TISSUE ENGINEERING: Part A Volume 16, Number 1, 2010 ª Mary Ann Liebert, Inc. DOI: 10.1089=ten.tea.2008.0680
Meniscus Reconstruction Through Coculturing Meniscus Cells with Synovium-Derived Stem Cells on Small Intestine Submucosa—A Pilot Study to Engineer Meniscus Tissue Constructs Yunbing Tan, B.S.,1,2 Yuanyuan Zhang, M.D., Ph.D.,3 and Ming Pei, M.D., Ph.D.1,2
The purpose of this study was to investigate the feasibility of coculturing meniscus cells (MCs) and synoviumderived stem cells (SDSCs) on small intestine submucosa (SIS) to establish an innovative method to engineer in vitro meniscus constructs. About 0.9 million cells (MCs, prelabeled SDSCs [with Vybrant DiI], and a coculture of MCs and prelabeled SDSCs [50:50]) were mixed with fibrin gel and seeded onto freeze-dried SIS discs (5 mm diameter1–2 mm thickness) individually. The tissue constructs were incubated in a serum-free defined medium supplemented with 10 ng=mL transforming growth factor beta-1 and 500 ng=mL insulin-like growth factor I for 1 month. One day after cell seeding, samples for scanning electron microscopy were prepared to evaluate cell attachment on the SIS surface. During incubation, fluorescent microscopy was used to trace cell migration (with 40 ,6-diamidino-2-phenylindole as a counterstain) on SIS scaffold. The tissue constructs were assessed using histology, immunostaining, biochemical analysis, real-time polymerase chain reaction, and compressive modulus. All three groups of cells attached well on SIS. The coculture with SDSCs yielded MC-based tissue constructs with greater cell survival and differentiation into chondrogenic phenotypes, which exhibited higher glycosaminoglycan, collagen II, and Sox 9 but relatively low collagen I, resulting in the concomitant increase in equilibrium modulus. This pilot study demonstrates the advantages of coculturing MCs with SDSCs on SIS for meniscus tissue engineering and regeneration.
matrix scaffold, bioreactor design, and environmental conditions.6 Of them, cell source and matrix scaffold are the two major parameters associated with meniscus regeneration. Meniscus cells (MCs) and mesenchymal stem cells (MSCs) have been proposed as potential cell sources contributing to the healing and remodeling response of the meniscus in vascular and avascular regions.14 MCs, especially in the inner third of the meniscus, are mostly fibrochondrocytes, where 60% of the collagen is type II, and five to six times more glycosaminoglycan (GAG) is present compared with the outer third.15,16 However, the proliferative capacity of fully differentiated adult cells is limited, and long-term in vitro expansion can reduce their functional quality. An MSC is a pluripotent progenitor cell that divides many times and its progeny gives rise to skeletal tissues.17 Recent studies suggest that MSCs may possess unusual immunological properties that may permit allo- and xenotransplantation.18 MSC differentiation requiring more complex cues may be provided by culturing the multipotent cells with more differentiated cells, which guide MSCs toward predetermined differentiation.19 Bone
Introduction
T
he meniscus plays a key role in direct load transmission and in the restraint mechanism of the knee joint. Injury or loss of meniscus can lead to osteoarthritis and irreversible joint damage.1 Treatment options for torn menisci vary according to the region of the lesion. The meniscus is vascularized only in the outer third and lesions occurring in the inner two-thirds rarely heal spontaneously. Partial or total removal of the torn meniscus was a standard therapy in the past. However, because of the change in contact pressure and contact area,2 meniscectomy has been strongly associated with the development of early osteoarthritis.3 Experimental studies using meniscus prostheses have also yielded unsatisfactory results.4 Problems with biocompatibility, wear, and inferior material properties of these prostheses have led investigators to pursue a more biological approach through the creation of a tissue-engineered meniscus.5–13 In tissue engineering techniques, many fundamental biological factors should be addressed, including cell source, 1
Tissue Engineering Laboratory, Department of Orthopaedics, West Virginia University, Morgantown, West Virginia. Mechanical and Aerospace Engineering, West Virginia University, Morgantown, West Virginia. Institute for Regenerative Medicine, Wake Forest University Health Science, Winston-Salem, North Carolina.
2 3
67
68 marrow stem cells, a popular MSC, have been investigated for their ability to contribute to meniscus reconstruction in animal models but the results are mixed.20–23 Compared to the other sources of MSCs, synovium-derived stem cells (SDSCs) have the greatest ability for chondrogenic differentiation, demonstrating the superiority of synovium as a potential source of MSCs for clinical applications in cartilage-like tissue regeneration.24–26 However, to our knowledge, there is no study focusing on using SDSCs as the cell source for meniscus tissue engineering. Multiple researchers are investigating various scaffolds on which to base a tissue-engineered meniscus. Small intestine submucosa (SIS), a decellularized extracellular matrix (ECM) and collagen-based xenogenetic biomaterial, has been shown to induce site-specific remodeling of various connective tissues and to promote a reconstructive healing response.27 Because of the minimal immune response28 and low risk of disease transmission,29 SIS has gained approval for clinical implant in the United States, Europe, and Australia. Recent studies indicated that SIS has been successfully utilized not only as an unseeded form to promote meniscus regeneration7–9,30,31 but also as a seeded scaffold to regenerate tissue constructs, such as bladder,32 cartilage,33 and anterior cruciate ligaments.34 A potential clinical problem with the unseeded technique is that unseeded grafts may be limited to a finite size of regenerated tissue; this problem can be potentially overcome when SIS is used in a cell-seeded form. In this study, we describe our strategic approach to the biological regeneration of the meniscus in which a unique MSC and natural biomaterial were applied in a serum-free chondrogenic medium. Our hypothesis was that meniscus constructs can be engineered in vitro with SDSCs and MCs cocultured on SIS-based scaffolds in a serum-free chondrogenic medium. Scanning electron microscopy (SEM), histology, immunostaining, biochemical analysis, real-time polymerase chain reaction (PCR), and equilibrium modulus were used to assess the engineered tissue constructs in terms of morphology, molecular biology, and functionality. Materials and Methods Cell isolation and culture Random biopsies of the intimal layer of synovial tissue were obtained aseptically from the knees of two 3-month-old pigs and pooled together for the study. After temporary storage in culture medium at 48C, the synovial tissue was finely minced and digested at 378C on an x–y–z shaker (Clay Adams Nutator; BD Biosciences, Bedford, MA) for 30 min in phosphate-buffered saline (PBS) containing 0.1% trypsin (Roche, Indianapolis, IN) and then for 2 h in a 0.1% solution of collagenase P (Roche) in alpha modified Eagle’s medium (aMEM)=10% fetal bovine serum (FBS). The cell suspension was passed through a 70-mm nylon filter, and the cells were collected from the filtrate by centrifugation. Cells were cultured for 4 days in aMEM with 10% FBS and 1PS (100 U=mL penicillin and 100 mg=mL streptomycin). Nonadherent cells were removed by a PBS wash on days 2 and 4, and the remaining adherent cells were used for further study. For negative isolation of SDSCs from primary cultures of adherent synovial cells containing macrophages and fibroblasts,35 cells were detached by trypsinization for 1 min (0.25% trypsin=0.2% ethylenediaminetetraacetic acid), wa-
TAN ET AL. shed, and suspended in PBS=2% FBS (107 cell=mL). The suspension was incubated with 5107=mL Dynabeads M-450 CD14 containing a monoclonal antibody specific for macrophages (Dynal Biotech, Oslo, Norway) for 1 h at 48C on an x–y–z shaker. The conjugated cells and the unbound Dynabeads were collected using the Dynal Magnetic Particle Concentrator (Dynal Biotech), and the depleted supernatant with SDSCs was transferred to a second tube. After expansion in flasks, passage 3 SDSCs were used for this study. For the isolation of MCs, meniscus tissue from pig knee joints was minced and digested sequentially in 0.05% hyaluronidase (Sigma, St. Louis, MO) in PBS for 5 min, 0.2% trypsin (Roche) in PBS for 30 min, followed by 0.2% collagenase II (300 U=mg; Worthington, Freehold, NJ) in PBS overnight on an x–y–z shaker (Clay Adams Nutator). The cell suspension was passed through a 70-mm nylon filter, and the cells were collected from the filtrate by centrifugation. MCs were cultured in high-glucose Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS and 1PS in a 378C, 5% CO2 incubator. Passage 1 MCs were used for this study. Characterization of SDSCs Seventy-five hundred SDSCs were plated in 75-cm2 flasks and cultured in aMEM with 10% FBS and 1PS for 14 days. Cells were harvested at days 0, 3, 7, 10, and 14 to measure DNA amount using Quant-iT PicoGreen dsDNA Assay kit (Invitrogen, Carlsbad, CA). For the colony-forming unit assay, SDSCs were replated at 100 cells=cm2 in six-well plates, incubated for 7 days, and stained with 0.5% crystal violet in methanol for 5 min. Cell surface phenotypes were determined using flow cytometry. Briefly, 0.5106 SDSCs were incubated for 30 min on ice in PBS containing 5% FBS and 1% NaN3 (Sigma), and then for 30 min on ice with appropriately diluted mouse monoclonal antibodies to CD44 (Abcam, Cambridge, MA), CD45 (Abcam), CD90 (BD Pharmingen, San Jose, CA), and CD105 (GeneTex, Irvine, CA) or isotype-matched immunoglobulins (IgGs) (IgG1 and IgG2a [Beckman Coulter, Fullerton, CA]). After washing with cold PBS, SDSCs were incubated with the secondary antibody (fluorescein isothiocyanate–conjugated goat anti-mouse Ig [Abcam]) for 30 min in the dark followed by fixation in 400 mL of 1% paraformaldehyde. Negative control samples received equivalent amounts of isotype-matched preimmune antibodies. The cells were analyzed on a BD dual laser FACSCalibur (BD Biosciences) using the FCS Express 3 software package. To define SDSC multidifferentiation capacity, SDSCs were replated in monolayer until confluence. For adipogenesis, the medium was switched to adipogenic medium consisting of growth medium (low-glucose DMEM, 10% FBS, 100 U=mL penicillin, and 100 mg=mL streptomycin) supplemented with 106 M dexamethasone, 0.5 mM isobutyl-1-methy xanthine, 100 mM indomethacin, and 10 mg=mL insulin for 14 days. Adipogenic differentiation was assessed using Oil Red O. For osteogenesis, the medium was switched to calcification medium consisting of growth medium supplemented with 107 M dexamethasone, 10 mM b-glycerol phosphate, 0.2 mM ascorbate-2-phosphate, and L-glutamine for 14 days. Osteogenic differentiation was assessed using Alizarin Red stain for ECM calcification. For chondrogenesis, 0.3106 SDSCs were placed in a 15-mL polypropylene tube and centrifuged at 500 g
SYNOVIAL STEM CELL INVOLVED MENISCUS RECONSTRUCTION ON SIS for 5 min. After 24 h incubation, the pellets were cultured in chondrogenic medium consisting of high-glucose DMEM, 40 mg=mL proline, 100 nM dexamethasone, 100 U=mL penicillin, 100 mg=mL streptomycin, 0.1 mM ascorbic acid-2phosphate, and 1ITS Premix (BD Biosciences) with the supplementation of 10 ng=mL transforming growth factor beta-1 (TGF-b1; R&D Systems, Minneapolis, MN) for 14 days. The consecutive sections were stained using Safranin O for sulfated GAG (sGAG) and immunostained with monoclonal antibody against collagen II (II-II6B3; DSHB, Iowa City, IA). Labeling of SDSCs Negatively isolated SDSCs were suspended at a density of 1106=mL in a serum-free culture medium and mixed with 5 mL of Vybrant DiI cell labeling solution (1:200; Invitrogen) by gentle pipetting. After incubating for 20 min at 378C, the mixture was centrifuged at 1500 rpm for 5 min. The cells were ready for use after being washed twice using prewarmed medium. Preparation of SIS Intact SIS was prepared according to the method previously described by Badylak et al.36 Briefly, after harvest of porcine ilium, the mesenteric tissue was removed. The mucosa and lamina propria of the lumenal side, as well as the serosal and external muscle layers of the adlumenal side, were mechanically removed by manual stripping. The resultant submucosa was irrigated copiously in distilled water and disinfected with 0.1% peracetic acid solution. The SIS was frozen at 208C overnight in dishes followed by freeze drying for 5 h. The dry SIS sheet was punched into discs with a diameter of 5 mm and sterilized with ethylene oxide. The SIS discs were stored sterile and dry at room temperature before use. Preparation and incubation of cell-hybrid scaffold constructs Sterile SIS discs were immersed in 100% ethanol, 70% ethanol, and then PBS (without Ca2þ and Mg2þ). In a centrifuge tube, 75 mL fibrinogen (100 mg=mL in PBS, from human plasma; Sigma), 69 mL PBS with cells (three groups: MCs alone, coculture of MCs and prelabeled SDSCs [50:50, SM], or prelabeled SDSCs alone), 3 mL thrombin (0.1 U=mL, from human plasma; Sigma), and 3 mL CaCl2 (50 mM) were sequentially added. Then, 10 mL of the cell–gel mixture was pipetted onto an SIS disc in a Petri dish. This procedure resulted in fibrin–SIS composites containing 0.9106 cells=construct. The whole gelling process was completed in 3 min. Then medium was added to cover the constructs. After 1 h, the constructs were transferred into nontissue culture–treated 24well plates in a 378C incubator with 5% CO2, and the medium was replaced with chondrogenic medium supplemented with a differentiative growth factor cocktail (10 ng=mL TGF-b1 and 500 ng=mL insulin-like growth factor I) for 30 days.35 At days 0, 7, and 30, constructs were collected for analysis. SEM Representative constructs (n ¼ 2) at day 2 were primarily fixed for 2 h at room temperature in 2.5% glutaraldehyde (Sigma) in distilled water, washed in distilled water three
69
times for 20 min each time. Secondary fixation was completed in 2% osmium tetroxide (Sigma) in distilled water for 2 h at room temperature, followed by the same wash procedure as after primary fixation. The constructs were then dehydrated consecutively in 25%, 50%, 75%, 95%, and 100% (twice) ethanol for 10 min each, and then in hexamethyldisilazane (HMDS; Sigma) at a ratio of 1:1 with ethanol twice for 1 h each time, in HMDS at a ratio of 1:2 with ethanol overnight, and in HMDS three times for 4 h each time. The constructs were freeze dried for 24 h. Each construct was cut into two halves with gold sputter on both sides. The images were recorded by a scanning electron microscope (Model S 2400; Hitachi, Brisbane, CA). Histochemistry and immunohistochemistry Representative constructs (n ¼ 2) were fixed overnight at 48C in 4% paraformaldehyde (Sigma) in PBS, dehydrated with ethanol, paraffin embedded, and sectioned to 5 mm. Consecutive sections were stained with Safranin O for sGAG and were immunostained with monoclonal antibodies against collagen II (II-II6B3) and collagen I (Sigma). Immunohistochemical sections were deparaffinized, hydrated, and treated with 1% hydrogen peroxide to inhibit endogenous peroxidase. The sections were then incubated for 30 min with 0.2% testicular hyaluronidase (Sigma) in PBS (pH 5) at 378C followed by another 30 min with 1.5% normal horse serum and 30 min at 378C with the primary antibody, then stained using a kit (Vectastain ABC, Burlingame, CA), followed by standardized development in diaminobenzidine (Invitrogen). The sections were counterstained with hematoxylin. Biochemical analysis For biochemical analysis, constructs (n ¼ 3) were digested overnight at 608C with 25 mg=mL papain in PBE buffer (100 mM phosphate and 10 mM ethylenediaminetetraacetic acid, pH 6.5) containing 10 mM cysteine, using 400 mL of enzyme per sample. To quantify cell density, the amount of DNA in the papain digests was measured using the Quant-iT PicoGreen dsDNA assay kit (Invitrogen) with a CytoFluor Series 4000 (Applied Biosystems, Foster City, CA). GAG was measured using dimethylmethylene blue dye and a Spectronic BioMate 3 Spectrophotometer (Thermo Scientific, Milford, MA) with bovine chondroitin sulfate as a standard. TaqMan real-time PCR For studies of gene expression, the total RNA was extracted from constructs (n ¼ 3) using an RNase-free pestle in TRIzol reagent (Invitrogen) and RNeasy Mini Kit (Qiagen, Valencia, CA). Sample mRNAs were quantified, and 1 mg RNA was used for reverse transcription with a High-Capacity cDNA Archive Kit (Applied Biosystems). The primers and probes of porcine chondrogenic genes (collagen I, collagen II, collagen X, aggrecan, and Sox 9) were customized by Applied Biosystems as part of the Custom TaqMan gene expression assays (Table 1). Eukaryotic 18S RNA (Assay ID Hs99999901_s1 ABI) was carried out as the endogenous control gene. Real-time PCR was performed with the iCycler iQ Multi Color RT-PCR Detection System (Bio-Rad Laboratories, Hercules, CA). The cycle parameters were 508C for 2 min, hot start at 958C for 10 min followed by 40 cycles of denaturation at 958C for 15 s,
70
TAN ET AL. Table 1. TaqMan-Customized Porcine Gene Primers and Probes
Gene Aggrecan Col I a 1 Col II a 1 Col X a 1 Sox 9
Primer=probe
Sequence (50 –30 )
Forward Reverse Probe Forward Reverse Probe Forward Reverse Probe Forward Reverse Probe Forward Reverse Probe
GCCACTGTTACCGCCACTT CACTGGCTCTCTGCATCCA CTGACCGGGCGACCTG CCGTGCCCTGCCAGATC CAGTTCTTGATTTCGTCGCAGATC TCGCACAACACATTGC TCCTGGCCTCGTGGGT GGGATCCGGGAGAGCCA CTCCCCTGGGAAACC GGCCCGGCAGGTCATC TGGGATGCCTTTTGGTCCTT TCAGACCTGGTTCCCC TGGCAAGGCTGACCTGAAG GCTCAGCTCGCCGATGT CCCCATCGACTTCCGC
GeneBank accession
PCR product (bp)
X60107
58
AF201723
78
AF201724
65
NM_001005153
80
AF029696
96
PCR, polymerase chain reaction.
and annealing and extension at 608C for 1 min. The cycle threshold (Ct) values for 18S RNA and that of samples were measured and calculated by computer software (PerkinElmer, Wellesley, MA). Relative transcript levels were calculated as w ¼ 2DDCt, in which DDCt ¼ DE DC, DE ¼ Ctexp Ct18S, and DC ¼ Ctct1 Ct18S. Mechanical testing The compressive moduli of constructs (n ¼ 5) were determined in uniaxial stress–relaxation using a stepper motordriven miniature compression device manufactured in-house with a miniature 5-mm DVRT (Microstrain, Burlington, VT) as in our previous study.37 In brief, discs were equilibrated in PBS containing protease inhibitors, placed in a cylindrical confining chamber filled with PBS, mounted in a miniature stepper motor-controlled material test machine, and compressed by a porous stainless steel platen by applying a 5% strain followed by four consecutive stress relaxations, each following a 2% strain step. Data were recorded at a sampling rate of 10 points=s over a time increment of 480 s. Constructs were considered to fully relax during this increment based on a change in stress of less than 0.006 MPa over the final 180 s. The equilibrium modulus was then determined for each sample as the slope of the best linear regression fit (r2 > 0.99) of the measured equilibrium stress versus applied strain. Statistics We used a one-way analysis of variance F-test. Statistical analysis was performed with SPSS 13.0 statistical software (SPSS, Chicago, IL). p-Values less than 0.05 were considered statistically significant. Results Stem-cell properties of SDSCs Passage 3 SDSCs from pig knee joints plated at a low density (100 cells=cm2) formed cell colonies by day 7 (Fig. 1A, B). The cell number increased slowly during the first 3 days, and then dramatically increased between days 3 and 14. The
total cell number increased about 427-fold in the observation period (14 days) (Fig. 1C). SDSCs were also characterized for their surface phenotypes (Fig. 1D). MSC surface markers, CD44, CD90, and CD105, showed positive expression in SDSCs; in contrast, there was no hematopoietic stem-cell marker detectable (CD45) in SDSCs. Adipogenic differentiation of SDSCs was demonstrated by the accumulation of lipid vacuoles [positive for Oil Red O staining (Fig. 1E) vs. nontreated control (Fig. 1F)]. SDSCs incubated with osteogenic medium underwent a change in their morphology from spindle shaped to cuboidal and formed large nodules that positively stained for Alizarin Red (Fig. 1G vs. nontreated control, Fig. 1H). TGF-b1–treated pellets displayed cartilagespecific metachromasia with positive Safranin O staining (Fig. 1I vs. nontreated control, Fig. 1J), which is specific for highly sGAG, a unique biochemical feature of cartilage proteoglycans. The detection of collagen II protein by immunostaining (Fig. 1K vs. nontreated control, Fig. 1L) further confirmed the cartilage phenotype of in vitro generated pellets. Untreated pellets were negatively stained. Cell morphology and attachment on SIS scaffold SEM was used to evaluate the morphology of SIS and adhesion of cells on SIS scaffolds. Figure 2A shows the rough serosal side of SIS, whereas Figure 2C displays the smooth mucosal side of SIS. After saturation with fibrin gel, both sides became more wrinkled (Fig. 2B vs. 2A, Fig. 2D vs. 2C). One day after cells were seeded with fibrin gel on SIS scaffolds, the scaffold profile exhibited several layers after freeze drying (Fig. 2E); high magnification showed that the cells were round and evenly distributed (Fig. 2F), and some cells were distributed in scaffold wrinkles (Fig. 2G) and holes (Fig. 2H). SEM data suggest that SIS, a natural and biocompatible material, can be used as a scaffold with the loaded cell and gel mixture for meniscus tissue engineering. To trace cell migration and distribution on SIS, SDSCs were prelabeled with Vybrant DiI (red color), and 40 ,6-diamidino-2phenylindole was used to counterstain nuclei (blue color) for both SDSCs and MCs. At day 0 after cell seeding, only blue was seen in the MC group (Fig. 3a1), and mixed colors were
SYNOVIAL STEM CELL INVOLVED MENISCUS RECONSTRUCTION ON SIS
71
FIG. 1. Stem-cell properties of synovium-derived stem cells (SDSCs). Multiple (A) and single (B) colony-forming units were shown in SDSCs plated at a low density (stained with crystal violet). Within 14 days of incubation, cell number increased dramatically (C). SDSC surface phenotypes were characterized using flow cytometry (D). SDSCs at confluence were treated with adipogenic medium for 14 days with untreated cells serving as a control [(E) vs. (F) stained with Oil Red O for lipid vacuoles]. SDSCs at confluence were treated with osteogenic medium for 14 days with untreated cells serving as a control [(G) vs. (H) stained with Alizarin Red for calcified nodules]. SDSCs in a pellet culture system were treated with chondrogenic medium for 14 days with untreated pellets serving as a control [(I) vs. (J) stained with Safranin O for sulfated glycosaminoglycan (GAG), and (K) vs. (L) immunostained for collagen II]. Color images available online at www.liebertonline.com=ten.
shown in the SDSC group (Fig. 3b1). In contrast, both the mixed colors and isolated blue were seen in the SM group (Fig. 3c1). The corresponding light microscope images (Fig. 3a2, 3b2, 3c2) showed that the cells and fibrin gel mixture attached on the surface of the SIS scaffold. At day 7 (Fig. 3A1–C1=A2–C2) and day 30 (not shown here), fluorescent images indicated that MCs and SDSCs were still evenly mixed with no detectable separation. Histological and molecular analysis of tissue-engineered meniscus constructs Our histology data suggested that Safranin O–stained sGAG (Fig. 4A–C vs. 4a–c) and immunostained collagen II (Fig. 4A1–C1 vs. 4a1–c1) accumulated with time (day 30 vs.
day 7) in all three groups. At day 30, the SDSC group yielded tissue constructs with more thick and dense expression of GAG (Fig. 4B) and collagen II (Fig. 4B1) and less expression of collagen I (Fig. 4B2) than the other groups; however, the coculture of SDSCs and MCs yielded tissue constructs exhibiting more interspersed GAG (Fig. 4C), collagen II (Fig. 4C1), and collagen I (Fig. 4C2). The above data are also supported by our biochemical analysis. To minimize the discrepancy from cell seeding in the three groups, DNA content was presented by adjusting it with that at day 0. DNA content decreased dramatically in the MC group over time compared to the other groups (Fig. 5A). In the MC group, the adjusted DNA ratio was 49.8 4.2% at day 7 versus 31.9 5.2% at day 30 ( p ¼ 0.0003); in contrast, in the SM group, the adjusted DNA ratio was 59.2 15.4% at
72
TAN ET AL.
FIG. 2. Scanning electron microscopy images of two sides of small intestine submucosa (SIS) scaffolds (serosal side: A=B and mucosal side: C=D) before (A, C) or after saturation with fibrin gel (B, D) and the seeded SDSCs with fibrin gel on SIS scaffolds at day 2 with low magnification (E) and high magnification (F–H).
day 7 versus 53.0 10.6% at day 30 ( p ¼ 0.5201), whereas in the SDSC group, the adjusted DNA ratio was 72.0 11.6% at day 7 versus 77.8 16.6% at day 30 ( p ¼ 0.5534). The data showed that the SDSC group had a stable DNA content at the highest level, indicating that SDSCs were able to maintain cell numbers when cocultured with MCs.
With incubation in chondrogenic medium, all groups exhibited an increase in chondrogenic index (GAG=DNA) over time (Fig. 5B). At days 0 and 7, there was no significant difference in chondrogenic index between the three groups. At day 30, however, the chondrogenic index increased dramatically in the SDSC group compared with that at day 7
SYNOVIAL STEM CELL INVOLVED MENISCUS RECONSTRUCTION ON SIS
73
FIG. 3. About 0.9106 cells from meniscus cells (MCs) alone (A1, a1=A2, a2), SDSCs alone (B1, b1=B2, b2), and SDSC and MC coculture (SM, C1, c1=C2, c2) were mixed with fibrin gel and seeded on SIS scaffolds individually at day 0 (a1–c1=a2–c2) and day 7 (A1–C1=A2–C2). SDSCs were prelabeled with Vybrant DiI (red). All sample sections were counterstained with 40 ,6diamidino-2-phenylindole (blue) for nuclei. (A2–C2=a2–c2) Light microscope images for the corresponding images (A1–C1= a1–c1) with fluorescence. Scale bar: 50 mm. Color images available online at www.liebertonline.com=ten.
(74.70 5.33% vs. 6.50 0.99%); the chondrogenic index in the SDSC group was almost 3.3-fold compared with the SM group and 5.7-fold compared with the MC group. Though the chondrogenic index was the lowest in the MC group, the MCs cocultured with SDSCs exhibited a significantly increased chondrogenic index (22.74 5.33% vs. 13.00 1.39%). Our quantitative real-time PCR data showed that the chondrogenic marker genes, collagen II (Fig. 6A), aggrecan (Fig. 6B), and Sox 9 (Fig. 6C), increased in all groups with time,
particularly after day 7. At day 30, the SDSC group displayed the strongest mRNA, whereas the MC group exhibited the poorest mRNA in terms of chondrogenic marker genes, which was consistent with our biochemistry data (Fig. 5). In the meantime, a gradual decrease occurred in both the MC group and the SM group, whereas an initial increase was followed by a decrease in the SDSC group (Fig. 6D), indicating a typical process of early chondrogenic marker (collagen I) expression seen in MSC-based chondrogenesis.
74
FIG. 4. Safranin O staining (a–c= A–C for sulfated GAG) and immunostaining (a1–c1=A1–C1 for collagen II and a2–c2=A2–C2 for collagen I) were used to evaluate chondrogenic differentiation of MC-based (a, a1, a2, A, A1, A2), SDSC-based (b, b1, b2, B, B1, B2), SM-based (c, c1, c2, C, C1, C2) tissue constructs at day 7 (a–c=a1–c1= a2–c2) and day 30 (A–C=A1–C1= A2–C2). Scale bar: 50 mm. Color images available online at www .liebertonline.com=ten.
TAN ET AL.
SYNOVIAL STEM CELL INVOLVED MENISCUS RECONSTRUCTION ON SIS
DNA amount adjusted by day 0
A
1.2 Day7 Day30
*
1.0
**
0.8
0.6
***
0.4
0.2
0.0 MC
B
SDSC
100
80 Ratio of GAG to DNA
SM
MC SM SDSC
***
60
40
*** 20
0 Day 0
Day 7
Day 30
FIG. 5. Biochemical analysis was used to quantitatively assess cell proliferation (DNA amount) and chondrogenic differentiation (GAG amount). DNA ratio was evaluated by adjusting with DNA amount at day 0 (A). The ratio of GAG to DNA was designated as chondrogenic index (B). Differences between the groups are indicated as follows: *p < 0.05, **p < 0.01, and ***p < 0.001. Data are shown as average standard deviation for n ¼ 3. Mechanical evaluation of tissue-engineered meniscus constructs At day 30, compressive moduli were tested to assess the construct strength from different cell sources (Fig. 7). The MC group exhibited the lowest compressive modulus (15.55 5.78 kPa), whereas the SDSC group displayed the highest value (49.43 17.37 kPa). Consistent with our quantitative biochemical and PCR data, the SM group yielded tissue constructs with an intermediate value (22.80 4.97 kPa), suggesting that the supplementation of SDSCs can enhance the equilibrium moduli of MC constructs. Discussion The goal of this study was to develop in vitro meniscus tissue constructs using a coculture technique with a tissuespecific stem cell on a clinically approved natural biomaterial.
75
Our data showed that MCs, SDSCs, and a coculture of MCs and SDSCs were able to mix with fibrin gel and evenly adhere on SIS, suggesting good biocompatibility between cells and the biomaterial. After the initial drop, the cell number in MC constructs continued to decrease with incubation time; this trend could be reversed when MCs were combined with SDSCs. The addition of SDSCs also could dramatically increase chondrogenic differentiation of MC-based tissue constructs, resulting in a higher equilibrium modulus. Our study indicates that meniscus constructs can be engineered in vitro with SDSCs and MCs cocultured on SIS-based scaffolds in a serum-free chondrogenic medium. As a decellularized ECM,27,36 SIS scaffold is composed of 80% to 90% collagen in the form of oriented fibers, contributing to longitudinal tensile properties, and contains GAGs as well as entrapped growth factors, such as basic fibroblast growth factor, vascular endothelial cell growth factor, and TGF-b.38–40 In this study, our SEM data showed that the seeded cells attached on the surface of SIS well and established a base for their interaction with the scaffold, which potentially allowed the delivery and receiving of signals for cell growth, proliferation, and differentiation. Fluorescence images confirmed the biocompatibility of SIS and implied that SDSCs and MCs were compatible with each other. SIS is also a biodegradable biopolymer. SIS has been reported to be entirely resorbed 3 months after implantation in the bladder of dogs and replaced by deposition of new host ECM through the body’s natural healing process, with successful replacement of the damaged urinary tissue.41 We found that the seeded cells were difficult to be immobilized on the smooth and saturated SIS scaffold. However, after freeze drying and resaturation with PBS, most PBS in SIS can be easily resorbed using sterile gauze while maintaining SIS in a hydrophilic condition. In this study, fibrin gel was applied by mixing with cells, which could be easily absorbed by half-dried SIS. As we know, fibrin is the basic framework on which the repair response of most tissues is initiated. In an in vitro culture system, meniscus fibrochondrocytes have been shown to be capable of extricating themselves from their surrounding matrix and migrating into a purified fibrin clot.42 In vivo studies have also shown the efficacy of an exogenous fibrin clot to support a repair response in the avascular portion of the meniscus.14,22 Therefore, fibrin can be considered a quintessential model for the matrices on which tissue-engineered menisci are created; it provides a deformable scaffold for even cell distribution, migration, and orientation, and the ability to degrade over time.37 One of the limiting factors in the use of fibrin, however, is the fragile nature of this scaffold. Therefore, the combined use with other clinically approved natural biopolymers (such as SIS) will complement the weakness of fibrin gel because of its lack of mechanical strength. Although the SIS preparation method includes processes such as decellularization, sterilization, and lyophilization, this scaffold still retains some active growth factors that can contribute to its biological activity.39,43 As a xenogenic graft, host immunological response should always be of concern. Allman et al. have reported that porcine SIS elicits an immunological response restricted to the Th2 pathway, which is consistent with a remodeling reaction rather than rejection.44 When surgically implanted, this biocompatible and biodegradable scaffold provides strength for the reinforcement of
76 7000 6500 6000 5500 5000 4500 4000 3500 3000
B
MC SM SDSC
90000 80000
Relative Aggrecan mRNA
Relative Col II mRNA
A
TAN ET AL.
250 200 150
MC SM SDSC
70000 60000 50000 40000 30000 20000
100 10000
50
Relative Sox-9 mRNA
C
1600 1500 1400 1300 1200 1100 1000 900 800 700 600 500 400 300 200 100 0
day 0
day 7
0
day 30
day 0
day 7
D
MC SM SDSC
day 30 MC SM SDSC
300000 Relative Col I mRNA
0
250000 200000 150000 100000 50000
day 0
day 7
day 30
0
day 0
day 7
day 30
FIG. 6. TaqMan real-time polymerase chain reaction was used to semiquantitate relative chondrogenic gene expression adjusted by 18S RNA. (A) Collagen II mRNA, (B) aggrecan mRNA, (C) Sox 9 mRNA, and (D) collagen I mRNA. All data shown were typical of those obtained from three independent experiments.
Equilibrium modulus (Kpa) at day 30
80
* *
60
40
20
0
MC
SM
SDSC
FIG. 7. Equilibrium modulus was measured to evaluate compressive tension for tissue constructs from different groups after a 30-day incubation. Differences between the groups are indicated as follows: *p < 0.05. Data are shown as average standard deviation for n ¼ 5.
damaged or weakened soft tissues and constitutes an alternative to autograft or allograft. SIS promotes cell proliferation= differentiation and induces the synthesis of a new tissue structurally and functionally similar to the original damaged tissue.45 Like articular cartilage, the inner third of the meniscus is under a predominantly compressive load and has poor healing potential. In addition, the repair (meniscus) tissue was reported to be a cartilage-like tissue.14,46,47 Further, chondrocytes have been successfully used as a cell source to engineer tissue constructs for the repair of a bucket-handle tear and longitudinal–horizontal lesion (avascular portion) of menisci.48,49 Some recent reports indicated that articular chondrocytes can be cocultured with meniscal fibrochondrocytes to engineer a functional meniscal construct,50,51 because the articular chondrocytes reside in a predominantly compressive tissue while the meniscal fibrochondrocytes function primarily in a tensile environment.52 Although meniscus and cartilage are two different tissues, the detailed knowledge already available for articular cartilage metabolism might be very helpful to develop future protocols for engineering avascular meniscus tissue. MSCs from bone marrow appear to have a high propensity for cartilage hypertrophy and bone formation,53,54 and therefore may not be
SYNOVIAL STEM CELL INVOLVED MENISCUS RECONSTRUCTION ON SIS ideal chondroprogenitors for the repair of meniscus. SDSCs are a promising stem cell for cartilage tissue engineering because they display greater chondrogenic and less osteogenic potential than MSCs derived from bone marrow or periosteum.55 They were also proven to be superior to other sources of MSCs such as adipose tissue and muscle.24–26 Further, meniscus defect regeneration has been shown to mediate through the migration, proliferation, and differentiation of fibroblasts that originates, presumably, from the adjacent synovium and joint capsule.31,46,56–58 In this study, the coculture of MCs and SDSCs was evaluated for chondrogenic differentiation capacity in a serum-free chondrogenic medium. Our data suggested that during the first 7 days of incubation, cell number decreased in each group with the MC group decreasing the most and the SDSC group decreasing the least. This may be because of the change in culture conditions from serum-containing to serum-free medium, in which serum deprivation would result in cell apoptosis.59 In addition, monolayer culture favors cell proliferation, whereas three-dimensional culture benefits cell differentiation.60 During days 7 and 30, cell numbers continued to decrease in the MC group; in contrast, the cell number started to increase in the SDSC group though there was no statistically significant difference, suggesting that SDSCs are more receptive to stimulation by TGF-b1 in maintaining and increasing cell number in pellets compared with MCs. Cell numbers in the SM group remained stable. Our data indicate that the coculture with SDSCs contributes to the maintenance of cell number in MC-based tissue constructs. In terms of chondrogenic differentiation, our histology data showed that during the first 7 days, collagen I (early chondrogenic marker though collagen I is also a key structural protein in meniscus) was detectable, whereas collagen II and aggrecan expression (chondrogenic markers) were very weak, which is consistent with our biochemical data (ratio of GAG to DNA) and real-time PCR data. At day 30, there was an intense expression of sGAG and collagen II in each group. Newly formed tissue invaded the SIS biomaterial, especially in the cocultured cell-based tissue constructs, indicating good biocompatibility. SDSC-based tissue constructs displayed the highest chondrogenic ability not only at the protein level but also at the mRNA level. Compared with the continuous decrease in other groups, collagen I mRNA initially increased followed by a decrease in the SDSC group, reflecting the typical expression profile of early chondrogenic phenotype in MSC-based chondrogenesis. The biomechanical properties of tissue constructs parallel their biochemical and molecular composition. Since this study focused on engineering a construct for the repair of the inner two-thirds (white zone) of the meniscus where stress is predominantly compressive instead of tensile, our compressive testing showed that SDSC-based tissue constructs exhibited the highest equilibrium modulus, which is about twofold compared with coculture-based tissue constructs ( p ¼ 0.03) and threefold compared with MC-based tissue constructs ( p ¼ 0.01). SDSCbased tissue constructs exhibited cartilage-like tissue with more GAG and collagen II as well as higher compressive stress. Since our goal was to engineer a meniscus construct, the existence of MCs in a coculture format would help direct SDSC differentiation into meniscus tissue more accurately, based on the principle of interaction between adult cells and pluripotent cells.61
77
Taken together, our pilot study showed that coculture of SDSCs with MCs on SIS is a promising approach to reconstruct meniscus tissue in vitro, though the degradation kinematics of SIS and communication between SIS and cells are not yet fully understood. Acknowledgments The authors thank Suzanne Smith for editing the manuscript and Vincent L. Kish, Fan He, and Song Chen for their generous assistance. This project was supported by the AO Research Fund (S-07-32P) of the AO Foundation. Disclosure Statement No competing financial interests exist. References 1. Cook, J.L. The current status of treatment for large meniscal defects. Clin Orthop Relat Res 435, 88, 2005. 2. Ahmed, A.M., and Burke, D.L. In-vitro measurement of static pressure distribution in synovial joints—part I: tibial surface of the knee. J Biomech Eng 105, 216, 1983. 3. Aagaard, H., and Verdonk, R. Function of the normal meniscus and consequences of meniscal resection. Scand J Med Sci Sports 9, 134, 1999. 4. de Groot, J.H., de Vrijer, R., Pennings, A.J., Klompmaker, J., Veth, R.P., and Jansen, H.W. Use of porous polyurethanes for meniscal reconstruction and meniscal prostheses. Biomaterials 17, 163, 1996. 5. Angele, P., Johnstone, B., Kujat, R., Zellner, J., Nerlich, M., Goldberg, V., and Yoo, J. Stem cell based tissue engineering for meniscus repair. J Biomed Mater Res A 85, 445, 2008. 6. Arnoczky, S.P. Building a meniscus. Biologic considerations. Clin Orthop Relat Res 367 Suppl, S244, 1999. 7. Cook, J.L., Tomlinson, J.L., Arnoczky, S.P., Fox, D.B., Reeves Cook, C., and Kreeger, J.M. Kinetic study of the replacement of porcine small intestinal submucosa grafts and the regeneration of meniscal-like tissue in large avascular meniscal defects in dogs. Tissue Eng 7, 321, 2001. 8. Cook, J.L., Tomlinson, J.L., Kreeger, J.M., and Cook, C.R. Induction of meniscal regeneration in dogs using a novel biomaterial. Am J Sports Med 27, 658, 1999. 9. Gastel, J.A., Muirhead, W.R., Lifrak, J.T., Fadale, P.D., Hulstyn, M.J., and Labrador, D.P. Meniscal tissue regeneration using a collagenous biomaterial derived from porcine small intestine submucosa. Arthroscopy 17, 151, 2001. 10. Hoben, G.M., and Athanasiou, K.A. Meniscal repair with fibrocartilage engineering. Sports Med Arthrosc 14, 129, 2006. 11. Kon, E., Chiari, C., Marcacci, M., Delcogliano, M., Salter, D.M., Martin, I., Ambrosio, L., Fini, M., Tschon, M., Tognana, E., Plasenzotti, R., and Nehrer, S. Tissue engineering for total meniscal substitution: animal study in sheep model. Tissue Eng Part A 14, 1067, 2008. 12. Schoenfeld, A.J., Landis, W.J., and Kay, D.B. Tissueengineered meniscal constructs. Am J Orthop 36, 614, 2007. 13. Stone, K.R., Steadman, J.R., Rodkey, W.G., and Li, S.T. Regeneration of meniscal cartilage with use of a collagen scaffold. Analysis of preliminary data. J Bone Joint Surg Am 79, 1770, 1997. 14. Arnoczky, S.P., Warren, R.F., and Spivak, J.M. Meniscal repair using an exogenous fibrin clot. An experimental study in dogs. J Bone Joint Surg Am 70, 1209, 1988.
78 15. Cheung, H.S. Distribution of type I, II, III and V in the pepsin solubilized collagens in bovine menisci. Connect Tissue Res 16, 343, 1987. 16. Nakano, T., Dodd, C.M., and Scott, P.G. Glycosaminoglycans and proteoglycans from different zones of the porcine knee meniscus. J Orthop Res 15, 213, 1997. 17. Caplan, A.I. Mesenchymal stem cells. J Orthop Res 9, 641, 1991. 18. Liechty, K.W., MacKenzie, T.C., Shaaban, A.F., Radu, A., Moseley, A.M., Deans, R., Marshak, D.R., and Flake, A.W. Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation in sheep. Nat Med 6, 1282, 2000. 19. Alsberg, E., Anderson, K.W., Albeiruti, A., Rowley, J.A., and Mooney, D.J. Engineering growing tissues. Proc Natl Acad Sci USA 99, 12025, 2002. 20. Izuta, Y., Ochi, M., Adachi, N., Deie, M., Yamasaki, T., and Shinomiya, R. Meniscal repair using bone marrow-derived mesenchymal stem cells: experimental study using green fluorescent protein transgenic rats. Knee 12, 217, 2005. 21. Murphy, J.M., Fink, D.J., Hunziker, E.B., and Barry, F.P. Stem cell therapy in a caprine model of osteoarthritis. Arthritis Rheum 48, 3464, 2003. 22. Port, J., Jackson, D.W., Lee, T.Q., and Simon, T.M. Meniscal repair supplemented with exogenous fibrin clot and autogenous cultured marrow cells in the goat model. Am J Sports Med 24, 547, 1996. 23. Yamasaki, T., Deie, M., Shinomiya, R., Izuta, Y., Yasunaga, Y., Yanada, S., Sharman, P., and Ochi, M. Meniscal regeneration using tissue engineering with a scaffold derived from a rat meniscus and mesenchymal stromal cells derived from rat bone marrow. J Biomed Mater Res A 75, 23, 2005. 24. Mochizuki, T., Muneta, T., Sakaguchi, Y., Nimura, A., Yokoyama, A., Koga, H., and Sekiya, I. Higher chondrogenic potential of fibrous synovium- and adipose synoviumderived cells compared with subcutaneous fat-derived cells: distinguishing properties of mesenchymal stem cells in humans. Arthritis Rheum 54, 843, 2006. 25. Sakaguchi, Y., Sekiya, I., Yagishita, K., and Muneta, T. Comparison of human stem cells derived from various mesenchymal tissues: superiority of synovium as a cell source. Arthritis Rheum 52, 2521, 2005. 26. Yoshimura, H., Muneta, T., Nimura, A., Yokoyama, A., Koga, H., and Sekiya, I. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell Tissue Res 327, 449, 2007. 27. Badylak, S.F., Tullius, R., Kokini, K., Shelbourne, K.D., Klootwyk, T., Voytik, S.L., Kraine, M.R., and Simmons, C. The use of xenogeneic small intestinal submucosa as a biomaterial for Achilles tendon repair in a dog model. J Biomed Mater Res 29, 977, 1995. 28. Palmer, E.M., Beilfuss, B.A., Nagai, T., Semnani, R.T., Badylak, S.F., and van Seventer, G.A. Human helper T cell activation and differentiation is suppressed by porcine small intestinal submucosa. Tissue Eng 8, 893, 2002. 29. Suckow, M.A., Voytik-Harbin, S.L., Terril, L.A., and Badylak, S.F. Enhanced bone regeneration using porcine small intestinal submucosa. J Invest Surg 12, 277, 1999. 30. Cook, J.L., Fox, D.B., Malaviya, P., Tomlinson, J.L., Kuroki, K., Cook, C.R., and Kladakis, S. Long-term outcome for large meniscal defects treated with small intestinal submucosa in a dog model. Am J Sports Med 34, 32, 2006. 31. Fox, D.B., Cook, J.L., Arnoczky, S.P., Tomlinson, J.L., Kuroki, K., Kreeger, J.M., and Malaviya, P. Fibrochondrogenesis
TAN ET AL.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
of free intraarticular small intestinal submucosa scaffolds. Tissue Eng 10, 129, 2004. Zhang, Y., Kropp, B.P., Lin, H.K., Cowan, R., and Cheng, E.Y. Bladder regeneration with cell-seeded small intestinal submucosa. Tissue Eng 10, 181, 2004. Beatty, M.W., Ojha, A.K., Cook, J.L., Alberts, L.R., Mahanna, G.K., Iwasaki, L.R., and Nickel, J.C. Small intestinal submucosa versus salt-extracted polyglycolic acid-poly-L-lactic acid: a comparison of neocartilage formed in two scaffold materials. Tissue Eng 8, 955, 2002. Brune, T., Borel, A., Gilbert, T.W., Franceschi, J.P., Badylak, S.F., and Sommer, P. In vitro comparison of human fibroblasts from intact and ruptured ACL for use in tissue engineering. Eur Cell Mater 14, 78, 2007. Pei, M., He, F., and Vunjak-Novakovic, G. Synoviumderived stem cell-based chondrogenesis. Differentiation 76, 1044, 2008. Badylak, S.F., Lantz, G.C., Coffey, A., and Geddes, L.A. Small intestinal submucosa as a large diameter vascular graft in the dog. J Surg Res 47, 74, 1989. Pei, M., He, F., Kish, V.L., and Vunjak-Novakovic, G. Engineering of functional cartilage tissue using stem cells from synovial lining: a preliminary study. Clin Orthop Relat Res 466, 1880, 2008. Hodde, J.P., Record, R.D., Liang, H.A., and Badylak, S.F. Vascular endothelial growth factor in porcine-derived extracellular matrix. Endothelium 8, 11, 2001. McDevitt, C.A., Wildey, G.M., and Cutrone, R.M. Transforming growth factor-beta1 in a sterilized tissue derived from the pig small intestine submucosa. J Biomed Mater Res A 67, 637, 2003. Voytik-Harbin, S.L., Brightman, A.O., Kraine, M.R., Waisner, B., and Badylak, S.F. Identification of extractable growth factors from small intestinal submucosa. J Cell Biochem 67, 478, 1997. Record, R.D., Hillegonds, D., Simmons, C., Tullius, R., Rickey, F.A., Elmore, D., and Badylak, S.F. In vivo degradation of 14C-labeled small intestinal submucosa (SIS) when used for urinary bladder repair. Biomaterials 22, 2653, 2001. Webber, R.J., York, J.L., Vanderschilden, J.L., and Hough, A.J., Jr. An organ culture model for assaying wound repair of the fibrocartilaginous knee joint meniscus. Am J Sports Med 17, 393, 1989. Hodde, J., Janis, A., and Hiles, M. Effects of sterilization on an extracellular matrix scaffold: part II. Bioactivity and matrix interaction. J Mater Sci Mater Med 18, 545, 2007. Allman, A.J., McPherson, T.B., Badylak, S.F., Merrill, L.C., Kallakury, B., Sheehan, C., Raeder, R.H., and Metzger, D.W. Xenogeneic extracellular matrix grafts elicit a TH2-restricted immune response. Transplantation 71, 1631, 2001. Badylak, S., Kokini, K., Tullius, B., Simmons-Byrd, A., and Morff, R. Morphologic study of small intestinal submucosa as a body wall repair device. J Surg Res 103, 190, 2002. Ghadially, F.N., Wedge, J.H., and Lalonde, J.M. Experimental methods of repairing injured menisci. J Bone Joint Surg Br 68, 106, 1986. Takeuchi, N., Suzuki, Y., Sagehashi, Y., Yamaguchi, T., Itoh, H., and Iwata, H. Histologic examination of meniscal repair in rabbits. Clin Orthop Relat Res 338, 253, 1997. Peretti, G.M., Caruso, E.M., Randolph, M.A., and Zaleske, D.J. Meniscal repair using engineered tissue. J Orthop Res 19, 278, 2001.
SYNOVIAL STEM CELL INVOLVED MENISCUS RECONSTRUCTION ON SIS 49. Peretti, G.M., Gill, T.J., Xu, J.W., Randolph, M.A., Morse, K.R., and Zaleske, D.J. Cell-based therapy for meniscal repair: a large animal study. Am J Sports Med 32, 146, 2004. 50. Aufderheide, A.C., and Athanasiou, K.A. Assessment of a bovine co-culture, scaffold-free method for growing meniscusshaped constructs. Tissue Eng 13, 2195, 2007. 51. Hoben, G.M., Hu, J.C., James, R.A., and Athanasiou, K.A. Self-assembly of fibrochondrocytes and chondrocytes for tissue engineering of the knee meniscus. Tissue Eng 13, 939, 2007. 52. Sweigart, M.A., and Athanasiou, K.A. Toward tissue engineering of the knee meniscus. Tissue Eng 7, 111, 2001. 53. Muraglia, A., Cancedda, R., and Quarto, R. Clonal mesenchymal progenitors from human bone marrow differentiate in vitro according to a hierarchical model. J Cell Sci 113, 1161, 2000. 54. Pelttari, K., Winter, A., Steck, E., Goetzke, K., Hennig, T., Ochs, B.G., Aigner, T., and Richter, W. Premature induction of hypertrophy during in vitro chondrogenesis of human mesenchymal stem cells correlates with calcification and vascular invasion after ectopic transplantation in SCID mice. Arthritis Rheum 54, 3254, 2006. 55. de Bari, C., Dell’Accio, F., Karystinou, A., Guillot, P.V., Fisk, N.M., Jones, E.A., McGonagle, D., Khan, I.M., Archer, C.W., Mitsiadis, T.A., Donaldson, A.N., Luyten, F.P., and Pitzalis, C. A biomarker-based mathematical model to predict boneforming potency of human synovial and periosteal mesenchymal stem cells. Arthritis Rheum 58, 240, 2008. 56. Arnoczky, S.P., and Warren, R.F. The microvasculature of the meniscus and its response to injury. An experimental study in the dog. Am J Sports Med 11, 131, 1983. 57. Ghosh, P., Sutherland, J., Bellenger, C., Read, R., and Darvodelsky, A. The influence of weight-bearing exercise
58.
59.
60.
61.
79
on articular cartilage of meniscectomized joints. An experimental study in sheep. Clin Orthop Relat Res 252, 101, 1990. Klompmaker, J., Veth, R.P., Jansen, H.W., Nielsen, H.K., de Groot, J.H., Pennings, A.J., and Kuijer, R. Meniscal repair by fibrocartilage in the dog: characterization of the repair tissue and the role of vascularity. Biomaterials 17, 1685, 1996. Tung, P.S., and Fritz, I.B. Transforming growth factor-beta and platelet-derived growth factor synergistically stimulate contraction by testicular peritubular cells in culture in serumfree medium. J Cell Physiol 146, 386, 1991. Lin, Y.J., Yen, C.N., Hu, Y.C., Wu, Y.C., Liao, C.J., and Chu, I.M. Chondrocytes culture in three-dimensional porous alginate scaffolds enhanced cell proliferation, matrix synthesis and gene expression. J Biomed Mater Res A 88, 23, 2009. Hendriks, J., Riesle, J., and van Blitterswijk, C.A. Co-culture in cartilage tissue engineering. J Tissue Eng Regen Med 1, 170, 2007.
Address correspondence to: Ming Pei, M.D., Ph.D. Tissue Engineering Laboratory Department of Orthopaedics West Virginia University P.O. Box 9196 Morgantown, WV 26506-9196 E-mail:
[email protected] Received: December 16, 2008 Accepted: July 20, 2009 Online Publication Date: October 30, 2009
