Mechanism of the salutary effects of flutamide on intestinal ...

Mechanism of the salutary effects of flutamide on intestinal myeloperoxidase activity following trauma-hemorrhage: up-regulation of estrogen receptor-␤-dependent HO-1 Huang-Ping Yu,*,† Mashkoor A. Choudhry,* Tomoharu Shimizu,* Ya-Ching Hsieh,* Martin G. Schwacha,* Shaolong Yang,* and Irshad H. Chaudry*,1 *Center for Surgical Research and Department of Surgery, University of Alabama at Birmingham; and † Graduate Institute of Clinical Medical Sciences, Chang Gung University, Taoyuan, Taiwan

Abstract: Hemeoxygenase (HO)-1 induction following adverse circulatory conditions is known to be protective, and precastrated males have less intestinal damage than sham-operated males following trauma-hemorrhage (T-H). Previous studies have also shown that administration of flutamide up-regulated estrogen receptor (ER) expression in males following T-H. We hypothesized that flutamide administration in males following T-H up-regulates HO-1 via an ER-dependent pathway and protects against intestinal injury. Male Sprague-Dawley rats underwent T-H [mean blood pressure (MBP) 40 mmHg for 90 min and then resuscitation]. A single dose of flutamide (25 mg/kg body weight), with or without an ER antagonist (ICI 182,780), a HO enzyme inhibitor [chromium-mesoporphyrin (CrMP)], or vehicle, was administered subcutaneously during resuscitation. At 2 h after T-H or sham operation, intestinal myeloperoxidase (MPO) activity, intercellular adhesion molecule (ICAM)-1, cytokineinduced neutrophil chemoattractant (CINC)-1, and CINC-3 levels were measured. Intestinal ER-␣, ER-␤, androgen receptor, and HO-1 mRNA/protein levels were also determined. Results showed that T-H increased intestinal MPO activity, ICAM-1, CINC-1, and CINC-3 levels. These parameters were improved significantly in the flutamide-treated rats subjected to T-H. Flutamide treatment increased intestinal HO-1 and ER-␤ mRNA/protein levels as compared with vehicle-treated T-H rats. Administration of the ER antagonist ICI 182,780 or the HO inhibitor CrMP prevented the flutamide-induced attenuation of shock-induced intestinal damage. Thus, the salutary effects of flutamide administration on attenuation of intestinal injury following T-H are mediated via up-regulation of ER-␤-dependent HO-1 expression. J. Leukoc. Biol. 79: 277–284; 2006. Key Words: chromium-mesoporphyrin ICAM-1 䡠 CINC-1 䡠 CINC-3

䡠

hemorrhagic shock

0741-5400/06/0079-277 © Society for Leukocyte Biology

䡠

INTRODUCTION Previous studies have shown that intestinal injury occurs during hemorrhagic shock and persists despite fluid resuscitation [1]. A large number of studies have demonstrated that the enhanced secretion of proinflammatory cytokines by mast cells, dendritic cells, and macrophages is an important factor in the initiation and perpetuation of intestinal inflammation [2]. These cytokines recruit other immune cells including neutrophils, thereby increasing leukocyte trafficking and intestinal permeability [3, 4]. Neutrophils can release mediators, which diffuse across the endothelium and injure parenchymal cells, or alternatively, neutrophils can leave the microcirculation and migrate to and adhere to matrix proteins or other cells [5, 6]. Intercellular adhesion molecule (ICAM)-1 is known to play a major role in the firm adhesion of neutrophils to the vascular endothelium. ICAM-1 is constitutively present on the surface of endothelial cells and is markedly up-regulated following trauma-hemorrhagic (T-H) shock [7]. In addition to adhesion molecules, chemokines such as cytokine-induced neutrophil chemoattractant (CINC)-1 and CINC-3 and members of the CXC chemokine family are also potent chemotactic factors for neutrophils [8]. The gonadal steroids, androgen and estrogen, play a major role in the regulation of cardiovascular and immune function following T-H [9, 10]. Immune and cardiac functions are depressed in males after T-H [11, 12]. In contrast, these functions are maintained in proestrus females following T-H [13, 14]. Flutamide, a testosterone receptor antagonist, has been shown to be protective following shock-like states in males [15, 16]. Previous studies have also demonstrated that up-regulation of hemeoxygenase (HO)-1 causes a reduction of adhesion molecules and neutrophil chemoattractant [17, 18]. Furthermore, estrogen can reduce neutrophil accumulation in the gut, and this effect is mediated via the estrogen receptor (ER) [19]. In addition to reduction of neutrophil accumulation, estrogen

1 Correspondence: Center for Surgical Research, University of Alabama at Birmingham, 1670 University Boulevard, Volker Hall, Room G094, Birmingham, AL 35294-0019. E-mail: [email protected] Received July 5, 2005; revised August 21, 2005; accepted October 20, 2005; doi: 10.1189/jlb.0705363

Journal of Leukocyte Biology Volume 79, February 2006 277

administration in males following T-H is also known to upregulate HO-1 expression and protects the organs against dysfunction and injury [20]. However, administration of the HO inhibitor chromium-mesoporphyrin (CrMP) prevented the 17␤estradiol-induced attenuation of shock-induced organ dysfunction and damage [20]. Recent findings from our laboratory suggest that the improvement of cardiac function in males treated with flutamide following T-H is a result of up-regulation of ER in cardiomyocytes [21]. Nonetheless, it remains unknown whether administration of flutamide in males following T-H attenuates intestinal injury and if so, whether the salutary effect is through up-regulation of an ER-dependent HO-1 pathway. To determine this, we examined whether flutamide up-regulates intestinal ER expression and if so, whether that is responsible for reducing intestinal injury following T-H via the HO-1 pathway.

MATERIALS AND METHODS Animals Adult male (275–325 g) Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) were used in this study. All experiments were performed in adherence with the National Institutes of Health (NIH; Bethesda, MD) guidelines for the use of experimental animals and approved by the Institutional Animal Care and Use Committee of the University of Alabama at Birmingham.

Experimental procedures We used a nonheparinized model of T-H and resuscitation in the rat, as described previously [20], with minor modifications. Briefly, male SpragueDawley rats were fasted overnight before the experiment but were allowed water ad libitum. The animals were anesthetized using 1.5% isoflurane (Attane, Minrad Inc., Bethlehem, PA) and oxygen inhalation and underwent a 5-cm ventral midline laparotomy to induce soft-tissue trauma before the onset of hemorrhage. The abdomen was then closed in layers, and catheters were placed in femoral arteries and the right femoral vein [polyethylene (PE-50) tubing, Becton Dickinson, Sparks, MD]. The wounds were bathed with 1% lidocaine (Elkins-Sinn, Cherry Hill, NJ) throughout the surgical procedure to minimize postoperative pain. The rats were then allowed to awaken, after which they were rapidly bled to a mean arterial pressure (MAP) of 35– 40 mmHg within 10 min. The time at which the animals could no longer maintain a MAP of 35– 40 mmHg without fluid infusion was defined as maximum bleed-out volume. After that point, MBP was maintained at 40 mmHg by infusing Ringers lactate intravenously in 0.2 mL bolus increments until 40% of the shed blood volume was returned in that form. The sham-operated animals underwent the same surgical procedure but were neither bled nor resuscitated. The time required for maximum bleed-out was ⬃45 min, the volume of maximum bleed-out was ⬃60% of the calculated circulating blood volume [22], and the total hemorrhage time was ⬃90 min. Animals were allocated randomly into four groups receiving: vehicle (propanediol, Sigma Chemical Co., St. Louis, MO) at the middle of resuscitation; flutamide (25 mg/Kg body weight subcutaneously, Sigma Chemical Co.) at the middle of resuscitation; the combination of flutamide (at the middle of resuscitation) and a high-affinity ER antagonist ICI 182,780 [3 mg/Kg body weight intraperitoneally (i.p.), Tocris Cookson Ltd., Ballwin, MO) at the beginning of resuscitation; and the combination of flutamide (at the middle of resuscitation) and a specific HO inhibitor CrMP (2.5 mg/Kg i.p., Frontier Scientific, Logan, UT) at the beginning of resuscitation. Following resuscitation, the catheters were removed, the vessels were ligated, and skin incisions were closed with sutures. The animals were returned to their cages and were allowed food and water ad libitum until sacrifice. The animals were killed at 2 h after the end of resuscitation.

Preparation of intestinal samples Immediately after anesthetizing the rats, the intestine was exposed. After approximately the first 15 cm-long proximal segment of intestine, a 3 cm-long

278

Journal of Leukocyte Biology Volume 79, February 2006

piece of intestine was removed and flushed gently with saline and was snap-frozen in liquid nitrogen.

Measurement of myeloperoxidase (MPO) activity MPO activity in homogenates of whole intestine was determined as described previously [23, 24]. All reagents were purchased from Sigma Chemical Co. Briefly, equal weights (100 mg wet weight) of intestine from various groups were suspended in 1 ml buffer (0.5% hexadecyltrimethylammonium bromide in 50 mM phosphate buffer, pH 6.0) and sonicated at 30 cycles, twice, for 30 s on ice. Homogenates were cleared by centrifuging at 12,000 rpm at 4°C, and the supernatants were stored at – 80°C. Protein content in the samples was determined using the Bio-Rad (Hecules, CA) assay kit. The samples were incubated with a substrate o-dianisidine hydrochloride. This reaction was carried out in a 96-well plate by adding 290 ␮l 50 mM phosphate buffer, 3 ␮l substrate solution (containing 20 mg/ml o-dianisidine hydrochloride), and 3 ␮l H2O2 (20 mM). Sample (10 ␮l) was added to each well to start the reaction. Standard MPO (Sigma Chemical Co.) was used in parallel to determine MPO activity in the sample. The reaction was stopped by adding 3 ␮l sodium azide (30%). Light absorbance at 460 nm was read. MPO activity was determined by using the curve obtained from the standard MPO.

Determination of ICAM-1, CINC-1, and CINC-3 levels Intestinal ICAM-1, CINC-1, and CINC-3 levels were determined using enzyme-linked immunosorbent assay kits (R&D, Minneapolis, MN) according to the manufacturer’s instructions. Briefly, the samples were homogenized in phosphate-buffered saline (1:10 weight:vol; pH 7.4) containing protease inhibitors (Complete Protease Inhibitor Cocktail, Boehringer Mannheim, Germany). The homogenates were centrifuged at 2000 g for 20 min at 4°C, and the supernatant was assayed for ICAM-1, CINC-1, and CINC-3 levels. An aliquot of the supernatant was used to determine protein concentration (Bio-Rad DC protein assay).

Isolation of intestine RNA Intestinal RNA was isolated using a Nucleospin RNA purification kit (BA Bioscience, Palo Alto, CA) following the manufacturer’s instruction. The concentration of RNA was determined by a spectrophotometer (Smart TM 300, Bio-Rad). The isolated RNA was then stored at – 80°C until analyzed.

mRNA expression assay Intestinal androgen receptor (AR), ER-␣, ER-␤, and HO-1 gene expressions were determined by real-time, quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) as described previously [21]. TaqMan RT-PCR reagents and protocols were used for all reactions. AR, ER-␣, ER-␤, and HO-1 primers were purchased from ABI (Applied Biosystems, Foster City, CA), and amplification of cDNA was performed on an ABI PRISM 7900HT sequence detection system. The primer sequences are shown in Table 1. 18s were used for endogenous control. All the samples were amplified for 1 cycle at 50°C for 2 min and at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and at 60°C for 1 min.

Western blot assay Rat intestine tissues were homogenized in a buffer containing 10 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 50 mM NaF, 0.5 mM phenylmethylsulfonyl fluoride, 1 mM sodium vanadate, 1% Triton X-100, 0.5% Nonidet P-40, and 1 ␮g/mL aprotinin. The homogenates were centrifuged at 12,000 g for 15 min at 4°C. An aliquot of the supernatant was used to determined protein concentration (Bio-Rad DC protein assay). Protein aliquots were mixed with 4⫻ sample buffer and were electrophoresed on 4 –12% sodium dodecyl sulfate-polyacrylamide gels (Invitrogen, Carlsbad, CA) and transferred electrophoretically onto nitrocellulose transfer membranes (Invitrogen). The membranes were then incubated with anti-AR (1:200 dilution), anti-ER␣ (1:2000 dilution), and anti-ER␤ (1:500 dilution) in 5% nonfat dry milk or anti-HO-1 (1:10,000) in Tris-buffered saline/Tween buffer (TBST) overnight at 4°C and then washed with TBST. The membranes were later incubated with horseradish peroxidase-conjugated goat anti-rabbit antibody (1:5000 dilution in 5% nonfat dry milk for AR, ER-␣, and ER-␤ and in TBST

http://www.jleukbio.org

TABLE 1.

Primers for Real-Time Quantitative PCR Analyses Primers (5⬘–3⬘)

Gene

Sense

Antisense

AR ER-␣ ER-␤ HO-1

CAACTTGCATGTGGATGACC CTTCTGGAGTGTGCCTGGTT CCTTGAAGGCTCTCGTGTTA GGTGTCCAGGGAAGGCTTTAAG

TGAGAAAGGTGCCTCATCCT CTTCTCCCTGCAGGTTCATC TAGAAGACGCCATCCAAAGG GTGCAGCTCCTCAGGGAAGTAG

for HO-1) for 1.5 h at room temperature and washed with TBST. The blots were immersed for 5 min in Super Signal West Pico detection reagent and then exposed to film. Signals were quantified using ChemiImager 5500 imaging software (Alpha Innotech Corp., San Leandro, CA).

Statistical analysis Results are presented as mean ⫾ SEM (n⫽6 rats/group). The data were analyzed using one-way ANOVA and Tukey’s test, and differences were considered significant at a P value of ⱕ0.05.

RESULTS Effects of flutamide on small intestinal MPO activity Intestinal MPO activity in sham-operated or T-H animals with and without flutamide treatment is shown in Figure 1. In sham-operated rats, flutamide did not alter intestinal MPO activity. T-H resulted in a significant increase in intestinal MPO activity in vehicle-treated animals. Flutamide treatment attenuated the increase in intestinal MPO activity. To determine whether flutamide reduces intestinal injury following T-H via an ER-mediated pathway, a group of animals was administrated with the ER antagonist ICI 182,780 along with flutamide. The results indicate that administration of the ER antagonist ICI 182,780 along with flutamide prevented the flutamide-induced decrease in intestinal MPO activity.

Effect of flutamide on ER-␣, ER-␤, and AR expression in the small intestine To evaluate the role of flutamide in intestinal ER mRNA expression following T-H and sham, T-H rats were treated with vehicle or flutamide. Another group of T-H rats was treated with flutamide and the ER antagonist, ICI 182,780. Neither T-H nor flutamide treatment altered ER-␣ (Fig. 2A) or AR (Fig. 2C) mRNA expression. In contrast, T-H induced a profound decrease in intestinal ER-␤ expression in vehicletreated rats (Fig. 2B). Treatment of the T-H rats with flutamide, however, normalized intestinal ER-␤ expression. This effect of flutamide was abolished by coadministration of flutamide and the ER antagonist ICI 182,780. In addition to mRNA expression, we examined the effect of flutamide on receptor protein levels. There was no significant difference in ER-␣ and AR protein levels in sham or T-H with or without flutamide treatment (Fig. 3, A and C). However, T-H induced a significant decrease in ER-␤ protein expression in vehicle-treated rats (Fig. 3B), which was normalized with flutamide treatment. Coadministration of the ER antagonist ICI 182,780 with flutamide, however, prevented the flutamide-induced increase in ER-␤ in the T-H group.

HO-1 expression in small intestine T-H induced a significant increase in intestinal HO-1 mRNA expression as compared with shams (Fig. 4). Administration of flutamide following T-H induced a further, significant increase in intestinal HO-1 mRNA expression as compared with T-H vehicle-treated rats. The increase in HO-1 mRNA expression induced by flutamide was abolished by administration of ICI 182,780. In addition to mRNA expression, we examined the effect of flutamide on the HO-1 protein level. The results indicated that a T-H-induced increase in HO-1 expression was further elevated by flutamide administration (Fig. 5). However, the increase in HO-1 protein level following T-H by flutamide was prevented by coadministration of ICI 182,780.

HO-1 and intestinal MPO activity Fig. 1. Effects of flutamide on MPO tissue levels in rats at 2 h after sham operation or T-H and resuscitation. Animals were treated with vehicle (Veh), flutamide (FL), or flutamide in combination with ICI 182,780 (FL⫹ICI). Data are shown as mean ⫾ SEM of six rats in each group. *, P ⬍ 0.05, compared with sham group; #, P ⬍ 0.05, compared with T-H⫹Veh; @, P ⬍ 0.05, compared with T-H⫹FL.

To determine the role of HO-1 in a flutamide-induced decrease in intestinal MPO activity in T-H rats, rats were treated with the HO inhibitor CrMP along with flutamide following T-H. The results indicate that administration of CrMP with flutamide prevented the flutamide-induced decrease in intestinal MPO activity (Fig. 6). Yu et al. Effect of flutamide following trauma-hemorrhage

279

Fig. 2. ER-␣ (A), ER-␤ (B), and AR (C) mRNA expression in small intestine from sham-operated rats treated with vehicle or flutamide and from T-H rats treated with vehicle, flutamide, or flutamide in combination with ICI 182,780. Data are shown as mean ⫾ SEM of five rats in each group. *, P ⬍ 0.05, compared with sham group; #, P ⬍ 0.05, compared with T-H⫹Veh; @, P ⬍ 0.05, compared with T-H⫹FL. RQ, Relative quantification.

Small intestinal ICAM-1, CINC-1, and CINC-3 levels T-H significantly increased ICAM-1 expression in the small intestine (Fig. 7A). However, treatment with flutamide prevented the T-H-induced increase in ICAM-1 expression. Moreover, coadministration of the ER antagonist ICI 182,780 or the HO inhibitor CrMP with flutamide prevented the flutamideinduced reduction in ICAM-1 expression in the T-H group. In addition, intestinal CINC-1 and CINC-3 levels increased significantly in vehicle-treated rats following T-H (Fig. 7, B and C). Flutamide administration following T-H prevented the increase in intestinal CINC-1 and CINC-3 levels. Administration of ICI 182,780 or CrMP with flutamide following T-H prevented the flutamide-induced decrease of intestinal CINC-1 and CINC-3 levels. 280


Fig. 3. ER-␣ (A), ER-␤ (B), and AR (C) protein expression in small intestine from sham operation with vehicle or flutamide and from T-H with vehicle, flutamide, or flutamide in combination with ICI 182,780. For equal protein loading, membranes were reprobed for ␤-actin using mouse monoclonal antibody (mAb). The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment are normalized as 1.0. Data are shown as mean ⫾ SEM of five rats in each group. *, P ⬍ 0.05, compared with sham group; #, P ⬍ 0.05, compared with T-H⫹Veh; @, P ⬍ 0.05, compared with T-H⫹FL.


Fig. 4. HO-1 mRNA expression in small intestine from sham-operated rats treated with vehicle or flutamide and from T-H treated with vehicle, flutamide, or flutamide in combination with ICI 182,780. Data are shown as mean ⫾ SEM of five rats in each group. *, P ⬍ 0.05, compared with sham group; #, P ⬍ 0.05, compared with T-H⫹Veh; @, P ⬍ 0.05, compared with T-H⫹FL.

DISCUSSION Our present results indicate that at 2 h following T-H, intestinal MPO activity, ICAM-1, CINC-1, and CINC-3 levels are increased markedly in male rats. Administration of a single dose of flutamide during resuscitation attenuated the increase in those inflammatory markers. Administration of flutamide also prevented the T-H-induced decrease in intestinal ER-␤ expression. In contrast to ER-␤, there was no significant dif-

Fig. 5. HO-1 protein expression in small intestine from sham-operated rats treated with vehicle or flutamide and from T-H rats treated with vehicle, flutamide, or flutamide in combination with ICI 182,780. For equal protein loading, membranes were reprobed for ␤-actin using mouse mAb. The intensity of the bands was analyzed using densitometry and plotted as histograms, as shown in each panel. In each experiment, the densitometric values obtained from rats receiving sham operation with vehicle treatment are normalized as 1.0. Data are shown as mean ⫾ SEM of five rats in each group. *, P ⬍ 0.05, compared with sham group; #, P ⬍ 0.05, compared with T-H⫹Veh; @, P ⬍ 0.05, compared with T-H⫹FL.

Fig. 6. Effects of HO inhibitor on MPO tissue levels in rats after T-H and resuscitation. Animals were treated with vehicle, flutamide, flutamide in combination with ICI 182,780, or flutamide in combination with CrMP. Data are shown as mean ⫾ SEM of six rats in each group. *, P ⬍ 0.05, compared with sham group; #, P ⬍ 0.05, compared with T-H⫹Veh; @, P ⬍ 0.05, compared with T-H⫹FL.

ference in intestinal ER-␣ and AR expression after T-H, with or without flutamide treatment. The marked decrease in ER-␤ expression in the intestine of male rats was surprising, and our study is the first to report that intestinal ER expression decreases following injury. A difference in the magnitude of HO-1 expression in the small intestine of male rats, with or without flutamide treatment following T-H, was also found. Administration of ER antagonist ICI 182,780 or HO inhibitor CrMP, along with flutamide following T-H, prevented the flutamide-induced above effects. These studies collectively suggest that the salutary effects of flutamide appear to be mediated via ER-␤ and the up-regulation of HO-1. The gut is considered a critical organ in the development of the delayed organ dysfunction in patients suffering from traumatic injuries and severe blood loss [25]. Splanchnic hypoperfusion is a characteristic feature in the cardiovascular response to hemorrhagic shock [26] and can cause hypoxia of the intestinal mucosa and subsequent increase in intestinal permeability [27]. Activated leukocytes, by attaching to the vessel wall or by inducing perivascular edema, can reduce circulatory flow [28]. Thus, reduction of neutrophil activation may improve organ blood flow and consequently, organ functions following T-H [29]. Neutrophil movement and migration are mediated by multiple adhesion molecules on the neutrophils and endothelial cell surfaces and chemotactic factors. Among adhesion molecules, ICAM-1 is an important mediator in the firm adhesion of neutrophils to the vascular endothelium and is strongly up-regulated following T-H shock [7]. With regard to chemokines, rat CINC-1 and CINC-3 are members of the interleukin-8 family and are potent chemotactic factors for neutrophils [8]. In this regard, our previous studies indicate that CINC-1 levels correlated with tissue MPO activity, a marker of neutrophil content, following T-H [23]. The present studies are in agreement with our previous studies [23] and indicate that flutamide administration following T-H normalized CINC-1 and CINC-3 levels, and this effect of flutamide was prevented if ICI 182,780 or CrMP were administered along with flutamide. Yu et al. Effect of flutamide following trauma-hemorrhage

281

Fig. 7. Effects of flutamide on intestinal ICAM-1 (A), CINC-1 (B), and CINC-3 (C) levels in rats after sham operation or T-H and resuscitation. Animals were treated with vehicle, flutamide, flutamide in combination with ICI 182,780, or flutamide in combination with CrMP. There were six rats in each group. Data are shown as mean ⫾ SEM of six rats in each group. *, P ⬍ 0.05, compared with sham group; #, P ⬍ 0.05, compared with T-H⫹Veh; @, P ⬍ 0.05, compared with T-H⫹FL.

Our results indicate that there was no difference in the expression of AR in the small intestine of male rats undergoing sham operation or T-H. However, the expression of ER-␤ levels was increased in the small intestine of male rats treated with flutamide following T-H. This finding supports our previous studies, which showed that treatment of male rats with flutamide following T-H up-regulated ER receptors in cardiomyocytes [21]. The present study indicates that flutamide upregulated the expression of ER-␤ levels and thus, contributed to the salutary effect on the small intestine following T-H. Although estrogen levels in males are lower than those in females, estrogen is measurable in males [13]. Thus, it is possible that the prevailing estrogen levels in males interact with the up-regulated ER levels and reduce intestinal injury. Support for this concept comes from our results, which showed that the salutary effects of flutamide on the small intestine were blocked if the ER antagonist ICI 182,780 were administered 282


with flutamide. In this regard, ICI 182,780 binds to ER competitively, and its binding to ER leads to degradation and down-regulation of ER [30]. Multiple changes in ER function following ICI 182,780 administration appear to contribute to the blockade of estrogen action. These include impaired dimerization, increased turnover, and disrupted nuclear localization [31–33]. Although ICI 182,780 is a selective ER antagonist, it is difficult to decipher whether it specifically blocked ER-␣, ER-␤, or both in our studies. Currently, however, there is no ER-␣- or ER-␤-specific antagonist available, and thus, it remains to be determined whether ICI 182,780 blocks the ER-␣, ER-␤, or both of these receptors. Our studies also suggest that the salutary effects of flutamide are mediated via ER-␤-dependent HO-1 up-regulation. A growing body of evidence indicates that HO-1 expression is up-regulated following hemorrhagic shock and that the HO product, carbon monoxide, plays a central role in the preservation of intestinal microcirculation under such conditions [34, 35]. In addition, intestinal induction of HO-1 has been shown not only to improve local mesenteric circulation but also to prevent a distant organ response following hemorrhagic shock [36]. It has also been reported that HO-1 can reduce the expression of adhesion molecules and may therefore also prevent subsequent leukocyte-endothelial cell interactions [17]. Furthermore, it has been reported that another heme degradation product, biliverdin, reduces ICAM-1 expression in the ischemic intestine [37]. Although the net contribution of the individual degradation products to the inhibition of leukocyteendothelial cell interactions was not evaluated, studies have shown the relevance of HO-1 up-regulation and hemorrhageinduced leukocyte activation [38]. In this regard, our recent study has shown that inhibition of HO-1 prevented estrogeninduced improvement in organ function following T-H [20]. Thus, these findings suggest that HO-1 plays an important role in improving organ functions following T-H. HO-1 is up-regulated following various pathophysiological conditions such as ischemia, oxidative stress, and endotoxemia, in which redox stress is induced [39, 40], and its induction appears to play a critical role in protection against the deleterious, pathological effects of low flow states [41, 42]. The functional significance of the involvement of nitric oxide (NO) in the HO-1 induction has been established [43]. Studies also suggest that NO increases HO-1 via the induction of HO-1 transcription and stabilization of HO-1 mRNA [44]. In view of this, it is also possible that there is a common regulation of NO and HO-1, as endothelial NO synthase (eNOS) and HO-1 are compartmentalized and functionally influenced by caveolae [45], the bulb-shaped invaginations of plasma membrane, which are implicated in many cellular processes, including transport functions and signal transduction. Furthermore, caveolins are basic structural and regulatory components of the caveolae. Similar to the way that eNOS and caveolin-1 association in caveolae maintains eNOS in an inactive state, it is likely that caveolin-1 expression results in decreased HO activity [45]. Thus, the potential effect of estradiol via ER to decrease the expression of caveolin-1 suggests a direct link between ER- and HO-1-mediated effects [46]. The finding that treatment of animals with ICI 182,780, which blocks ER, abolished flutamide-induced up-regulation of HO-1 following http://www.jleukbio.org

T-H suggests that administration of flutamide following T-H up-regulates HO-1 via the ER pathway. Our recent studies indicated that administration of flutamide following T-H improved cardiac output and cardiac index in male rats [21]. Previous studies have also shown that reduction of neutrophil accumulation following hemorrhagic shock in the small intestine correlated with the improvement of cardiac function [47]. It is therefore possible that the protective effect of flutamide on intestinal injury following T-H may also be a result of the systemically improved cardiac function by flutamide. Nonetheless, as flutamide administration following T-H up-regulates intestine ER-␤ and HO-1 expression, it is also possible that flutamide may have a direct effect on the intestine. Additional studies are, however, needed to precisely elucidate the mechanism by which flutamide attenuates intestinal injury following T-H. It could be argued that the present study used measurement at a single time-point, i.e., at 2 h after treatment, and thus, it remains unclear whether the salutary effects are sustained for longer periods of time, i.e., 24 h after treatment [11, 14]. In this regard, our previous studies have shown that if the improvement in organ functions by any pharmacological agent were evident early after treatment, then those salutary effects are sustained for prolonged intervals, and they also improve the survival of animals [14]. Thus, although a time-point other than 2 h was not examined in this study, based on our previous studies, it would appear that the salutary effects of flutamide would be evident, even if those effects at another time-point following T-H and resuscitation were measured. It can also be argued that we should have administered CrMP alone in these studies to determine if that, per se, has any adverse effects. In this regard, our recent study has shown that administration of CrMP alone did not produce any deleterious effects, but its administration with estrogen blocked the salutary effects of estrogen on organ functions following T-H [20]. As CrMP administration in itself did not influence organ function in sham or T-H animals [20], administration of CrMP alone was therefore not carried out in this study. Previous studies from our laboratory have shown salutary effects of flutamide in restoring immune functions following T-H [15]. In the present study, flutamide was found to induce a further increase in HO-1 enzyme expression in the small intestine following T-H. This up-regulation in HO-1 was associated with attenuation of intestinal injury under those conditions. Induction of HO-1 is not entirely ER-dependent. Previous studies have shown that HO-1 is also induced following various stressful conditions [39, 40]. In line with these findings, a significant increase in HO-1 expression in vehicletreated T-H rats compared with sham-operated rats was also seen in our study. Furthermore, this initial increase in HO-1 is likely independent of ER, as there was a significant decrease in ER expression in vehicle-treated T-H rats. However, a flutamide-mediated, further increase in HO-1 was found to be dependent on ER, as administration of ICI 182,780 with flutamide blocked the increase in HO-1 as well as the salutary effects of flutamide on intestine. These studies collectively suggest that that the salutary effects of flutamide on intentional integrity are mediated by up-regulation of the HO pathway via ER.

Our results also showed that flutamide can attenuate the increase in intestinal ICAM-1, CINC-1, and CINC-3 levels following T-H, and the beneficial effects were abolished when flutamide was coadministrated with ER antagonist ICI 182,780 or HO inhibitor CrMP following T-H. These studies collectively lead us to conclude that the ER-dependent HO pathway may be a significant effecter mechanism by which flutamide attenuates neutrophil accumulation following T-H shock. In summary, our results indicate that the flutamide upregulates ER-␤-dependent HO-1 expression and attenuates intestinal injury following T-H. Blockade of HO pathways and the associated deterioration of the examined parameters suggest that the reduction of neutrophil accumulation in intestine is mediated via HO. Although the precise mechanism of the salutary effects of flutamide on organ functions and the contribution of HO pathways in reducing organ injuries following T-H remain unclear, our study provides evidence that upregulation of HO-1 via ER-␤ serves as a significant effecter mechanism in the reduction of intestinal injury following T-H. Additional studies using the specific ER-␤ agonist under these conditions will provide further support to this notion.

ACKNOWLEDGMENTS This investigation was supported by NIH Grant R37 GM39519 (I. H. C.). M. G. S. is, in part, supported by NIH Grant K02 AI49960. We express our sincere thanks to Mr. Z. F. Ba for his superb technical assistance during these studies.

REFERENCES 1. Kuebler, J. F., Toth, B., Yokoyama, Y., Bland, K. I., Rue III, L. W., Chaudry, I. H. (2004) ␣1-Acid-glycoprotein protects against traumahemorrhagic shock. J. Surg. Res. 119, 21–28. 2. Fiocchi, C. (1998) Inflammatory bowel disease: etiology and pathogenesis. Gastroenterology 115, 182–205. 3. Vaday, G. G., Franitza, S., Schor, H., Hecht, I., Brill, A., Cahalon, I., Hershkoviz, R., Lider, O. (2001) Combinatorial signals by inflammatory cytokines and chemokines mediate leukocyte interactions with extracellular matrix. J. Leukoc. Biol. 69, 885– 892. 4. Rodriguez, P., Heyman, M., Candalh, C., Blaton, M. A., Bouchaud, C. (1995) Tumor necrosis factor-␣ induces morphological and functional alterations of intestinal HT29 cl.19A cell monolayers. Cytokine 7, 441– 448. 5. Olanders, K., Sun, Z., Borjesson, A., Dib, M., Andersson, E., Lasson, A., Ohlsson, T., Andersson, R. (2002) The effect of intestinal ischemia and reperfusion injury on ICAM-1 expression, endothelial barrier function, neutrophil tissue influx, and protease inhibitor levels in rats. Shock 18, 86 –92. 6. Shimizu, T., Tani, T., Hanasawa, K., Endo, Y., Kodama, M. (2001) The role of bacterial translocation on neutrophil activation during hemorrhagic shock in rats. Shock 16, 59 – 63. 7. Dayal, S. D., Hasko, G., Lu, Q., Xu, D. Z., Caruso, J. M., Sambol, J. T., Deitch, E. A. (2002) Trauma/hemorrhagic shock mesenteric lymph upregulates adhesion molecule expression and IL-6 production in human umbilical vein endothelial cells. Shock 17, 491– 495. 8. Nakagawa, H., Komorita, N., Shibata, F., Ikesue, A., Konishi, K., Fujioka, M., Kato, H. (1994) Identification of cytokine-induced neutrophil chemoattractants (CINC), rat GRO/CINC-2␣ and CINC-2␤, produced by granulation tissue in culture: purification, complete amino acid sequences and characterization. Biochem. J. 301, 545–550. 9. Kher, A., Wang, M., Tsai, B. M., Pitcher, J. M., Greenbaum, E. S., Nagy, R. D., Patel, K. M., Wairiuko, G. M., Markel, T. A., Meldrum, D. R. (2005) Sex differences in the myocardial inflammatory response to acute injury. Shock 23, 1–10.

Yu et al. Effect of flutamide following trauma-hemorrhage

283

10. Olsen, N. J., Kovacs, W. J. (1996) Gonadal steroids and immunity. Endocr. Rev. 17, 369 –384. 11. Chaudry, I. H., Ayala, A., Ertel, W., Stephan, R. N. (1990) Hemorrhage and resuscitation: immunological aspects. Am. J. Physiol. 259, R663– R678. 12. Ayala, A., Ertel, W., Chaudry, I. H. (1996) Trauma induced suppression of antigen presentation and expression of major histocompatibility class II antigen complex in leukocytes. Shock 5, 79 –90. 13. Angele, M. K., Schwacha, M. G., Ayala, A., Chaudry, I. H. (2000) Effect of gender and sex hormones on immune responses following shock. Shock 14, 81–90. 14. Chaudry, I. H., Samy, T. S. A., Schwacha, M. G., Wang, P., Rue III, L. W., Bland, K. I. (2003) Endocrine targets in experimental shock. J. Trauma 54, S118 –S125. 15. Angele, M. K., Wichmann, M. W., Ayala, A., Cioffi, W. G., Chaudry, I. H. (1997) Testosterone receptor blockade after hemorrhage in males. Restoration of the depressed immune functions and improved survival following subsequent sepsis. Arch. Surg. 132, 1207–1214. 16. Samy, T. S. A., Schwacha, M. G., Cioffi, W. G., Bland, K. I., Chaudry, I. H. (2000) Androgen and estrogen receptors in splenic T lymphocytes: effects of flutamide and trauma-hemorrhage. Shock 14, 465– 470. 17. Soares, M. P., Seldon, M. P., Gregoire, I. P., Vassilevskaia, T., Berberat, P. O., Yu, J., Tsui, T. Y., Bach, F. H. (2004) Heme oxygenase-1 modulates the expression of adhesion molecules associated with endothelial cell activation. J. Immunol. 172, 3553–3563. 18. Man, K., Ng, K. T., Lee, T. K., Lo, C. M., Sun, C. K., Li, X. L., Zhao, Y., Ho, J. W., Fan, S. T. (2005) FTY720 attenuates hepatic ischemia-reperfusion injury in normal and cirrhotic livers. Am. J. Transplant. 5, 40 – 49. 19. Harnish, D. C., Albert, L. M., Leathurby, Y., Eckert, A. M., Ciarletta, A., Kasaian, M., Keith Jr., J. C. (2004) Beneficial effects of estrogen treatment in the HLA-B27 transgenic rat model of inflammatory bowel disease. Am. J. Physiol. Gastrointest. Liver Physiol. 286, G118 –G125. 20. Szalay, L., Shimizu, T., Schwacha, M. G., Choudhry, M. A., Rue III, L. W., Bland, K. I., Chaudry, I. H. (2005) Mechanism of the salutary effects of estradiol on organ function following trauma-hemorrhage: upregulation of heme oxygenase. Am. J. Physiol. Heart Circ. Physiol. 289, H92–H98. 21. Yu, H. P., Yang, S., Choudhry, M. A., Hsieh, Y. C., Bland, K. I., Chaudry, I. H. (2005) Mechanism responsible for the salutary effects of flutamide on cardiac performance following trauma-hemorrhagic shock: upregulation of cardiomyocyte estrogen receptors. Surgery 138, 85–92. 22. Wang, P., Ba, Z. F., Lu, M-C., Ayala, A., Harkema, J. M., Chaudry, I. H. (1994) Measurement of circulating blood volume in vivo after traumahemorrhage and hemodilution. Am. J. Physiol. 266, R368 –R374. 23. Toth, B., Schwacha, M. G., Kuebler, J. F., Bland, K. I., Wang, P., Chaudry, I. H. (2003) Gender dimorphism in neutrophil priming and activation following trauma-hemorrhagic shock. Int. J. Mol. Med. 11, 357–364. 24. Rana, S. N., Li, X., Chaudry, I. H., Bland, K. I., Choudhry, M. A. (2005) Inhibition of IL-18 reduces myeloperoxidase activity and prevents edema in intestine following alcohol and burn injury. J. Leukoc. Biol. 77, 719 –728. 25. Moore, F. A. (1999) The role of the gastrointestinal tract in postinjury multiple organ failure. Am. J. Surg. 178, 449 – 453. 26. Peitzman, A. B., Billiar, T. R., Harbrecht, B. G., Kelly, E., Udekwu, A. O., Simmons, R. L. (1995) Hemorrhagic shock. Curr. Probl. Surg. 32, 925– 1002. 27. Fink, M. P. (1991) Gastrointestinal mucosal injury in experimental models of shock, trauma, and sepsis. Crit. Care Med. 19, 627– 641. 28. Granger, D. N., Kubes, P. (1994) The microcirculation and inflammation: modulation of leukocyte-endothelial cell adhesion. J. Leukoc. Biol. 55, 662– 675. 29. Maier, M., Strobele, H., Voges, J., Bauer, C., Marzi, I. (2003) Attenuation of leukocyte adhesion by recombinant TNF-binding protein after hemorrhagic shock in the rat. Shock 19, 457– 461.

284


30. Howell, A., Osborne, C. K., Morris, C., Wakeling, A. E. (2000) ICI 182,780 (FaslodexTM): development of a novel, “pure” antiestrogen. Cancer 89, 817– 825. 31. Parker, M. G. (1993) Action of “pure” antiestrogens in inhibiting estrogen receptor action. Breast Cancer Res. Treat. 26, 131–137. 32. Pink, J. J., Jordan, V. C. (1996) Models of estrogen receptor regulation by estrogens and antiestrogens in breast cancer cell lines. Cancer Res. 56, 2321–2330. 33. Dauvois, S., White, R., Parker, M. G. (1993) The antiestrogen ICI 182,780 disrupts estrogen receptor nucleocytoplasmic shuttling. J. Cell Sci. 106, 1377–1388. 34. Tamion, F., Richard, V., Lacoume, Y., Thuillez, C. (2002) Intestinal preconditioning prevents systemic inflammatory response in hemorrhagic shock. Role of HO-1. Am. J. Physiol. Gastrointest. Liver Physiol. 283, G408 –G414. 35. Tamion, F., Richard, V., Bonmarchand, G., Leroy, J., Lebreton, J. P., Thuillez, C. (2001) Induction of heme-oxygenase-1 prevents the systemic responses to hemorrhagic shock. Am. J. Respir. Crit. Care Med. 164, 1933–1938. 36. Ito, K., Ozasa, H., Kojima, N., Miura, M., Iwa, T., Senoo, H., Horikawa, S. (2003) Pharmacological preconditioning protects lung injury induced by intestinal ischemia/reperfusion in rat. Shock 19, 462– 468. 37. Nakao, A., Otterbein, L. E., Overhaus, M., Sarady, J. K., Tsung, A., Kimizuka, K., Nalesnik, M. A., Kaizu, T., Uchiyama, T., Liu, F., Murase, N., Bauer, A. J., Bach, F. H. (2004) Biliverdin protects the functional integrity of a transplanted syngeneic small bowel. Gastroenterology 127, 595– 606. 38. Moncure, M., Chen, L., Childs, E. W., Smalley, D., Udobi, K. F., Cheung, L. Y. (2003) Heme-oxygenase-1 mRNA expression affects hemorrhagic shock-induced leukocyte adherence. J. Trauma 55, 118 –125. 39. Bauer, I., Rensing, H., Florax, A., Ulrich, C., Pistorius, G., Redl, H., Bauer, M. (2003) Expression pattern and regulation of heme oxygenase1/heat shock protein 32 in human liver cells. Shock 20, 116 –122. 40. Sonin, N. V., Garcia-Pagan, J. C., Nakanishi, K., Zhang, J. X., Clemens, M. G. (1999) Patterns of vasoregulatory gene expression in the liver response to ischemia/reperfusion and endotoxemia. Shock 11, 175–179. 41. Pannen, B. H., Kohler, N., Hole, B., Bauer, M., Clemens, M. G., Geiger, K. K. (1998) Protective role of endogenous carbon monoxide in hepatic microcirculatory dysfunction after hemorrhagic shock in rats. J. Clin. Invest. 102, 1220 –1228. 42. Rensing, H., Bauer, I., Datene, V., Patau, C., Pannen, B. H., Bauer, M. (1999) Differential expression pattern of heme oxygenase-1/heat shock protein 32 and nitric oxide synthase-II and their impact on liver injury in a rat model of hemorrhage and resuscitation. Crit. Care Med. 27, 2766 – 2775. 43. Zuckerbraun, B. S., Billiar, T. R., Otterbein, S. L., Kim, P. K., Liu, F., Choi, A. M., Bach, F. H., Otterbein, L. E. (2003) Carbon monoxide protects against liver failure through nitric oxide-induced heme oxygenase 1. J. Exp. Med. 198, 1707–1716. 44. Hartsfield, C. L., Alam, J., Cook, J. L., Choi, A. M. (1997) Regulation of heme oxygenase-1 gene expression in vascular smooth muscle cells by nitric oxide. Am. J. Physiol. 273, L980 –L988. 45. Kim, H. P., Wang, X., Galbiati, F., Ryter, S. W., Choi, A. M. (2004) Caveolae compartmentalization of heme oxygenase-1 in endothelial cells. FASEB J. 18, 1080 –1089. 46. Woodman, O. L., Missen, M. A., Boujaoude, M. (2004) Daidzein and 17 ␤-estradiol enhance nitric oxide synthase activity associated with an increase in calmodulin and a decrease in caveolin-1. J. Cardiovasc. Pharmacol. 44, 155–163. 47. Szabo, A., Hake, P., Salzman, A. L., Szabo, C. (1999) Beneficial effects of mercaptoethylguanidine, an inhibitor of the inducible isoform of nitric oxide synthase and a scavenger of peroxynitrite, in a porcine model of delayed hemorrhagic shock. Crit. Care Med. 27, 1343–1350.
