could be obtained (Fig. 1G). Isolation of a totally pure CGC population from individual embryos was impractical, but not essential, as similar proportions of Math1/lacZ-negative cells were present in the different cultures compared, regardless of Math1 genotype. As the isolated tissues may contain CGC precursors as well as other cell types, we use the term ‘rhombic lip cells’. Further confirmation for the enrichment of the isolated rhombic lip tissue by CGC was obtained by RT-PCR. Isolated rhombic lips from Math1β-gal/+ expressed lacZ and Math1, as expected (Fig. 1H). An independent verification was provided by the expression of Zipro1 (RU49/Zfp38), a zincfinger transcription factor specifically expressed in CGC from early stages (Yang et al., 1996) (Fig. 1H). We followed the expression of Math1/lacZ over time in cultures obtained from individual embryos of the three Math1 genotypes. No notable differences, such as density of cells or increased number of dead cells, were observed in cultures from controls and Math1β-gal/β-gal (data not shown). Staining for lacZ after 3 days in culture (Fig. 2A-F) revealed no background in cultures from Math1+/+, although most cells from Math1β-gal/+ (Fig. 2B,E) and Math1β-gal/β-gal (Fig. 2C,F) appeared blue. Comparison of cell density, proportion of stained cells and staining intensity did not imply any major difference between Math1 null and control cells at this stage. Moreover, Math1/lacZ expression indicated that CGC precursors lacking Math1 survived after 3 days in vitro and continuously maintained Math1 promoter activity. Hence, it was concluded that Math1 was not essential for the survival of CGC precursors.

Math1 is required for downregulation of its expression As no differences were visible between Math1-null and control cells after 3 days in vitro, we challenged the cells with a longer culturing period (Fig. 2G-L). After 6 days in vitro, Math1/lacZ expression was dramatically decreased in cultures from Math1β-gal/+ (Fig. 2H,K). This observation was consistent with the expression of Math1 in the outer EGL, and its downregulation in differentiating cells at the inner EGL (Helms and Johnson, 1998). Surprisingly, Math1/lacZ activity in Math1β-gal/β-gal was still strong after 6 days in culture (Fig. 2I,L). Thus, Math1 promoter activity remained high in cells derived from Math1β-gal/β-gal, while downregulated in cells from Math1β-gal/+ littermates. To refine this observation, we used a quantitative colorimetric assay for β-galactosidase activity in the cultured cells. After 3 days in culture, Math1/lacZ activity was very similar in Math1β-gal/+ and Math1β-gal/β-gal cultures, much above the background measured in Math1+/+ (Fig. 2M). However, after 6 days in culture a significantly higher level of β-galactosidase activity remained in Math1β-gal/β-gal cells, in contrast to the significant reduction of activity in Math1β-gal/+ cultures (P