Metabolic Adaptations in Skeletal Muscle during Lactation ...

0013-7227/04/$15.00/0 Printed in U.S.A.

Endocrinology 145(11):5344 –5354 Copyright © 2004 by The Endocrine Society doi: 10.1210/en.2004-0721

Metabolic Adaptations in Skeletal Muscle during Lactation: Complementary Deoxyribonucleic Acid Microarray and Real-Time Polymerase Chain Reaction Analysis of Gene Expression XIAO QIU XIAO, KEVIN L. GROVE,

AND

M. SUSAN SMITH

Division of Neuroscience, Oregon National Primate Research Center (X.Q.X., K.L.G., M.S.S.), Department of Physiology and Pharmacology (M.S.S.), Oregon Health & Science University, Beaverton, Oregon 97006 Lactation and fasting are two physiological models characterized by negative energy balance. Our previous studies demonstrated that uncoupling protein (UCP) 3 expression in skeletal muscle was down-regulated during lactation and up-regulated during fasting. The present studies used cDNA microarray and real-time PCR to perform a systems and comparative analysis in gene expression in skeletal muscle under conditions of negative energy balance. Gastrocnemius skeletal muscle RNA pools were generated from the following groups of rats: cycling diestrous females, cycling females with 48 h of fasting, lactation, and lactation ⴙ leptin. Of those known genes studied, 35 genes were up-regulated and 49 were down-regulated during lactation. Leptin treatment during lactation reversed the differential regulation of about 80% of these genes, demonstrating the importance of the leptin suppression to the changes in skeletal muscle metabolism.

L

ACTATION AND FASTING are two models characterized by negative energy balance resulting from a large energy drain due to milk production (lactation) or a dramatic reduction in energy intake (fasting) (1, 2). Lactation is a physiological state associated with significant metabolic adaptations and changes in energy balance. A major increase in energy demand, along with a decrease in adaptive thermogenesis, occurs during lactation (1, 3). This adaptation has been considered as an energy-sparing mechanism to facilitate the availability of energy for milk production. Our previous studies have demonstrated both similarities and differences between lactation and fasting in the regulation of expression of uncoupling proteins (UCPs) in brown adipose tissue (BAT) and skeletal muscle (4). Both lactation and fasting caused a similar down-regulation of UCP1 and UCP3 in BAT, which would be consistent with the need to conserve energy through a decrease in nonshivering thermogenesis (3, 5– 8). The opposite changes observed in the regulation of UCP3 in skeletal muscle (decreased in lactation, increased in fasting) may represent the difference in the use of lipids as Abbreviations: Acadm, Acyl-CoA dehydrogenase for medium chain fatty acid; BAT, brown adipose tissue; CoA, coenzyme A; CPT1, carnitine palmitoyltransferase 1; FABP3, fatty acid binding protein 3; FAT/ CD36, fatty acid translocase; P, days postpartum; TCA, tricarboxylic acid; UCP, uncoupling protein. Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.

GenMAPP analysis revealed a coordinated regulation at key steps in glycolysis/gluconeogenesis, the tricarboxylic acid cycle, and lipid metabolism, indicating an increased rate of lactate production through glycolysis and reduced fatty acid degradation in skeletal muscle during lactation. Particular interest was paid to those genes that changed in a similar manner to UCP3 mRNA. Many of these genes that were decreased during lactation and increased during fasting are involved in fatty acid degradation and transport, including acyl-coenzyme A dehydrogenase for medium chain fatty acid, carnitine palmitoyltransferase 1, and fatty acid translocase. The current studies provide a basis for investigating the mechanisms underlying metabolic adaptations during lactation and fasting and highlight the importance of UCP3 in lipid metabolism. (Endocrinology 145: 5344 –5354, 2004)

fuels during these two states: spared during lactation and greatly used during fasting (7, 9 –11). Lactation is also characterized by very low circulating leptin levels (12), which may mediate the lactation-induced UCP down-regulation, because acute treatment with exogenous leptin, or removal of the nursing pups, a model of natural hyperleptinemia, reversed the effect of lactation, especially at the level of transcription (1, 4). However, little is known about the full extent and importance of alterations in gene expression in skeletal muscle during lactation, and no comparative analysis of the systems changes in muscle mRNA under the conditions of negative energy balance has been reported. To address these questions, we used cDNA microarrays and real-time PCR to acquire a comprehensive picture of the lactation- and fasting-induced transcriptional adaptations in skeletal muscle. To determine roles played by leptin during lactation, we also examined lactating rats treated with leptin. We were particularly interested in identifying genes that may play a role in the differential regulation of UCP3 gene expression and whose change in lactation was reversed by leptin treatment. Materials and Methods Animals and tissues Pregnant and virgin cycling female Sprague Dawley rats (Simonsen, Gilroy, CA) were housed with a 12-h light, 12-h dark photoperiod (lights on at 0700 h) in a temperature-controlled room (21–22 C). The day of delivery was considered as d 0 postpartum (P0) and litters were adjusted

5344

Xiao et al. • Gene Expression during Lactation

to eight pups on P2. Lactating rats were allowed free access to rat chow and water and allowed to suckle their eight pups undisturbed until P9, at which time they were divided into two groups: lactation, suckled eight pups until P11; and lactation ⫹ leptin, suckled eight pups and received recombinant mouse leptin (3 mg/kg, ip; Amgen, Inc., Thousand Oaks, CA) at 1600 h on P9 and P10. Both groups were killed by decapitation after 1500 h on P11. Cycling female rats were similarly killed after 48 h of fasting or without any previous food deprivation on diestrus, as examined by daily vaginal smears. Hindlimb gastrocnemius skeletal muscle was quickly removed, dissected free of connective tissues, and stored at ⫺80 C. All animal procedures were approved by the Oregon National Primate Research Center Institutional Animal Care and Use Committee.

General design of microarray experiments The number of independent experiments performed were: three control diestrus, three lactation and lactation ⫹ leptin, and two fasting. In each experiment, gastrocnemius skeletal muscle RNA pools (n ⫽ 3 animals/pool) were generated from the following groups of rats: 1) control, cycling diestrous females; 2) cycling females with 48 h of fasting; 3) lactation; and 4) lactation ⫹ leptin. To identify genes that were differentially expressed in muscle, comparisons were made between normalized signal intensity from the control group (diestrus) and experimental groups (lactation, lactation ⫹ leptin, and fasting) from each experiment. Genes with fold change in the normalized signal greater than 1.8 in at least two experiments were designated as differentially expressed.

RNA isolation Skeletal muscle was homogenized in TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) and total RNA was isolated according to the manufacturer’s specifications. RNA was further purified using an affinity resin column (QIAGEN, Inc., Valencia, CA). The quality and concentration of the RNA were determined by measuring the absorbance at 260 and 280 nm, and RNA integrity was confirmed by RNA gel.

Endocrinology, November 2004, 145(11):5344 –5354 5345

functionally grouped genes (13). When a MAPP is linked to a gene expression data set, GenMAPP automatically and dynamically color codes the genes on MAPP according to criteria supplied by the user. GenMAPP was used to construct and modify pathways as well as to provide access to annotation for genes and a connection with pathway.

Real-time RT-PCR Real-time RT-PCR was used to study the expression of genes (phosphofructokinase, lactate dehydrogenase A, pyruvate dehydrogenase E1 ␣ 1, acetyl-coenzyme dehydrogenase: medium chain), which were identified as differentially expressed from data obtained in cDNA microarray. Moreover, the expression of genes that were not modified (hexokinase II) or not present on cDNA arrays [carnitine palmitoyltransferase 1 (CPT1), fatty acid translocase (FAT/CD36), fatty acid binding protein 3 (FABP3)] was also examined. RNA samples were prepared for real-time PCR by randomprimed reverse transcription reaction using random hexamer primers (Promega, Madison, WI) and 1 ␮g of RNA. The reverse transcription reaction was then diluted 1:50 for PCR analysis. Reactions were conducted in triplicate for increased accuracy. Ten microliters of reaction mixture contained 5 ␮l TaqMan Universal PCR Master Mix, 300 nm specific target gene primers, 80 nm 18 S RNA gene primers, 250 nm specific probes, and 2 ␮l cDNA. The amplification was performed as follows: 2 min at 50 C, 10 min at 95 C, then 40 cycles each at 95 C for 15 sec and 60 C for 60 sec in the ABI/Prism 7700 Sequences Detector System (Applied Biosystems, Foster City, CA). After PCR was completed, baseline and threshold values were set to optimize the amplification plot, and the data were exported to an Excel spreadsheet. Standard curves were drawn on the basis of the log of the input RNA vs. the critical threshold cycle, which is the cycle in which the fluorescence of the sample was greater than the threshold of baseline fluorescence. These standard curves allowed for the critical threshold values to be converted to relative RNA concentrations for each sample. 18S RNA amplifications were conducted with the Pre-Developed TaqMan Assay Reagent (Applied Biosystems) and other primers and probes were designed using the Primer Express software from Applied Biosystems. The sequences of primers and probes used are summarized in Table 1.

Statistical analysis Labeling, hybridization, and analysis of image The Spotted Microarray Core (SMC) of Oregon Health & Science University uses PerkinElmer Micromax TSA Labeling and Detection Kit (PerkinElmer Life Sciences, Inc., Boston, MA). Briefly, in each total RNA pool, poly A⫹ mRNA was converted into fluorescein- and biotin-labeled cDNA using reverse transcriptase and nucleotide analogs. The cDNA probes were then mixed and simultaneously hybridized to the SMCmou8400A arrays in an overnight incubation. Fluorescein- and biotin-labeled cDNAs were sequentially detected with a series of conjugate reporter molecules according to TSA process. Ultimately, each of the two fluorescent reporter molecules (Cyanine 3 or Cyanine 5) is associated with the hybridized genetic material from each of the two starting samples. Hybridized arrays were scanned on one of two PerkinElmer ScanArray 4000 XLs, using PerkinElmer ScanArray Express software. Images were stored as TIFF files, which were analyzed using ImaGene (BioDiscovery, El Segundo, CA) and generate the Cy5/Cy3 signal. For the present experiment, cDNA from diestrus group was labeled for Cy3, and lactation, lactation ⫹ leptin, and fasting were labeled for Cy5. The resultant data were then preprocessed (normalized, centralized, and standardized) using the Lowess routine of GeneSight (BioDiscovery) in both the Windows and Linux environments. The raw data were stored as tab-delimited text files for use in standard analysis packages or as html documents with links to Stanford’s Source database. Ratios and signal intensities in Log2 values reported in these files were finally transformed into fold change.

Analysis of gene expression GeneSight, GenMAPP, and Microsoft Excel software were used for the data analysis. GeneSight (version 4.0, BioDiscovery) was used to find differentially expressed genes by confidence analyzer. GenMAPP (Gene MicroArray Pathway Profiler, see http://www.genmapp.org) is a program for viewing and analyzing microarray data on microarray pathway profiles (MAPPs) representing biological pathways or any other

All real-time PCR data are expressed as mean ⫾ sem. One-way ANOVA, followed by the Newman-Keuls’s multiple range test, or Student’s t test, was used to determine significant differences among groups.

Results General features of altered gene expression in response to lactation or fasting

Table 2 and 3 show the differentially regulated genes induced by lactation and their changes upon the leptin treatment or induced by 48 h fasting. The genes with fold change higher than 1.8 or lower than ⫺1.8 were thought to be differentially regulated. The 1.8-fold criterion as a minimum cutoff for change is chosen here based on the literature previously reported (14). It should be noted that a fold change of 1.8 represents an 80% increase. Of those known genes studied during lactation, 84 genes were differentially regulated compared with the diestrus control; 35 showed an increase and 49 displayed a decrease in transcript levels. These genes can be divided into different functional categories. It is interesting to note that, except for some important genes related to carbohydrate metabolism, which will be discussed in detail later, there was significant decreased expression for a large number of genes encoding protein transcription and translation, indicating reduced activity of protein synthesis by muscle during lactation (Table 2). Most of these changes appeared to be in response to the hypoleptinemia associated with lactation because many of the

5346

Endocrinology, November 2004, 145(11):5344 –5354


TABLE 1. Primer and probe sequences used for real-time PCR Gene

ID

Hexokinase 2

Mm.255848

Lactate dehydrogenase A

Rn.107896

Phosphofructokinase

Mm.269649

Pyruvate dehydrogenase E1 ␣1

Mm.34775

Acetyl-coenzyme A dehydrogenase, medium chain

Mm.10530

Fatty acid translocase/CD36

AF072411

Carnitine palmitoyltransferase 1

NM-031559

changes were reversed by leptin treatment. In addition, when lactating rats were given leptin, only 14 genes were found to be differentially regulated, with seven up-regulated and other seven down-regulated. Altered gene transcript levels in the glycolysis/gluconeogenesis pathway induced by lactation

Figure 1 shows the fold changes in glycolysis and gluconeogenesis gene levels during lactation, lactation ⫹ leptin, or fasting. During lactation, there was a significant and coordinate increase in glycolytic enzymes up through pyruvate production. Transcript levels for several key enzymes, for instance, 6-phospho-fructokinase, aldolase, glyceraldehyde3-phosphophate dehydrogenase, and pyruvate kinase, were increased by 90 –190% (fold change, 1.9 –2.9). However, one of the important enzymes for gluconeogenesis, fructose 1,6bisphosphatase, was decreased during lactation (fold change, ⫺2.10). Although these gene changes may indicate increased pyruvate production, there was a significant decrease in pyruvate dehydrogenase (fold change, ⫺2.54) and increased expression of lactate dehydrogenase (fold change, 2.70), indicating that there was an increase in lactate production. When lactating rats were pretreated with leptin, most of the lactation-induced changes in glycolytic and gluconeogenetic enzymes were partially reversed. Real-time PCR confirmed a significant increase in 6-phosphofructokinase and lactate dehydrogenase, as well as a significant decrease in pyruvate dehydrogenase, in the skeletal muscle of the lactating rat (Fig. 2). In contrast, fasting for 48 h caused only subtle changes in genes in the glycolysis pathway in skeletal muscle. Most notably, there was a decrease in hexokinase (fold change, ⫺1.57) and glucose-6-phosphate isomerase (fold change, ⫺1.44) during fasting, indicating a possible decrease in glucose oxidation. This makes physiological sense due to the fact that fasting animals are mobilizing fat stores as energy substrates rather than using glucose (see below). There was also a significant increase in 6-phosphofructokinase expression

Primer and probe

Sense: GCTCGAGCCTCGGTTTCTC Antisense: GTTTTGGTTGAGCTCCGTGAA Probe: CGACTCGCCGCAGCAGGATGAT Sense: GGGAGAAAGGCTGGGAGTTC Antisense: ACGTTCACACCACTCCACACA Probe: CAGGACCCACCCGTGACAGCTCA Sense: GCATCAGCATGGCCGACTA Antisense: AGGGTGATCGGTAAGCTCAGAA Probe: AGCACGTCACACGCCGCACC Sense: TGGAATCATTATAGGTGGTACAGAGAAC Antisense: TGCAACCAGTCTATAAGCTCTCTGTC Probe: CCACCCCCTGATGGACTGGGAAC Sense: TGATCTCATTTCCTTGGGAAGAC Antisense: GCATCACCCTCGTGTAACTAAGC Probe: AAGCCCTTTTCCCCTGAAGCAGCAA Sense: CCTTAAAGGAATCCCCGTATACAG Antisense: AGAAACAGTGGTTGTCTGGGTTC Probe: CCAGCCAACGCCTTTGCCTCC Sense: CATTACAAGGACATGGGCAAGTT Antisense: TCCATAGTGCAGGAGCGTACA Probe: TCCATGACCCGGCTCTTCCGAGA

(fold change, 1.85) in skeletal muscle of the fasting rat, as determined by cDNA microarray analysis. However, this change was not supported by the real-time PCR data (Fig. 2). Lactation reduced gene transcript levels of enzymes in the tricarboxylic acid (TCA) cycle in skeletal muscle

Figure 3 shows the fold changes in gene levels in the TCA cycle during lactation, lactation ⫹ leptin, or fasting. As shown above, pyruvate dehydrogenase, the enzyme that catalyzes the first step of the TCA cycle, was significantly decreased during lactation compared with diestrus (fold change, ⫺2.54), indicating that pyruvate would be shunted to lactate not acetyl-coenzyme A (CoA). In addition, succinyl-CoA synthetase (fold change, ⫺3.04) was also inhibited. Other enzymes in the TCA cycle showed a more subtle decrease in expression, such as isocitrate dehydrogenase (fold change, ⫺1.77), fumarate hydratase (fold change, ⫺1.64), and dihydrolipoamide succinyltransferase (fold change, ⫺1.28). Most of these decreases were reversed by leptin treatment. In contrast, fasting caused only subtle changes in expression of the enzymes involved in the TCA cycle. Differential effects of lactation and fasting on transcript levels of genes involved in fatty acid metabolism and transport in skeletal muscle

Figure 4 shows the changes in genes involved in fatty acid degradation during lactation, lactation ⫹ leptin, or fasting. There was only one major change in fatty acid degradation enzymes in skeletal muscle during lactation, a significant decrease in acyl-CoA dehydrogenase for medium chain fatty acids (Acadm; fold change, ⫺3.56). This decrease was almost completely reversed by leptin treatment. Furthermore, real-time PCR confirmed the significant decrease in this enzyme during lactation (Fig. 5). In contrast, fasting appeared to subtly increase many genes in this pathway, including a significant increase in Acadm, as determined by real-time PCR (Fig. 5). To assess whether other fatty acid oxidation-related enzymes and fatty



TABLE 2. Down-regulated genes (fold change lower than ⫺1.8) in skeletal muscle during lactation: comparison with diestrous controls Lactation

Lactation ⫹ Leptin

Cyclin G1

⫺2.90

⫺1.20

1.02

Acetyl-coenzyme A dehydrogenase, medium chain Succinate-coenzyme A ligase, ADP-forming, ␤ subunit Pyruvate dehydrogenase E1 ␣1 Aspartyl-tRNA synthetase Phosphorylase kinase, ␤ Fructose bisphosphatase 2

⫺3.56 ⫺3.04 ⫺2.54 ⫺2.32 ⫺2.19 ⫺2.10

⫺1.38 ⫺1.69 ⫺1.36 ⫺1.41 ⫺2.00 ⫺1.36

1.44 1.27 1.09 1.04 1.07 1.01

Protein tyrosine phosphatase 4a2 CDC-like kinase Protein tyrosine phosphatase 4a1

⫺2.44 ⫺2.16 ⫺2.16

⫺1.47 ⫺1.25 1.15

⫺1.13 1.05 1.23

Heterogeneous nuclear ribonucleoprotein A2/B1 Karyopherin (importin) ␣ 3 RNA-binding region (RNP1, RRM) containing 2 Hypothetical RNA binding protein RDA288 Nucleolin DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 Zinc finger RNA binding protein Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 Poly A binding protein, cytoplasmic 1 Zinc finger protein 91

⫺3.30 ⫺2.67 ⫺2.53 ⫺2.52 ⫺2.47 ⫺2.38 ⫺1.99 ⫺1.93 ⫺1.89 ⫺1.81

⫺1.23 ⫺1.33 ⫺1.22 ⫺1.23 ⫺1.4 ⫺1.46 ⫺1.30 ⫺1.46 ⫺1.31 ⫺1.16

⫺1.03 1.24 1.04 1.07 1.23 1.03 1.22 1.47 1.07 ⫺1.15

Reticulon 4 Capping protein (actin filament) muscle Z-line, ␣2 Kinesin family member 5B Proteasome (prosome, macropain) subunit, ␣ type 4 Synaptophysin-like protein SM-11044 binding protein Lyric

⫺2.65 ⫺2.92 ⫺2.26 ⫺2.01 ⫺1.99 ⫺1.99 ⫺1.93

⫺1.22 ⫺1.36 ⫺1.49 ⫺1.22 ⫺1.07 ⫺1.58 ⫺1.42

1.21 1.19 1.08 1.21 1.30 ⫺1.04 1.03

⫺3.14 ⫺2.95 ⫺2.78 ⫺2.29 ⫺1.92 ⫺1.92 ⫺1.88 ⫺1.84 ⫺1.81

⫺1.47 ⫺1.29 ⫺1.76 ⫺1.52 ⫺1.50 ⫺1.79 ⫺1.29 ⫺1.35 ⫺1.37

1.28 1.12 ⫺1.03 1.00 ⫺1.05 ⫺1.12 ⫺1.16 1.25 1.01

Fibroblast growth factor inducible 14

⫺2.39

⫺1.31

1.19

Cytochrome c, somatic

⫺3.52

⫺1.20

⫺1.14

Heat shock 70-kDa protein 5 (glucose-regulated protein) DnaJ (Hsp40) homolog, subfamily C, member 7

⫺1.96 ⫺1.87

⫺1.80 ⫺1.50

⫺1.44 1.56

Clathrin, heavy polypeptide (Hc) Septin 7

⫺1.87 ⫺1.81

⫺1.33 ⫺1.39

⫺1.06 ⫺1.08

DNA segment, Chr 3, MJeffers 1 Nexilin Tax1 binding protein 1 COP9 (constitutive photomorphogenic) homolog, subunit 2 Mortality factor 4 like 2 Major sperm protein domain Son cell proliferation protein

⫺3.05 ⫺2.90 ⫺2.32 ⫺2.30 ⫺1.94 ⫺1.94 ⫺1.92

⫺1.33 ⫺1.74 ⫺1.67 ⫺1.34 ⫺1.27 ⫺1.40 ⫺1.72

1.18 ⫺1.09 1.12 1.14 1.21 1.06 1.17

GenBank

Cell cycle control Mm.2103 Metabolic enzymes Mm.10530 Mm.38951 Mm.34775 Mm.28693 Mm.28827 Mm.2974 Signaling components Mm.193688 Mm.1761 Mm.28909 Transcription regulators Mm.155896 Mm.25548 Mm.259348 Mm.212899 Mm.270297 Mm.19101 Mm.21515 Mm.182318 Mm.2642 Mm.28324 Cellular component Mm.220966 Mm.260626 Mm.268688 Mm.30270 Mm.269677 Mm.246440 Mm.209935 Protein processing Mm.27695 Mm.880 Mm.21848 Mm.29859 Mm.30242 Mm.260943 Mm.29815 Mm.2238 Mm.260384 Growth factor-like protein Mm.18459 Electron carrier Mm.35389 Stress-related protein Mm.918 Mm.196142 Endocytosis and trafficking Mm.200876 Mm.270259 Others Mm.11204 Mm.200188 Mm.30069 Mm.3596 Mm.27218 Mm.28236 Mm.46401

Description

Eukaryotic translation initiation factor 3, subunit Eukaryotic translation initiation factor 3, subunit Basic leucine zipper and W2 domains 1 Eukaryotic translation initiation factor 2, subunit Peptidylprolyl isomerase D Eukaryotic translation initiation factor 5B Methionine adenosyltransferase II, ␣ Eukaryotic translation initiation factor 3, subunit Eukaryotic translation initiation factor 5

acid transporters exhibited changes similar to those of Acadm during lactation and fasting, we used real-time PCR to examine changes of additional important genes that were not included on the microarray chip: CPT1, FAT/CD36, and FABP3. Expression of CPT1 and FAT/CD36 mRNA was significantly decreased during lactation and elevated during fasting, a pat-

1␣ 6 2 (␤)

10 (␪)

Fasting

tern similar to the changes previously reported for UCP3 expression (Fig. 5) (4). FABP3 was also decreased during lactation, although the increase induced by fasting was not statistically significant. After leptin treatment during lactation, FABP3 remained low, whereas CPT1 and FAT/CD36 expression were reversed (Fig. 5).

5348



TABLE 3. Up-regulated genes (fold change higher than 1.8) in skeletal muscle during lactation: comparison with diestrous controls Lactation

Lactation ⫹ Leptin

Fasting

Glutamate-ammonia ligase Aldolase 1, A isoform Creatine kinase Lactate dehydrogenase Cytochrome c oxidase subunit IV isoform 1 Pyruvate kinase Aldolase 3, C isoform Phosphoribosyl pyrophosphate synthetase 1 ATPase, Na⫹/K⫹ transporting, ␣1 polypeptide Glyceraldehyde-3-phosphate dehydrogenase S-Adenosylhomocysteine hydrolase ATPase, H⫹ transporting, V0 subunit C Phosphofructokinase 1-Acylglycerol-3-phosphate O-acyltransferase 1 Glutamic pyruvic transaminase 1 Branched chain ketoacid dehydrogenase kinase

4.13 2.92 2.78 2.70 2.51 2.46 2.22 2.16 2.15 2.02 1.96 1.88 1.93 1.88 1.84 1.81

1.77 2.06 2.85 1.73 1.27 1.68 2.33 1.03 1.03 1.69 ⫺1.06 ⫺1.04 1.04 1.03 ⫺1.02 ⫺1.14

1.46 1.32 1.36 1.33 1.29 1.09 1.49 ⫺1.12 1.58 1.17 1.13 1.20 1.85 ⫺1.49 ⫺1.37 1

EH-domain containing 1 Guanine nucleotide binding protein, ␤ 2, related sequence 1 Rho GDP dissociation inhibitor

2.35 1.85 1.81

⫺1.08 1.15 ⫺1.14

1.11 1.21 1

Acidic ribosomal phosphoprotein P0 Flap structure specific endonuclease 1

2.39 2.07

1.92 1.23

1.26 ⫺1.32

Ribosomal protein S27a

2.88

1.10

⫺1.03

Actinin ␣4 Endothelial and smooth muscle cell-derived neuropilin-like molecule Actin, ␤, cytoplasmic Actinin ␣3 Dynamin 2

3.25 3.21 2.81 2.42 2.11

1.44 2.43 2.24 2.39 ⫺1.39

1.92 1.14 1.34 1.40 ⫺1.56

Hemoglobin ␣, adult chain 1 Ferritin heavy chain Ciliary neurotrophic factor receptor

4.26 2.58 2.07

2.09 1.78 1.30

⫺1.18 1.09 ⫺1.23

Heat shock protein 1 Heat shock protein 8

2.02 1.84

1.12 1.38

1.26 1.05

Chromobox homolog 5 Target of myb1 homolog Autophagy 7-like

2.53 2.18 2.08

1.76 ⫺1.23 1.21

⫺1.28 ⫺1.02 ⫺1.05

GenBank

Metabolic enzymes Mm.2338 Mm.16763 Mm.16831 Mm.29324 Mm.2136 Mm.216135 Mm.7729 Mm.27454 Mm.205791 Mm.5289 Mm.2573 Mm.30155 Mm.1166 Mm.8684 Mm.30130 Mm.8903 Signaling components Mm.30169 Mm.5305 Mm.30016 Transcription regulators Mm.5286 Mm.2952 Protein processing Mm.180003 Cellular component Mm.276042 Mm.37787 Mm.297 Mm.5316 Mm.39292 Growth factor-like protein Mm.196110 Mm.1776 Mm.30367 Stress-related protein Mm.13849 Mm.197551 Others Mm.28003 Mm.1967 Mm.34548

Description

Discussion

In this study, we used cDNA microarray and real-time PCR analysis to compare the pattern of gene expression in skeletal muscle in two models of negative energy balance resulting from either a large energy drain due to milk production (lactation) or a dramatic reduction in energy intake (fasting). In addition, in view of leptin’s role as an important metabolic regulator, the effect of leptin replacement on lactation-induced changes in gene expression was examined in this study. Based on the changes in mRNA levels, our results support the idea that lactation induces a few key metabolic adaptations to conserve energy and metabolic substrates for milk production: 1) Increased expression of genes encoding key enzymes in the glycolytic pathway, accompanied by decreased expression of gene transcripts in the TCA cycle in skeletal muscle, indicate increased glycolysis but reduced activity in the TCA pathway during lactation. 2) Lactating rats actively spare mus-

cle fatty acids by decreasing expression of the genes encoding lipid metabolism and transport. 3) There is a reduced activity of protein synthesis by muscle during lactation. 4) Many lactation-induced changes in gene expression are leptin dependent because leptin treatment can reverse or attenuate these changes. The purpose of these adaptations appears to provide biosynthetic intermediates for use by other aerobic tissues and to decrease metabolic fuel oxidation by the muscle, thereby sparing energy sources for milk production. Lactation is a physiological state characterized by a dramatic increase in the nutrient requirement of the mother (1, 10, 15). There are three strategies to meet this increased demand: increased appetite, improved metabolic efficiency, and use of lipid reserves. In rodents, lactation results in hypoleptinaemia (12, 16) and significant increases in neuropeptide Y and agouti-related peptide and a decrease in pro-opiomelanocortin expression in the hy-



FIG. 1. Glycolysis/gluconeogenesis pathway adapted from a view in GenMAPP. The fold changes presented below the name of the enzymes are for lactation, lactation ⫹ leptin, and fasting, compared with diestrus.

pothalamus (17–19); these changes are thought to drive the hyperphagia and decrease sympathetic outflow to maintain energy balance. In addition, lactating animals improve metabolic efficiency and favor nutrient utilization by the mammary gland. For instance, there are decreased thermogenesis and UCP1 expression in BAT (3–5, 20), decreased lipogenesis in white adipose tissue, and reduced splanchnic extraction of dietary glucose (21). Furthermore, hypoleptinaemia, hypoinsulinemia, and diminished responsiveness in adipose and muscle tissues favor uptake of nutrients by the mammary gland. Because skeletal muscle accounts for most of an individual’s mass and daily energy consumption, muscle fuel economy is very important, not only for minimizing food requirements, but also for reducing unwanted heat production and for avoiding the catabolism of proteins important for muscle functions. Therefore, it is reasonable to deduce that metabolic changes in muscle will contribute to the whole body adaptations during lactation.

Lactation increases glycolysis but decreases the TCA cycle in skeletal muscle

Lactation increases gene expression of several enzymes in the glycolysis pathway in skeletal muscle, and these changes would promote increased pyruvate production. However, the concomitant decrease in pyruvate dehydrogenase and increase in lactate dehydrogenase would promote increased lactate production rather than increased ATP production through the TCA cycle. This observation is further supported by a decrease in the expression of several enzymes in the TCA cycle such as succinyl-CoA synthetase. These changes in gene expression are consistent with previous physiological studies showing a decrease in glucose utilization (22) and pyruvate dehydrogenase activity (23) in skeletal muscle in lactating animals. Because both pyruvate dehydrogenase and succinyl-CoA synthetase are important to the metabolism of branched chain amino acids, the inhibition of genes encoding these enzymes, in concert with inhibition of protein synthesis during lactation, would presumably lead to the

5350



FIG. 2. Validation of selected genes from cDNA microarray. Cycling rats were either ad libitum fed (Diestrus) or fasted for 48 h (Fasting). Day 11 lactating rats received no treatment (Lactation) or were pretreated with leptin (Lactation ⫹ Leptin). Total RNA was extracted with TRIzol reagent from hindlimb skeletal muscle and mRNA expression was assessed by real-time RT-PCR. Columns with differing superscripts (a, b, or c) indicate values that are significantly different from each other. (One-way ANOVA, followed by Newman-Keuls’s multiple range test, n ⫽ 4 –7).

sparing of amino acids. Glucose oxidation and incorporation into lipids are also decreased in adipocytes (24, 25), whereas hepatic glucose production is enhanced during lactation (26). The increase in lactate from skeletal muscle would serve as a substrate for the increased hepatic gluconeogenesis. On the other hand, in mammary gland epithelial cells, glucose transporter 1 (GLUT1), an isoform independent of insulin stimulation, is remarkably increased during lactation (27), indicating increased utilization of glucose by mammary gland under basal conditions. Furthermore, lactation results in insulin resistance in skeletal muscle, but the mammary gland maintains a high sensitivity to insulin (28, 29), which is particularly important under conditions of hypoinsulinemia. These observations suggest that lactating dams can limit glucose utilization and increase lactate output by skeletal muscle, as well as by adipocytes, to facilitate the efficient partitioning of nutrients to the mammary gland for milk production. In general, our cDNA microarray analysis comparing differential gene expression in skeletal muscle in fasted and fed rats is similar to that previously reported (14). However, the fasting rat, which is also a model of energy conservation, shows a dramatically different pattern of gene expression from the lactating rat. Whereby the lactating rat displayed increased expression in several of the enzymes involved in the glycolytic pathway and decreases

in the TCA cycle, there were only subtle changes in a few of these enzymes in the fasted rat. The one exception to this was 6-phosphofructokinase, which was similarly increased in skeletal muscle from lactating and fasted rats. However, although this increase in the lactating rat was confirmed by real-time PCR analysis, the change was not confirmed in the fasting rat. These results are not surprising because the fasting rat is mobilizing fat stores to substitute for low glucose levels. Lactation decreases fatty acid uptake and oxidation by skeletal muscle

In general, there were only subtle changes in the expression of enzymes involved with fatty acid degradation in the skeletal muscle during lactation, including a small decrease in lipoprotein lipase, which has been reported previously (30). One exception to this was a greater than 3-fold reduction in the Acadm. However, many of the key transporters involved in fatty acid uptake were not present on the cDNA microarray chips used in this study. Therefore, we used real-time PCR to characterize changes in: 1) CPT1, the enzyme that regulates the transfer of long chain fatty acyl-CoA into mitochondria, and regulates fatty acid oxidation, 2) FAT/CD36, a major regulator of cellular uptake of longchain fatty acids, and 3) FABP3, which plays a key role in the



FIG. 3. TCA cycle pathway adapted from a view in GenMAPP. The fold changes presented below the name of the enzymes are for lactation, lactation ⫹ leptin and fasting, compared with diestrus.

transport of fatty compounds throughout the cytoplasm. All three of these important fatty acid transporters were decreased during lactation, suggesting that lipid usage by skeletal muscle is low in this state. In contrast to the lactating rat, CPT1, Acadm, and FAT/CD36 are significantly increased in skeletal muscle during fasting, and FABP3 shows a tendency to increase even though it does not reach statistical significance. These changes in gene expression are consistent with the observation that fat is mobilized as a fuel substrate during fasting (31–34). The divergent effects of lactation and fasting on transcriptional changes in fatty acid oxidation enzymes and transporters are very similar to that of UCP3 expression and serum free fatty acid levels previously reported by our group (4). Taken together, these studies indicate a close association between key regulators of lipid oxidation and transport with UCP3 gene expression and, hence, are consistent with the hypothesis that this UCP homolog may be involved in the regulation of lipid metabolism. The lactationinduced decrease in the utilization of fatty acids by muscle favors the delivery of these substrates to the mammary gland for milk production (35, 36).

Hypoleptinemia during lactation is a permissive signal for metabolic adaptations in skeletal muscle

The lactating rat displays hypoleptinemia, irrespective of the fact that it maintains a high level of body fat, suggesting that leptin is being actively suppressed. Hypoleptinemia is likely important to reduce homeostatic feedback onto the hypothalamus that normally restricts food intake. In addition, hypoleptinemia may also be important for regulating energy conservation and substrate usage in peripheral tissues as well. Therefore, leptin is likely to be a key mediator of mechanisms involved in the metabolic changes induced by lactation, although other factors such as the decrease in sympathetic nervous system activity and hormonal changes that are associated with lactation, i.e. insulin, prolactin, and oxytocin, cannot be excluded (4, 12, 37, 38). In the present studies, only 14 genes were differentially regulated in lactating rats treated with leptin when compared with diestrus, as opposed to 84 differentially regulated genes in lactating rats without leptin treatment. Thus, more than 80% of the genes that were differentially regulated in skeletal muscle during lactation were reversed by leptin treatment. Furthermore, 70% of the differentially regulated

5352



FIG. 4. Fatty acid degradation pathway adapted from a view in GenMAPP. The fold changes presented below the name of the enzymes are for lactation, lactation ⫹ leptin, and fasting, compared with diestrus.

FIG. 5. Changes in fatty acid degradation enzymes and transporters in skeletal muscle. See Fig. 2 for additional detail.


genes induced by lactation in the glycolysis, TCA cycle, and fatty acid degradation pathways were reversed, either completely or partially, by the treatment with leptin. From these studies, it is not possible to determine the site of leptin action to reverse the changes in skeletal muscle during lactation. Leptin could be acting directly on skeletal muscle, or other peripheral tissues or via a central nervous system-mediated mechanism. In accordance with the previous observations that low circulating leptin levels during lactation may be responsible for the alteration in mRNA expression of UCPs and the removal of the central actions of leptin (1, 4), the present results strongly suggest that the drop in circulating leptin may be involved in determining utilization of metabolites, either independently or in combination with other neuronal and hormonal factors. In interpreting the results of these studies, it should be noted that some aspects of the methodology for the cDNA microarray analysis, such as Cy5/Cy3 signal and 1.8-fold cutoff, might result in falsely identifying genes as being differentially regulated. Based on our real-time PCR results, in which we examined five genes under three conditions, only two genes during fasting were not confirmed; thus, this part accounts for 13%. In addition, the interpretation of the data is based on the change in mRNA levels. It is possible that changes in the activity of metabolic pathways could occur due to the mechanisms downstream of mRNA, such as regulation of protein synthesis or the activity of synthesized proteins. Further studies are needed to validate the changes shown by microarray analysis and to examine whether translational and/or posttranslational mechanisms may be operative in regulating metabolic adaptations. In summary, we observed a high rate of gene expression for the substances in the glycolytic pathway, accompanied by lower levels of gene expression for those in the TCA cycle in skeletal muscle during lactation. In addition, the coordinate down-regulation of fatty acid degradation enzymes and transporters was consistent with the suppression of UCP3 expression. These metabolic adaptations suggest that skeletal muscle during lactation can efficiently produce biosynthetic intermediates and actively spare fatty acids for milk production. The current studies provide a basis for investigating the mechanisms underlying metabolic adaptations during lactation and fasting and highlight the importance of UCP3 in lipid metabolism. Acknowledgments The authors thank Dr. Robert Searles (Manager, Oregon Health & Science University Gene Microarray Shared Resource) for his help in this study. Received June 7, 2004. Accepted July 8, 2004. Address all correspondence and requests for reprints to: Dr. M. Susan Smith, Division of Neuroscience, Oregon National Primate Research Center, Oregon Health & Science University, 505 Northwest 185th Avenue, Beaverton, Oregon 97006. E-mail: [email protected]. This work was supported by National Institutes of Health Grants HD-14643, HD-18185, and RR00163.

References 1. Smith MS, Grove KL 2002 Integration of the regulation of reproductive function and energy balance: lactation as a model. Front Neuroendocrinol 23:225– 256


2. Roberts SB 2000 Regulation of energy intake in relation to metabolic state and nutritional status. Eur J Clin Nutr 54(Suppl 3):S64 –S69 3. Trayhurn P, Gouglas JB, McGuckin MM 1982 Brown adipose tissue thermogenesis is suppressed during lactation in mice. Nature 298:59 – 69 4. Xiao XQ, Grove KL, Grayson BE, Smith MS 2004 Inhibition of uncoupling protein expression during lactation: role of leptin. Endocrinology 145:830 – 838 5. Pedraza N, Solanes G, Iglesias R, Vazquez M, Giralt M, Villarroya F 2001 Differential regulation of expression of genes encoding uncoupling proteins 2 and 3 in brown adipose tissue during lactation in mice. Biochem J 355:105–111 6. Sivitz WI, Fink BD, Morgan DA, Fox JM, Donohoue PA, Haynes WG 1999 Sympathetic inhibition, leptin, and uncoupling protein subtype expression in normal fasting rats. Am J Physiol Endocrinol Metab 277:E668 –E677 7. Sivitz WI, Fink BD, Donohoue PA 1999 Fasting and leptin modulate adipose and muscle uncoupling protein: divergent effects between messenger ribonucleic acid and protein expression. Endocrinology 140:1511–1519 8. Champigny O, Ricquier D 1990 Effects of fasting and refeeding on the level of uncoupling protein mRNA in rat brown adipose tissue: evidence for dietinduced and cold-induced responses. J Nutr 120:1730 –1736 9. Bezaire V, Hofmann W, Kramer JK, Kozak LP, Harper ME 2001 Effects of fasting on muscle mitochondrial energetics and fatty acid metabolism in Ucp3 (⫺/⫺) and wild-type mice. Am J Physiol Endocrinol Metab 281:E975–E982 10. Dewey KG 1997 Energy and protein requirements during lactation. Annu Rev Nutr 17:19 –36 11. Weigle DS, Selfridge LE, Schwartz MW, Seeley RJ, Cummings DE, Havel PJ, Kuijper JL, BeltrandelRio H 1998 Elevated free fatty acids induce uncoupling protein 3 expression in muscle: a potential explanation for the effect of fasting. Diabetes 47:298 –302 12. Brogan RS, Mitchell SE, Trayhurn P, Smith MS 1999 Suppression of leptin during lactation: contribution of the suckling stimulus versus milk production. Endocrinology 140:2621–26278 13. Dahlquist KD, Salomonis N, Vranizan K, Lawlor SC, Conklin BR 2002 GenMAPP, a new tool for viewing and analyzing microarray data on biological pathways. Nat Genet 31:19 –20 14. Jagoe RT, Lecker SH, Gomes M, Goldberg AL 2002 Patterns of gene expression in atrophying skeletal muscles: response to food deprivation. FASEB J 16:1697–1712 15. Vernon RG, Denis RG, Sorensen A, Williams G 2002 Leptin and the adaptations of lactation in rodents and ruminants. Horm Metab Res 34:678 – 685 16. Denis RG, Williams G, Vernon RG 2003 Regulation of serum leptin and its role in the hyperphagia of lactation in the rat. J Endocrinol 176:193–203 17. Smith MS 1993 Lactation alters neuropeptide-Y and proopiomelanocortin gene expression in the arcuate nucleus of the rat. Endocrinology 133:1258 –1265 18. Pickavance L, Dryden S, Hopkins D, Bing C, Frankish H, Wang Q, Vernon RG, Williams G 1996 Relationships between hypothalamic neuropeptide Y and food intake in the lactating rat. Peptides 17:577–582 19. Chen P, Li C, Haskell-Luevano C, Cone RD, Smith MS 1999 Altered expression of agouti-related protein and its colocalization with neuropeptide Y in the arcuate nucleus of the hypothalamus during lactation. Endocrinology 140: 2645–2650 20. Trayhurn P 1983 Decreased capacity for non-shivering thermogenesis during lactation in mice. Pflugers Arch 398:264 –265 21. Travers MT, Vernon RG, Barber MC 1997 Repression of the acetyl-CoA carboxylase gene in ovine adipose tissue during lactation: the role of insulin responsiveness. J Mol Endocrinol 19:99 –107 22. Burnol AF, Ferre P, Leturque A, Girard J 1987 Effect of insulin on in vivo glucose utilization in individual tissues of anesthetized lactating rats. Am J Physiol 252:E183–E188 23. Vernon RG, Faulkner A, Finley E, Pollock H, Taylor E 1987 Enzymes of glucose and fatty acid metabolism of liver, kidney, skeletal muscle, adipose tissue and mammary gland of lactating and non-lactating sheep. J Anim Sci 64:1395–1411 24. Burnol AF, Guerre-Millo M, Lavau M, Girard J 1986 Effect of lactation on insulin sensitivity of glucose metabolism in rat adipocytes. FEBS Lett 194: 292–296 25. Burnol AF, Ebner S, Kande J, Girard J 1990 Insulin resistance of glucose metabolism in isolated brown adipocytes of lactating rats. Evidence for a post-receptor defect in insulin action. Biochem J 265:511–517 26. Burnol AF, Leturque A, Ferre P, Girard J 1983 Glucose metabolism during lactation in the rat: quantitative and regulatory aspects. Am J Physiol 245: E351–E358 27. Camps M, Vilaro S, Testar X, Palacin M, Zorzano A 1994 High and polarized expression of GLUT1 glucose transporters in epithelial cells from mammary gland: acute down-regulation of GLUT1 carriers by weaning. Endocrinology 134:924 –934 28. Jones RG, Ilic V, Williamson DH 1984 Physiological significance of altered insulin metabolism in the conscious rat during lactation. Biochem J 220: 455– 460 29. Vernon RG, Faulkner A, Hay Jr WW, Calvert DT, Flint DJ 1990 Insulin resistance of hind-limb tissues in vivo in lactating sheep. Biochem J 270:783–786

5354



30. Champigny O, Hitier Y 1987 Lipoprotein lipase activity in skeletal muscle and brown adipose tissue of pregnant and lactating rats. J Nutr 117:349 –354 31. Moreno M, Lombardi A, De Lange P, Silvestri E, Ragni M, Lanni A, Goglia F 2003 Fasting, lipid metabolism, and triiodothyronine in rat gastrocnemius muscle: interrelated roles of uncoupling protein 3, mitochondrial thioesterase, and coenzyme Q. FASEB J 17:1112–1114 32. Pilegaard H, Saltin B, Neufer PD 2003 Effect of short-term fasting and refeeding on transcriptional regulation of metabolic genes in human skeletal muscle. Diabetes 52:657– 662 33. Samec S, Seydoux J, Russell AP, Montani JP, Dulloo AG 2002 Skeletal muscle heterogeneity in fasting-induced upregulation of genes encoding UCP2, UCP3, PPAR␥ and key enzymes of lipid oxidation. Pflugers Arch 445:80 – 86

34. Turcotte LP, Srivastava AK, Chiasson JL 1997 Fasting increases plasma membrane fatty acid-binding protein (FABP(PM)) in red skeletal muscle. Mol Cell Biochem 166:153–158 35. Del Prado M, Villalpando S, Gordillo J, Hernandez-Montes H 1999 A high dietary lipid intake during pregnancy and lactation enhances mammary gland lipid uptake and lipoprotein lipase activity in rats. J Nutr 129:1574 –1578 36. Williamson DH 1989 Regulation of metabolism during lactation in the rats. Reprod Nutr Dev 26:597– 603 37. McNamara JP, Murray CE 2001 Sympathetic nervous system activity in adipose tissues during pregnancy and lactation of the rat. J Dairy Sci 84:1382–1389 38. Torner L, Neumann ID 2002 The brain prolactin system: involvement in stress response adaptations in lactation. Stress 5:249 –257

International Symposium: “The Science of Diabetes Complications: Implications for Novel Therapy” 17–19 November, 2004 Toronto, Ontario, Canada Contact: 416-586-8665; Fax: 416-361-2657; Email: [email protected] or view our website at: www.endocrinologycanada.org Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.