Metabolic engineering of noviose: heterologous expression of ...

Biotechnol Lett (2008) 30:1609–1615 DOI 10.1007/s10529-008-9733-2

ORIGINAL RESEARCH PAPER

Metabolic engineering of noviose: heterologous expression of novWUS and generation of a new hybrid antibiotic, noviosylated 10-deoxymethynolide/narbonolide, from Streptomyces venezuelae YJ003-OTBP1 Binod Babu Pageni Æ Tae-Jin Oh Æ Hei Chan Lee Æ Jae Kyung Sohng

Received: 13 February 2008 / Revised: 16 March 2008 / Accepted: 26 March 2008 / Published online: 22 April 2008 Ó Springer Science+Business Media B.V. 2008

Abstract NovW, novU and novS genes have been characterized as dTDP-4-keto-6-deoxy-D-glucose 3epimerase, C-5 methyltransferase and dTDP-glucose 4-ketoreductase, respectively involved in noviose biosynthetic pathway. We have cloned and expressed the Streptomyces spheroids novWUS genes in S. venezuelae YJ003-OTBP1. This established the function of novWUS and, at the same time, it also proved that the noviosyl derivative of 10-deoxymethynolide(2)/narbonolide(4) obtained from S. venezuelae YJ003-OTBP1 is a novel hybrid antibiotic. Keywords Deoxysugar biosynthesis Heterologous expression Hybrid antibiotic Noviose Streptomyces venezuelae

Introduction A growing appreciation of deoxysugars for the biological activities of many secondary metabolites has led to a surge of investigations in the biosynthesis of deoxysugars (Melancon and Liu 2007). Recent studies of rational manipulation of deoxysugars B. B. Pageni T.-J. Oh H. C. Lee J. K. Sohng (&) Institute of Biomolecule Reconstruction (iBR), Department of Pharmaceutical Engineering, Sun Moon University, #100, Kalsan-ri, Tangjeong-myeon, Asan-si, Chungnam 336-708, Republic of Korea e-mail: [email protected]

generate the diverse array of new macrolide derivatives with potential biological activities. A number of deoxysugar moieties participate in the molecular recognition of a drug target site and often play crucial roles in determining the biological activity of the parent natural products in secondary metabolite antibiotics (Weymouth-Wilson 1997). The importance of the sugars in various antibiotics has prompted researchers to approach the generation of novel derivatives from natural products by altering the glycosylation pattern. The aminocoumarin antibiotics, novobiocin, chlorobiocin, and coumermycin A1, are potent inhibitors of bacterial gyrase and contain an unusual branched deoxysugar with 5,5-gem-dimethyl structure which is essential for the biological activity (Maxwell 1999). Cloning of the biosynthetic gene clusters of novobiocin revealed a contiguous group of five genes, novSTUVW and sequence analysis suggested that these genes are responsible for the biosynthesis of deoxysugar moiety of novobiocin (Freitag et al. 2006a) and novWUS genes were also well-characterized by in vitro method in our previous study (Thuy et al. 2005). Streptomyces venezuelae ATCC 15439 produced a group of macrolactone, including the 12membered ring 10-deoxymethynolide (1) and a 14membered ring narbonolide (3) obtained from single multifunctional PKS (pikA). The set of genes required for the biosynthesis of a TDP-D-desosamine is clustered downstream of pikA that involved in biosynthesis of methymycin/pikromycin (Fig. 1a)

123

1610

Biotechnol Lett (2008) 30:1609–1615

Fig. 1 (a) Proposed biosynthetic pathway leading toward TDP-5,5-gem-dimethyl-deoxysugar noviose, TDP-desosamine. DesIII (TDP-glucose synthase), DesIV (TDP-glucose 4,6dehydratase) and DesVII/DesVIII (glycosyltransferase) from S. venezuelae; NovW (TDP-glucose 3-epimerase), NovU (C-5methyltransferase) and NovS (TDP-glucose 4-ketoreductase)

from S. spheroides. 10-deoxymethynolide (1) and narbonolide (3) obtained from S. venezuelae. Also, the noviosylated 10deoxymethynolide (2) and the noviosylated narbonolide (4) obtained from S. venezuelae YJ003-OTBP6.1. (b) Expression plasmid pOTBP6.1

(Xue et al. 1998). In addition, the pikromycin glycosyltransferase DesVII/DesVIII system affects the efficiency of glycosylation and shows flexibility in

accepting various deoxysugars generating further structural variations (Hong et al. 2004; Lee et al. 2006). These unique features of S. venezuelae in

123


1611

generating structural variability can be applied for designing of strategies to accomplish the of novel hybrid macrolides by combinatorial biosynthesis. In this study, we have used S. venezuelae YJ003OTBP1 (Pageni et al. 2008) as host bacteria. Previously, it was used to express the pOTBP3 plasmid to generate the 4-amino-4,6-dideoxy-L-glucose derivative of methymycin and pikromycin (Pageni et al. 2008). We have here cloned novWUS genes S. spheroides NCIB 11891 (Steffensky et al. 2000) and heterologously expressed in S. venezuelae YJ003-OTBP1 by the transformation of expression plasmid including noviose sugar genes (Fig. 1a). Novel noviosyl derivative of 10-deoxymethynolide(2)/narbonolide(4) have been proved by LC/MS and MS/MS analysis.

Materials and methods Bacterial strains, plasmids and growth conditions Streptomyces venezuelae and S. venezuelae YJ003OTBP1 were used to produce methymycin/pikromycin and their novel derivatives. Plasmid pMS62 (5,568 bp) from Streptomyces spheroides (Steffensky et al. 2000) was used to amplify novWUS genes for the construction of the expression plasmid. The pCJW93 containing bidirectional promoters obtained from Leadlay’s group was used to construct the expression plasmid pMBE101 (Wilkinson et al. 2002). pGEM-7zf(+) and pGEM-T easy vectors (Promega, USA) were used as subcloning vectors. Transformants were selected on R2YE agar plates by overlaying with aparamycin (0.5 mg/ml), kanamycin (1 mg/ml) and thiostrepton (0.5 mg/ml) (Kieser et al. 2000; Sambrook and Russell 2001). Transformants were grown on SPA solid medium (Lee et al. 2006) with appropriate antibiotics for production of Table 1 The primers used in this study

Restriction sites are italicized

glycosylated products. Escherichia coli XL1-Blue MRF (Stratagene, USA) as a host for DNA manipulation and E. coli ET 12567 (Stratagene, USA) as demethylation were also used and Luria-Bertani (LB) medium was used for E. coli propagation. Construction of heterologous expression plasmid pOTBP6.1 Primers for amplification of genes are summarized in Table 1. PCR product of novW (624 bp) was cloned into the SacI and KpnI sites of sub-cloning vector pGEM-7zf(+) where PCR product of novS (867 bp) was also cloned in KpnI and EcoRI restriction sites. SacI/EcoRI fraction from pGEM-7zf(+) was cloned into pMBE101 using same sites in order to generate pOTBP5.1. Later, novU was cloned in the pOTBP5.1 using BstBI and XbaI restriction sites to obtain the target plasmid pOTBP6.1 (Fig 1b). All PCR products were cloned into the pGEM-T easy vector (Promega, USA) and sequenced prior to cloning into the expression vector to verify that no mutations occurred during PCR. PCR conditions were as follows: denaturation of 7 min at 94°C, 30 cycles of annealing at 60–70°C for 1 min, and polymerization at 72°C for 1 min. The amplification was performed in a total volume of 20 ll with 5 ll PCR premix solution from Genotech Co., South Korea. Construction of S. venezuelae YJ003-OTBP6.1 A pOTBP1 (Pageni et al. 2008) was constructed to integrate the essential genes for TDP-4-keto-6-deoxyglucose and to glycosidase novel deoxysugar to aglycon, which was transformed in S. venezuelae YJ003 generating novel strain S. venezuelae YJ003OTBP1. The integration of essential genes in genomic DNA of S. venezuelae YJ003-OTBP1 was verified by PCR analysis as well as southern blot

Nucleotides sequence (50 –30 )

Enzymes

NovSF

ATAGGTACCATGGAGCCCGCTCCCGTC

KpnI

NovSR NovWF

CTCGAATTCCTCGGTCGAGGACTACTACGA CACGAGCTCTTGAAGGAGGTGAAGCCGTC

EcoRI SacI KpnI

Primers

NovWR

ATAGGTACCTCACGGGCCCGGGTCTCC

NovUF

GTTTTTCGAAA TGAGGGGAAGGAAGAA

BstBI

NovUR

TATTCTAGAGCGCGGCCTTCGATG

XbaI

123

1612

analysis (data not shown). Streptomyces venezuelae YJ003-OTBP6.1 was generated after the transformation of pOTBP6.1 into S. venezuelae YJ003-OTBP1 by PEG-mediated protoplast transformation method (Kieser et al. 2000). Production and analysis of the noviosylated 10-deoxymethynolide/narbonolide Streptomyces venezuelae, S. venezuelae YJ003, and S. venezuelae YJ003-OTBP6.1 were grown on SPA solid medium at 30°C for 5 days in presence of antibiotics. The crude extract was extracted as previously described method (Pageni et al. 2008). Prior to performing HPLC analysis, a solid-phase extraction (SPE) cleanup column was employed to remove unwanted impurities, such as pigments and particles. About 10 ll of solvent extracts were analyzed using a reverse-phase C18 column (Mytstil RP-18, 4.6 9 250 mm 9 5 lm, Kanto Chemical Tokyo) with 80% (v/v) acetonitrile/water in 5 mM ammonium acetate buffer containing 0.05% (w/v) of acetic acid/water at 1 ml/min for over 65 min. Eluates were monitored at 220 nm. The products were analyzed with ESI/MS. TLC was also carried for the crude products of S. venezuelae, S. venezuelae YJ003 and S. venezuelae YJ003-OYBP6.1 (Pageni et al. 2008). LC/ MS and MS/MS were performed to obtain further structural information. Biological activity assay The antibacterial activity of S. venezuelae, S. venezuelae YJ003, S. venezuelae YJ003-OTBP1 and S. venezuelae YJ003-OTBP6.1 was assayed against Bacillus subtilis ATCC 23857 (Lee et al. 2006). Bacillus subtilis was initially grown on LB medium and aliquots of the grown culture were dispensed on LB agar-based medium. Each compound was reconstituted in an equal volume of methanol and dispensed into paper disks. An equal volume of methanol, as the negative control, was also dipped onto a paper disk. The dried disks were placed onto agar plates and incubated at 37°C for 8 h.

Results and discussion The novSWU genes are found upstream of gyrB and downstream of novR in the noviose biosynthetic gene

123


cluster from S. spheroides. The deduced amino acid sequence (288 aa) encoded by novS (GenBank accession no. AAF67512) shows its similarity to a number of 4-ketoreductases involved in deoxysugar biosynthesis (Thuy et al. 2005). NovW (207 aa, GenBank accession no. AAF67516) was characterized as 3,5-epimerase (Thuy et al. 2005) but recently, it has been characterized as 3-epimerase rather than 3,5-epimerase by in vitro assay identifying the 4-key residues (His62, Lys72, Tyr132 and Asp168) in the catalytic cycle (Tello et al. 2006). The protein (420 aa) encoded by NovU shows 88% identity with CloU (GenBank accession no. AAN65243) whose function was previously proved (Freitag et al. 2006b) and function of NovU is also expected as the C-5methyltransferases. Furthermore, the consensus motif for S-adenosyl-L-methionine (SAM)-binding site (114VVEFGSNTG122) found in NovU is in support of methyltransferase activity (Thuy et al. 2005). Noviose sugar genes novWUS were used to construct the Streptomyces-E. coli shuttle vector pOTBP6.1. After the transformation of pOTBP6.1 into S. venezuelae YJ003-OTBP1, plasmid DNA was isolated from transformants and novWUS genes in transformant were confirmed by PCR (data not shown). The production of 2 and 4 was checked by culturing S. venezuelae YJ003-OTBP6.1 in SPA agar media. Antibacterial assay of the noviosylated products from S. venezuelae YJ003-OTBP6.1 was tested against B. subtilis. Inhibition zone diameter was indicative of the antibacterial activity due to production of novel compounds 2 and 4 (Fig. 2a). Streptomyces venezuelae YJ003-OTBP1 also shows some slight antibacterial activity due to quinovosylated 10-deoxymethynolide/narbonolide in presence of a pathway-independent reductase of S. venezuelae (Borisova et al. 1999; Hong et al. 2004). The inhibition zone diameter shown by S. venezuelae YJ003OTBP6.1 (11.5 mm) is larger than the S. venezuelae YJ003-OTBP1 (3 mm) proving the generation novel bioactive compounds. TLC of crude product from S. venezuelae YJ003-OTBP6.1 is also in support of producing novel compounds 2 and 4 (data not shown). The crude extracts obtained from wild, mutant and transformants were further analyzed by HPLC, ESI/MS, LC/MS, and MS/MS. The HPLC profiles of the crude products from S. venezuelae YJ003-OTBP6.1 and S. venezueale were compared and found that both glycosylated macrolide


1613

Fig. 2 (a) Antibacterial activity assay of the crude products from S. venezuelae (I), S. venezuelae YJ003 (II), S. venezuelae YJ003OTBP1 (III) and S. venezuelae YJ003OTBP6.1 (IV). (b). Typical HPLC traces for the crude products from S. venezuelae (I), S. venezuelae YJ003 (II) and S. venezuelae YJ003OTBP6.1 (III)

compounds were observed at the same retention time range (Fig. 2b-III). HPLC analysis of crude products from S. venezuelae and S. venezuelae YJ003 were also compared and found that aglycone production dominates in S. venezuelae YJ003 as shown in Fig. 2b-II whereas the glycosylated products become major product in S. venezuelae (Fig. 2b-I). This result clearly demonstrated that S. venezuelae YJ003OTBP6.1 produces 2 and 4. The LC/MS analysis from S. venezuelae YJ003OTBP6.1 revealed that the molecular ion [M + NH+4 ] for 4 and 2 were detected at m/z = 531.2 and m/z = 475.4 respectively (data not shown). Furthermore, parent ion for 4, m/z = 513 [M + d + H+], its dehydrated form m/z = 495 [M + d - H2O + H+], aglycone (3) m/z = 352 [aglycon + H+], and deoxysugar m/z = 161 [d] from S. venezuelae YJ003OTBP6.1 was found from MS/MS analysis (Fig. 3a). Similarly, parent ion for 2, m/z = 457 [M + d + H+], its dehydrated form m/z = 440 [M + d -H2O + H+], aglycone (1) m/z = 296 [aglycon + H+], and deoxysugar m/z = 161 [d] for 2 from S. venezuelae YJ003-OTBP6.1 was also observed in MS/MS data (Fig. 3b). This fragmentation pattern is found consistent, which has made this research plausible. Streptomyces venezuelae is a suitable heterologous host for the expression of polyketide biosynthetic genes and deoxysugar genes (Xue and Sherman 2001). Development of the genetically engineered strain, S. venezuelae YJ003-OTBP1 validated the unique advantage of S. venezuelae as an attractive host for the production of novel glycosylated macrolides. The substrate flexibility of DesVII has also been demonstrated to accept TDP-D-olivose (TDP2,6-dideoxyhexose) during the glycosylation to the

aglycon, compound 1 and 3 (Borisova et al. 1999; Hong et al. 2004). In a recent in vitro study, the glycosylation of TDP-D-desosamine to compound 1 and 3 required the presence of an additional protein, DesVIII (Borisova et al. 2004). DesVII has also been shown to be flexible toward hybrid aglycones, to which the sugar is attached (Yoon et al. 2002). Analysis of amino acid sequences of DesVII, NovM and several glycosyltransferases involved in the biosynthesis of polyketides showed a very well conserved domain including histidine residue rich region. The histidine present in the conserved region could play important role in the catalytic activity of the enzyme and be important for substrate binding and transition state stabilization in some oligosaccharide-independent glycosyltransferases (Quiros et al. 2000). Sequence alignment of glycosyltransferase NovM from S. spheroides with DesVII from S. venezuelae shows identical consensus sequence motif as PX 3 RX 5 PX 3 LLPXCXAIXHHGGXGX 4 AX 4 VPQ (Wilson et al. 1998). So, current study reveals a step further about the flexibility of DesVII, which normally accepts desosamine deoxysugar, is also capable of accepting an unusual deoxysugar (noviose sugar), as substrate donor. The successful generation of 2 and 4 has further expanded the usefulness of glycosyltransferases as a tool for the generation of novel bioactive macrolides. We previously showed the incorporation of TDP-4-keto-6-deoxy-D-glucose, including C-4 amination onto the alternate polyketide aglycons 1 and 3 (Pageni et al. 2008). Furthermore, we also found that our system containing DesVII/DesVIII protein pair apparently catalyzes the transfer of 6-deoxy-TDPglucose (Quinovose) into 1 and 3 by using oleandrose deoxysugar genes and novU (data not shown).

123

1614


Fig. 3 MS/MS analysis of the noviosylated narbonolide (4, a) and the noviosylated 10-deoxymethynolide (2, b) produced from S. venezuelae YJ003-OTBP6.1

However, production level of the 2 and 4 is found relatively low (0.8 mg/l of each) and it requires further improvements in purification of crude products for the structure elucidation of 2 and 4 by NMR. Low yield of 2 and 4 may be due to lack of optimal expression during genetic construction and pathway enzymes may work less efficiently with structurally altered substrates (Floss 2006). Here, we are successful to express the deoxysugar genes from aminocoumarin antibiotics for the macrolide generating hybrid antibiotics by in vivo assay. The successful manipulation of the hybrid macrolides including 5,5-gem-dimethyldeoxysugar noviose in S. venezuelae YJ003-OTBP1 has further expanded the usefulness of unnatural biosynthetic sugars as a tool for combinatorial biosynthesis. Therefore, it is expected that this research will aid in the development of biosynthesis of macrolide bearing the unnatural biosynthetic deoxysugars and DesVII/DesVIII pair genes might be applied as

123

good substrate donor (flexible to various deoxysugars) towards glycosylation in future works. Acknowledgments This study was supported by the 21C Frontier Microbial Genomics and Application Center Program, Ministry of Science & Technology (Grant MG02-0301-004-23-1), Republic of Korea. We thank to Prof. L. Heide from Tu¨bingen University, Germany for providing the plasmid pMS62.

References Borisova SA, Zhao L, Melancon III CE et al (2004) Characterization of the glycosyltransferase activity of desVII: analysis of and implications for the biosynthesis of macrolide antibiotics. J Am Chem Soc 126:6534–6535 Borisova SA, Zhao L, Sherman DH et al (1999) Biosynthesis of desosamine: construction of a new macrolide carrying a genetically designed sugar moiety. Org Lett 15:133–136 Floss HG (2006) combinatorial biosynthesis-potential and problems. J Biotechnol 124:242–257

Biotechnol Lett (2008) 30:1609–1615 Freitag A, Li SM, Heide L (2006a) Biosynthesis of the unusual 5,5-gem-dimethyl-deoxysugar noviose: investigation of the C-methyltransferase gene cloU. Microbiology 152:2433–2442 Freitag A, Mendez C, Salas JA et al (2006b) Metabolic engineering of the heterologous production of clorobiocin derivatives and elloramycin in Streptomyces coelicolor M512. Metab Eng 8:653–661 Hong JSJ, Park SH, Choi CY et al (2004) New livosyl derivatives of methymycin/pikromycin from an engineered strain of Streptomyces venezuelae. FEMS Microbiol Lett 238:391–399 Kieser T, Bibb MJ, Butbler MJ et al (2000) Practical streptomyces genetics. John Innes Foundation, Norwich Lee SK, Park JW, Kim JW et al (2006) Neopikromycin and novapikromycin from the pikromycin biosynthetic pathway of Streptomyces venezuelae. J Nat Prod 69:847–849 Maxwell A (1999) DNA gyrase as a drug target. Biochem Soc Trans 27:48–53 Melancon III CE, Liu HW (2007) Engineered biosynthesis of macrolide derivatives bearing the non natural deoxysugars 4-epi-D-mycaminose and 3-N-monomethylamino-3deoxy-D-fucose. J Am Chem Soc 129:4896–4897 Pageni BB, Oh TJ, Liou K et al (2008) Genetically engineered biosynthesis of macrolide derivatives including 4-amino4,6-dideoxy-L-glucose from Streptomyces venezuelae YJ003-OTBP3. J Microbiol Biotechnol 18:88–94 Quirose LM, Carbajo JR, Salas JA (2000) Inversion of the anomeric configuration of the transferred sugar during inactivation of the macrolide antibiotic oleandomycin catalyzed by a macrolide glycosyltransferase. FEBS Lett 476:186–189 Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor

1615 Steffensky M, Muhlenweg A, Wang ZX et al (2000) Identification of the novobiocin biosynthetic gene cluster of Streptomyces spheroides NCIB 11891. Antimicrob Agents Chemother 44:1214–1222 Tello M, Jakimowicz P, Errey JC et al (2006) Characterization of Streptomyces spheroides NovW and revision of its functional assignment to a dTDP-6-deoxy-D-xylo-4-hexulose 3-epimerase. Chem Commun 1079–1081 Thuy TTT, Lee HC, Kim CG et al (2005) Functional characterizations of novWUS involved in novobiocin biosynthesis from Streptomyces spheroides. Arch Biochem Biophys 436:161–167 Weymouth-Wilson FC (1997) The role of carbohydrates in biologically active natural products. Nat Prod Rep 14:99–100 Wilkinson CJ, Hughes-Thomas ZA, Martin CJ et al (2002) Increasing the efficiency of heterologous promoters in actinomycetes. J Mol Microbiol Biotechnol 4:417–426 Wilson VTW, Cundliffe E (1998) Characterization and targeted disruption of a glycosyltransferase gene in the tylosin producer, Streptomyces fradiae. Gene 214: 95–100 Xue Y, Sherman DH (2001) Biosynthesis and combinatorial biosynthesis of pikromycin- related macrolides in Streptomyces venezuelae. Metab Eng 3:15–26 Xue Y, Zhao L, Liu HW et al (1998) A gene cluster for macrolide antibiotic biosynthesis in Streptomyces venezuelae: Architecture of metabolic diversity. Proc Natl Acad Sci USA 95:12111–12116 Yoon YJ, Beck JB, Kim BS et al (2002) Generation of multiple bioactive macrolides by hybrid modular polyketide synthases in Streptomyces venezuelae. Chem Biol 9:203–214

123