The FASEB Journal • Research Communication
Metal-responsive transcription factor-1 (MTF-1) is essential for embryonic liver development and heavy metal detoxification in the adult liver YING WANG, URSULA WIMMER, PETER LICHTLEN, DANIEL INDERBITZIN,* BRUNO STIEGER,* PETER J. MEIER,* LUKAS HUNZIKER,† THOMAS STALLMACH,‡ ¨ LICKE,円円 OLEG GEORGIEV, AND WALTER SCHAFFNER1 RHEA FORRER,§ THOMAS RU Institute of Molecular Biology, *Division of Clinical Pharmacology and Toxicology, Department of Internal Medicine, †Institute of Experimental Immunology, †Institut fu¨r Klinische Pathologie, § Veterina¨rmedizinisches Labor,兩兩 Biologisches Zentrallabor, University of Zurich, Switzerland Metal-responsive transcription factor-1 (MTF-1) activates the transcription of metallothionein genes and other target genes in response to heavy metal load and other stresses such as hypoxia and oxidative stress. It also has an essential function during embryogenesis: targeted disruption of Mtf1 in the mouse results in lethal liver degeneration on day 14 of gestation. Here we studied Mtf1 knockout mice at embryonic and adult stages, the latter by means of conditional knockout. Hepatocytes from Mtf1 null mutant and wild-type embryos were taken into culture on day 12.5 of gestation. Both initially appeared normal, but mutant cells were lost within a few days. Furthermore, Mtf1 null hepatocytes were poorly, if at all, rescued by cocultivation with wild-type rat embryo hepatocytes, indicating a cell-autonomous defect. When the Mtf1 gene was excised by Cre recombinase after birth in liver and bone marrow and to a lesser extent in other organs, mice were viable under non-stress conditions but highly susceptible to cadmium toxicity, in support of a role of MTF-1 in coping with heavy metal stress. An additional MTF-1 function was revealed upon analysis of the hematopoietic system in conditional knockout mice where leukocytes, especially lymphocytes, were found to be severely underrepresented. Together, these findings point to a critical role of MTF-1 in embryonic liver formation, heavy metal toxicity, and hematopoiesis.— Wang, Y., Wimmer, U., Lichtlen, P., Inderbitzin, D., Stieger, B., Meier, P. J., Hunziker, L., Stallmach, T., Forrer, T., Ru¨licke, T., Georgiev, O., Schaffner, W. Metal-responsive transcription factor-1 (MTF-1) is essential for embryonic liver development and heavy metal detoxification in the adult liver. FASEB J. 18, 1071–1079 (2004)
ABSTRACT
Key Words: heavy metal stress 䡠 cadmium toxicity 䡠 hematopoiesis 䡠 conditional knockout The "metal-responsive transcription factor-1" MTF-1 (also termed metal regulatory transcription factor, or metal response element binding transcription factor) plays an important role in the cellular response 0892-6638/04/0018-1071 © FASEB
to heavy metal load and contributes to the cellular response to other stress. MTF-1 is a protein with six zinc fingers and is conserved from humans to insects; its best-characterized targets are those that code for metallothioneins (MTs), small cysteine-rich proteins (1– 5). Metallothioneins bind heavy metals with high affinity and are involved in heavy metal homeostasis/ detoxification and radical scavenging (6). MTF-1 binds via its zinc fingers to so-called metal response elements (MREs), DNA motifs of core consensus TGCRCNC present in multiple copies in the promoters of all Mt genes and other target genes of MTF-1. In the mouse, MTF-1 seems to be particularly important for the induction of two stress-inducible metallothionein genes, Mt-I and Mt-II, in response to heavy metal load (7, 8). Other target genes of the ubiquitously expressed MTF-1 include those for ZnT1, a zinc exporter pump, tear albumin/lipocalin, and C/EBP␣ (9, 10). Under hypoxic conditions, MTF-1 contributes to the expression of placental growth factor (PlGF), an angiogenic factor expressed in many tumors (11–13). Targeted gene disruption of the Mtf1 locus in the mouse causes embryonic lethality at midgestation ⬃14 days postcoitum (p.c.) due to liver degeneration (14). A gross effect on the central nervous system (CNS) could be excluded by a transplantation experiment whereby neuroectoderm from 12.5-day embryos was grafted onto the brain of adult mice. Mutant and wild-type tissues survived, and cells containing or lacking Mtf1 were able to differentiate into several major cell types of the CNS (15). Fibroblasts from 12.5-day embryos survived in culture but were more susceptible to the cytotoxic effects of cadmium and H2O2 (14). In this paper we demonstrate that the embryonic liver phenotype is caused by a cell-autonomous defect at the hepatocyte level. To further explore the function of MTF-1 in adult mice, we generated Mtf1 conditional 1 Correspondence: Institute of Molecular Biology, Winterhurerstr. 190, Universita¨t Zu¨rich, 8057 Zu¨rich, Switzerland. E-mail:
[email protected] doi: 10.1096/fj.03-1282com
1071
knockout mice where Mtf1 was deleted in the liver, bone marrow, and to various degrees in some other tissues after birth. Mice lacking Mtf1 in the liver survive well under non-stress conditions but exhibit increased sensitivity to cadmium intoxication, revealing a function of MTF-1 distinct from its role in embryonic liver development. Conditional knockout mice displayed an abnormality in hematopoiesis, with significantly reduced total leukocytes, especially lymphocytes. Together, these results establish the role of MTF-1 in the response to heavy metals and reveal a new aspect of MTF-1 function in the hematopoietic system.
MATERIALS AND METHODS Embryonic hepatocyte culture Fetuses were removed from pregnant Mtf1⫹/⫺ mice on day 12.5 of gestation by cesarean section under anesthesia, one at a time, and placed in phosphate-buffered saline (PBS). Livers were then isolated and disrupted by pipetting 30 times in 500 L culture medium (see below) supplemented with 5% FBS medium. Culture (100 L) containing ⬃106 cells were plated in one well of a 24-well plate precoated with MATRIGEL (Becton Dickinson labware, Franklin Lakes, NJ, USA). Cells were kept at 37°C in a humidified incubator with 5% CO2 and the medium was renewed every 24 h. The rest of the embryo was used for genotyping. For rat and mouse embryonic hepatocyte cocultivation, each 12.5-day mouse embryonic liver was mixed with half of a 12.5-day rat embryonic liver such that the rat cell to mouse cell ratio was ⬃1:1. The culture medium was a 1:1 volume mixture of Ham's F12 (Gibco 21765-011) and Williams E medium (Amimed 1-48f02-I) supplemented with 1% l-glutamine (Sigma, St. Louis, MO, USA), 0.03225 mg/mL l-proline (Sigma), 1.67% (V:V) ITS (insulin/transferrin/selen) (Gibco 51500-056), 0.1 M vitamin C, and 10⫺7 M dexamethasone. Cell samples were collected at the indicated time intervals. In the coculture experiment, the first samples were analyzed within a few hours of removing the embryonic livers. Reconstitution of hematopoiesis in irradiated mice Embryonic livers (13.5 days) were freshly isolated on a sterile bench in a ventilated hood. Livers were kept in 1 mL cold DMEM medium. The remainder of each embryo was used for genotyping. Cells were isolated from livers by incubating disrupted liver in 1⫻ trypsin-EDTA at 37°C for 30 min. Wild-type mice were irradiated 24 h before the experiment and received whole-body irradiation (9.5 Gy). Wild-type, Mtf1⫹/⫺, and Mtf1⫺/⫺ liver cells were injected intravenously into the irradiated mice; control mice were injected with PBS. All mice were kept under specific pathogen-free conditions (SPF). Blood samples were taken after 4 months and the blood cell lineage was analyzed by FACS. Tissue processing, histology, and blood analysis For tissue processing and histological studies, mouse embryos or tissues were fixed in 4% formalin; 24 h later the tissues were dehydrated in graded ethanol and embedded in paraffin blocks for sectioning with a microtome and staining with hematoxylin-eosin (H&E). To detect apoptotic cells, consecutive slides were stained using "in situ cell death detection kit, fluorescein" (Roche, Nutley, NJ, USA). For blood analysis, blood was drawn from the orbital sinus under anesthetization 1072
Vol. 18
July 2004
and collected in heparin- or EDTA-containing tubes. Blood cell counting was done with the automated analyzer CELLDYN (Abbott, Abbott Park, IL, USA). RT-PCR Total RNA was isolated using either TRIzol reagent (Life technologies, Grand Island, NY, USA) or QIAGEN RNeasy kit (Qiagen, Chatsworth, CA, USA) according to the manufacturer’s protocol. DNaseI digestion was performed after RNA isolation. RT-PCR was performed using QIAGEN OneStep RT-PCR kit (Qiagen), with ⬃100 ng total RNA. Primers used were: for mouse AFP (AT⫽57°C): 5⬘ CGAAACCTCCAGGCAACAAC 3⬘; 5⬘ GCAGAAGCCTAGTTGGATCA 3⬘; for rat AFP (AT⫽57°C): 5⬘ CGGAATCTCCAGGCTGTACT 3⬘; 5⬘ TGTCCTGGCATTTCGATGGCG 3⬘; for mouse CPS (AT⫽55°C): 5⬘ ATGACGAGGATTTTGACAGCTTGCAAAG 3⬘; 5⬘ CCACTTCACCAGCAACA 3⬘; for rat CPS (AT⫽55°C): 5⬘ ATGACGAGGATTTTGACAGCTTGCAAAG 3⬘; 5⬘ TCACGTGCCGTTGTATCAGGG 3⬘; for GAPDH (AT⫽58°C): 5⬘ TCGGAGTCAACGGATTTGGTCGTA 3⬘; 5⬘ ATGGACTGTGGTCATGAGTCCTTC 3⬘; for cMTF-1 (MTF-1 cDNA) (AT⫽ 58°C): 5⬘ TTAGACGAAGCTTGGGCTGCAGG 3⬘; 5⬘ CAATGTTTCTTGGCATGGGTGTG 3⬘. Generation of MTF-1 cDNA rescue mice and liver-specific deletion mice Plasmid pUbi-JunB was a gift from Dr. Erwin F. Wagner. The JunB coding sequence was substituted with mouse MTF-1 cDNA; two additional loxP sites were introduced by standard procedure using primers: 5⬘TATGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGTTAACGT 3⬘; 5⬘TAACGTTAACATAACTTCGTATAATGTATGCTATACGAAGTTATGCGGCCGCA3⬘. (Detailed information is available upon request.) The plasmid pUbiMTF2xloxP was linearized by digestion with Bgl II and the fragment was injected into the male pronuclei of fertilized eggs from Mtf1⫹/⫺ intercrossing according to standard methods. Mice from cDNA rescue line Mtf1⫺/⫺Tg were crossed with Mx-Cre mice (a gift from Dr. Michel Aguet). Starting at postnatal day 5 or 6, all littermates, including KoTg control mice, were injected (four times, with 3-day intervals) intraperitoneally with 100 g (total volume 20 L in PBS) polyinosinic-polycytidylic acid (polyI/C; Sigma) to induce expression of Cre recombinase. They were genotyped by PCR using primer pairs: Mtf1 wt allele: 5⬘ TGT CTT ACT GAT GAG GTG TC 3⬘; 5⬘ GCT CTT CAA AGT CCC AAA TG 3⬘; Mtf1 KO allele: 5⬘GATCGGCCATTGAACAAGATG 3⬘; 5⬘CCTGATGCTCTTCGTCCAGATC 3⬘; MTF-1 transgene: 5⬘CACATTATCTCACCAGATCAGATTC3⬘; 5⬘CTG TTC TCC CAT GAC TAG GCT G 3⬘; Mx-Cre: 5⬘ CTA TCC AGC AAC ATT TGG GCC AGC 3⬘; 5⬘CCA GGT TAC GGA TAT AGT TCA TGA C 3⬘.
The FASEB Journal
WANG ET AL.
A complete excision of cMTF-1 in the liver (and in white blood cells; see below) was reached by repeated injection of double-stranded RNA (polyI/C). Excision of the MTF-1 transgene led to transient formation of extracellular circles, which were diluted out by the ensuing liver cell proliferation. Cadmium and zinc toxicity test Cadmium was injected subcutaneously (s.c.) rather than added to the drinking water to better control the dosage (16). For the cadmium toxicity test, 7 KoTgCre mice (Mtf1 knockout, MTF-1 cDNA, Mx-Cre; 4 males and 3 females) and 12 KoTg (Mtf1 knockout, MTF-1 cDNA; 8 males and 4 females), all 8 –16 wk old, were injected s.c. with CdSO4 in PBS, 10 mol/kg body weight (b.w.) for 4 days, and 20 mol/kg for 5 days. To determine total amounts of cadmium in livers, kidneys, and brains from cadmium-treated mice, tissues were submitted to an oxidative acid digestion in a microwave oven and measured by ICP-MS. To test zinc toxicity, 12- to 14-wk-old female mice were injected s.c. for 7 consecutive days with increasing doses of ZnCl2 in PBS (Sigma). On days 1, 2, and 3, KoTg (n⫽3) and KoTgCre (n⫽3) mice received 200, 300, and 400 mol/kg b.w., respectively. On days 4 and 5, mice received 600 mol/kg b.w. and on days 6 and 7, 800 mol/kg b.w. EMSA assay Liver extracts were prepared using tissue protein extraction reagent T-PERTM (Pierce, Rockford, IL, USA). EMSA (electrophoretic mobility shift assay) was performed as described (17, 18). Binding reactions were performed by incubating 2–5 fmol end-labeled, 31 bp-long MRE-s-containing oligonucleotides with liver extracts. Identification of the MTF-1 binding was performed by using wild-type control liver extracts in the presence or absence of an MRE-s-containing oligonucleotide.
RESULTS Abnormal liver structures in Mtf1 knockout embryos but no sign of apoptosis For a more detailed investigation of the embryonic liver degeneration in Mtf1 null mutant embryos (14), we analyzed Mtf1 knockout (KO) livers using several different histological tools. H&E staining of Mtf1 null mutant livers revealed enlarged sinusoids and a tendency of hepatocytes to form irregular patches of cells, some in the process of necrosis. White blood precursor cells as well as erythroid cells appeared morphologically normal in wild-type and KO livers (Fig. 1A). We checked for hepatic apoptosis by the TUNEL assay and found no evidence of elevated apoptosis in KO livers (Fig. 1B). Primary embryonic hepatocyte culture indicates mutant hepatocyte defect is cell autonomous To test hepatocyte viability in Mtf1 KO mice, we cultured hepatocytes from single embryonic livers. Wildtype (wt), Mtf1⫹/⫺, and Mtf1⫺/⫺ embryonic livers were isolated on day 12.5 p.c. and grown ex vivo. Cells were collected at intervals on days 2, 4, 6, and 8 of culture. LIVER FORMATION AND HEAVY METAL HANDLING VIA MTF-1
Figure 1. Mtf1⫺/⫺ embryonic livers from day 13.5 p.c. have features that are distinguishable from the wild-type livers. A) Embryonic livers from day 13.5 p.c. were sectioned and stained with hematoxylin-eosin. The KO embryonic liver contains enlarged sinusoids with a disrupted epithelial cell pattern. Many hepatocyte-like cells and their nuclei are enlarged and tend to form contiguous patches. In the enlarged field of the KO embryo, white arrows indicate from top to bottom, enlarged nucleus of hepatocyte presumably undergoing necrotic cell death, hepatocyte-like cell of normal appearance, and hematopoietic cells. B) TUNEL staining for apoptosis reveals no obvious differences between KO and wt embryonic livers.
Expression of several liver-specific markers—AFP (␣fetoprotein) (19), HNF4 (hepatocyte nuclear factor 4) (20), and CPS (carbamoyl phosphate synthetase) (21)—was determined by RT-PCR. Liver cells from wild-type mouse embryos grew to confluency within 2 days in microwell culture. By contrast, Mtf1 KO liver cultures appeared normal at first but cell density decreased rapidly. In fact, in some microwells most of the Mtf1⫺/⫺ cells were lost after several days whereas in others the remaining cells lacked hepatocyte morphology (Fig. 2A). Wild-type embryonic liver cultures expressed all three liver markers tested: HNF4 expression was strong throughout the entire culture period (data not shown), whereas two independent wild-type cultures showed increasing expression of AFP and CPS from day 2 to day 8 (Fig. 2B). Thus, we conclude that wild-type hepatocytes survive for at least 8 days in culture and maintain their differentiation state. None of the above liver markers could be detected from liver cultures lacking Mtf1, even if total cell RNA was normalized to the transcripts of a ubiquitously expressed gene (GAPDH) (Fig. 2B). These results indicate that Mtf1⫺/⫺ hepatocytes are intrinsically less viable than their wild-type counterparts. To ascertain whether the hepatocyte defect was cell autonomous or could be rescued by normal hepatocytes, we cocultivated wild-type rat hepatocytes with Mtf1⫺/⫺ mouse hepatocytes. In each culture, cells from 12.5-day embryonic liver of a wild-type, an Mtf1⫹/⫺, or 1073
an Mtf1⫺/⫺ embryo were cocultivated with half of a 12.5-day wild-type rat embryo liver. Hepatocytes were found to proliferate and reach confluency after 1 or 2 days; no obvious difference could be observed by microscopic inspection between wt, heterozygous, and KO cocultures (Fig. 2C). Cells were collected at different time intervals, and expression of the embryonic liver-specific markers AFP and CPS was checked by RT-PCR using specific primers that selectively amplified rat or mouse genes. Rat liver cells cultured alone were used as control. They grew well and expressed all liver markers throughout the entire period in culture. Wild-type mouse liver cells from each coculture expressed mouse-specific AFP and CPS (mAFP and mCPS). This indicates that wild-type mouse cells can readily survive and maintain their hepatocyte identity in the presence of rat hepatocytes. By contrast, expression of mAFP decreased in Mtf1 null mutant hepatocytes at an early stage and the signal had disappeared by day 8 in KO cultures. For mCPS, no significant expression could be detected in KO cells even shortly after removing the liver from the embryo or at a later time (Fig. 2D). We conclude that in spite of the presence of healthy rat hepatocytes, there is at most a minor rescue effect for the KO hepatocytes. A straightforward explanation of these findings is that the loss of hepatocytes in Mtf1⫺/⫺ embryos is a cell-autonomous effect, and strongly indicates this to be the primary cause of embryonic lethality (see Discussion). Embryonic hematopoiesis still compatible with disruption of Mtf1
Figure 2. Primary embryonic hepatocyte cultures (A) wt and KO hepatocytes from 12.5-day mouse embryos were cultured for 8 days. In wild-type hepatocyte cultures, hepatocytes maintained their characteristic morphology of spherical cells and formed tight clusters in the culture. By contrast, cell density was low in KO cultures and cultured cells lost their hepatocyte morphology. B) RT-PCR using total RNA from hepatocyte cultures. Expression of hepatocyte markers AFP and CPS was undetectable in the KO culture whereas wt cells expressed the markers throughout their time in culture, as measured by RT-PCR. C) 12.5-day mouse embryonic hepatocytes were cocultured with 12.5-day rat embryonic hepatocytes. Rat/Mtf1⫹/⫹ mouse and rat/Mtf1⫺/⫺ mouse cocultures appeared to be similar. D) Cells were collected on days 0, 2, 4, 6, and 8. Mouse hepatocyte signals for mAFP and mCPS were barely visible or absent from the rat/Mtf1⫺/⫺ mouse cocultures; therefore, the coculture shown in panel C (right-hand side) must have consisted essentially of rat hepatocytes. Rat AFP and rat CPS genes were used as control to normalize the input material for RT-PCR.
1074
Vol. 18
July 2004
During embryogenesis, hematopoiesis first occurs in the yolk sac. After midgestation, blood stem cells migrate to the embryonic liver. The fetal liver produces blood cells until shortly before birth, when the bone marrow takes over as the site of hematopoiesis (22). Several knockout mouse strains with embryonic liver defects, including those for c-Met, c-Jun, XBP, and NF-B, display a deficiency in the hematopoietic system (23–27). Therefore, we performed an experiment to see whether the Mtf1 KO liver is able to reconstitute long-term hematopoiesis. Livers from day 13.5 p.c. of wild-type, Mtf1⫹/⫺, and Mtf1⫺/⫺ mouse embryos were isolated, dissociated, and transplanted onto lethally irradiated wild-type recipient mice via intravenous injection. All 20 mice receiving embryonic liver cells survived, whereas all control mice who received a PBS injection died within 10 days. Genotyping of donor embryos performed after cell injection revealed that 6 were wild-type, 13 heterozygous, and 1 was an Mtf1 KO. Four months later, the origin of blood cells in the recipient mice was checked by PCR genotyping. A ⬍5% wild-type signal was detectable in the KO liver recipient by PCR using DNA from peripheral blood cells (Fig. 3A). The fact that one mouse receiving Mtf1⫺/⫺ liver cells also survived indicates that Mtf1⫺/⫺ cells could, in principle, contribute to reconstitution of the hematopoietic system. FACS analysis using B cell-specific mark-
The FASEB Journal
WANG ET AL.
(data not shown). That the MTF-1 cDNA was able to rescue the liver degeneration phenotype is compelling evidence that the Mtf1 KO phenotype is caused by deletion of the Mtf1 gene rather than a secondary effect, such as an interference with the expression of a neighboring gene. After birth, deletion of Mtf1 from liver is no longer lethal
Figure 3. Mtf1⫺/⫺ embryonic hematopoietic cells can reconstitute hematopoiesis in adult mice. A) Irradiated mice received embryonic liver cells to reconstitute the hematopoietic system. Four months after transplantation, recipient mice were bled and genotyped by PCR with primers that distinguished between wild-type and mutant (KO) alleles. 95% of blood cells from KO liver recipient consisted of Mtf1⫺/⫺ cells. B) FACS analysis using blood from the recipient mice revealed no obvious difference between wt and KO hematopoietic precursor cells. B220, CD19 B cells markers; CD4 and CD8, T cell markers; Mac1, macrophage marker.
ers CD19 and B220, T cell-specific markers CD4 and CD8, and a macrophage-specific marker, MAC1, revealed that Mtf1⫺/⫺ liver cells had the potential to supply these types of cells (Fig. 3B). Their immunological competence was not challenged in this experiment, since all mice were maintained under SPF conditions. FACS analysis of just two mice— one reconstituted with KO, the other with wild-type embryonic liver cells— did not permit reliable quantification of immune cells. Subsequent analyses of Mtf1 conditional knockout mice, however, revealed an underrepresentation of peripheral blood leukocytes (see below). MTF-1 cDNA transgene fully rescues the KO phenotype Disruption of Mtf1 causes embryonic lethality at midgestation due to liver degeneration. To test whether this phenotype is indeed caused by the deletion of Mtf1, we generated transgenic mice expressing an MTF-1 cDNA gene in a conventional Mtf1 KO background. A plasmid containing MTF-1 cDNA under the control of the human ubiquitin promoter/enhancer and flanked by two loxP sites (pUbiMTF2xloxP) was injected into zygotes from Mtf1 heterozygous crosses (Fig. 4A). Subsequently, mice homozygous for Mtf1 knockout expressing MTF-1 cDNA transgene (KoTg) were generated by more crosses. These mice turned out to be viable and reproduced normally under laboratory conditions. EMSA indicated that the MTF-1 levels were very similar in the livers of KoTg mice and wild-type mice LIVER FORMATION AND HEAVY METAL HANDLING VIA MTF-1
We generated Mtf1⫺/⫺TgCre (KoTgCre) mice by crossing KoTg mice with Mx-Cre mice. Mx-Cre transgenic mice express Cre recombinase under the Mx1 (interferon-inducible protein p78, IFI78) gene promoter, which is inducible by interferon-␣, interferon-, or double-stranded RNA. Cre-mediated gene deletion was reported to be complete in liver and bone marrow and to vary in different organs—for example, from 8% excision efficiency in the brain, to 40% in the kidney and 94% in the spleen (1, 2). For induction of Cre recombinase, mice of both genotypes (KoTgCre and KoTg) were injected several times with synthetic double-stranded RNA (polyI/C) starting at postnatal day 5 or 6. Expression of the MTF-1 cDNA transgene in KoTgCre mice was verified by RT-PCR using a primer pair hybridizing specifically to the transcript generated from MTF-1 cDNA but not with the endogenous MTF-1 transcript. PolyI/C-induced mice had no detectable cMTF-1 expression in their livers and blood cells whereas expression in brain, kidney, heart, lung, and testis was reduced to various degrees, in agreement with previous studies (Fig. 4B) (1). Consistent with deletion of the gene and loss of mRNA, no MTF-1-specific DNA binding activity could be detected in KoTgCre liver extract by EMSA (Fig. 4C). KoTgCre mice were found to be viable under laboratory conditions. H&E staining of adult liver sections from KoTgCre mice revealed no abnormality in overall liver structure; hepatocytes formed cords separated by sinusoids, which were lined by flattened endothelial cells (Fig. 4D). To further characterize adult liver function in conditional knockout mice, blood concentrations of common markers of liver damage, AST (aspartate aminotransferase), ALT (alanine aminotransferase), and AP (alkaline phosphatase) were determined. The KoTgCre group mice displayed normal AST and ALT levels and a mild (60%) increase in AP relative to the control group KoTg (data not shown). Cadmium sensitivity of mice with selective Mtf1 deletion in the liver MTF-1 regulates basal and heavy metal-induced expression of mouse metallothioneins, notably Mt-I and Mt-II. Another prominent target gene of MTF-1 is the one for ZnT1 (zinc transporter 1), which exports zinc from the cytoplasm and thus protects cells from zinc toxicity (10). To test the contribution of MTF-1 on zinc and cadmium detoxification, we challenged conditional 1075
Figure 4. Deletion of Mtf1 in adult mice. A) A transgene with MTF-1 cDNA under the control of the human ubiquitin promoter/ enhancer and flanked by 2 loxP sites was introduced into Mtf1 KO mice and could rescue the KO phenotype. B) Control mice (KoTg) and conditional knockout mice (KoTgCre) were injected (four times, with 3-day intervals) intraperitoneally with 100 g/kg polyI/C starting from postnatal day 5 or 6. After polyI/C treatment, different tissues from conditional knockout (KoTgCre) and control (KoTg) mice were checked by RT-PCR for expression of cMTF-1. C) EMSA using liver extract revealed a lack of MTF-1 protein in KoTgCre mouse livers, whereas another ubiquitous transcription factor (Sp1) was not affected. Wt mouse and rat livers were used as controls. D) Histological analysis of livers from KoTg and KoTgCre mice.
knockout mice that lacked Mtf1 in the liver with zinc or cadmium (28) (see Materials and Methods). Cadmium treatment was lethal for all male KoTgCre mice, whereas all male KoTg control mice survived without any symptoms. From the female group, two female KoTgCre mice and one control KoTg mouse died during the experiment. Histological analysis of dead mice revealed massive cell degeneration and necrotic cells in liver, lung, and pancreas. The brain was not obviously affected (not shown), probably because the brain-blood barrier protects the CNS from cadmium influx (see Fig. 5). These results suggest that loss of Mtf1 in the liver, and possibly partial loss in other organs, renders the mice susceptible to cadmium toxicity. Measurement of total metal concentration using ICP-MS demonstrated that, compared with their KoTg mice littermates, KoTgCre mice had accumulated considerably less cadmium in their livers and kidneys than the control mice. In KoTgCre male mice, the total amount of accumulated cadmium was reduced 3-fold in livers and 1.7-fold in kidneys (Fig. 5A) compared with the control mice. The female KoTgCre mice had accumulated 2-fold less in the livers and 1.6-fold less in the kidneys (Fig. 5B). Since metal-loaded metallothioneins are preferentially accumulating in liver and kidney, these data are in line with a severely reduced expression of metallothioneins in cells lacking Mtf1 (see Discussion). We also tested the effect of increasing doses of zinc (200 – 800 mol/kg). However, control and KoTgCre mice both survived well under these conditions (data not shown; for details of protocol, see Materials and Methods). More studies are required to determine whether there is any difference in zinc sensitivity between wild-type and conditional knockout animals. 1076
Vol. 18
July 2004
Leukocyte deficiency in Mtf1 conditional knockout mice PCR genotyping revealed virtually complete excision of the MTF-1 cDNA transgene in KoTgCre blood cells (data not shown). To check how the loss of Mtf1 affects blood cell function and survival, we quantified the blood cells in these mice. Mtf1 conditional knockout mice (n⫽7, 4 males and 3 females) displayed one-third
Figure 5. KoTgCre mice accumulate less cadmium than control mice. Despite greater sensitivity to cadmium, KoTgCre mice have accumulated relatively low amounts of cadmium, as revealed by ICP-MS metal determination. A) Cadmium concentrations (g/g) determined in livers, kidneys, and brains of cadmium-treated male mice KoTgCre (n⫽4), KoTg (n⫽4). B) Cadmium concentrations (g/g) in livers, kidneys, and brains of cadmium-treated female mice, KoTgCre (n⫽3), KoTg (n⫽4).
The FASEB Journal
WANG ET AL.
of the amount of white blood cells compared with the control group, KoTg mice (n⫽8, 4 male and 4 females) (Fig. 3), whereas the amounts of erythroid cells and platelets were similar between the two mouse groups (data not shown). Blood differentiation assays demonstrated that in the conditional KO mice, the lymphocyte population was particularly severely reduced; monocyte and neutrophil populations dropped in proportion to total white blood cells (Fig. 6).
DISCUSSION Even though the "metal-responsive transcription factor-1" MTF-1 apparently is ubiquitously expressed at all stages of life, disruption of the Mtf1 gene in the mouse is specifically associated with embryonic lethality due to liver degeneration at midgestation ⬃14 days p.c. (14). Whatever the mechanism of liver degeneration, it was already established it could not be due entirely to the lack of stress-induced metallothioneins, since knockout of metallothionein genes Mt-I and Mt-II yielded viable mice under laboratory conditions (16, 29). We were interested to see whether the primary cause of lethality was a cell-intrinsic defect of hepatocytes, a developmental defect that precluded the formation of an orderly liver structure, or a defect in other cell types resulting in the lack of a direct signal or a diffusible factor (hormone) required for embryonic liver development. The first time point “day 0” revealed a weak expression of AFP in the Mtf1 KO (Fig. 2D). AFP is an early hepatocyte marker whose full expression is known to depend on MTF-1 (9). This indicates that the culture initially contained hepatocytes, possibly already compromised in their differentiation potential as suggested by the lack of detectable CPS, another hepatocyte marker. Such hepatocytes, however, disappeared soon during culturing and, in some cases, were replaced by fibroblast-like cells. At present we do not know whether
Figure 6. Deficiency in hematopoiesis in KoTgCre mice Total numbers (cells/L blood) of leukocytes, lymphocytes, neutrophils, and monocytes from conditional knockout (KoTgCre, n⫽7) and control (KoTg, n⫽8) mice. Blood was drawn from the orbital sinus under anesthetization and collected in heparin-containing tubes. LIVER FORMATION AND HEAVY METAL HANDLING VIA MTF-1
the latter represented dedifferentiated/transdifferentiated hepatocytes or overgrowth of a minority cell population. Therefore, Mtf1⫺/⫺ embryos most likely suffer from a hepatocyte-autonomous defect, which in cell culture can be at most somewhat delayed by coculture with healthy rat liver cells. (An alternative explanation for the complementation failure—an incompatibility between mouse and rat hepatocytes— seems highly unlikely to us.) Because adult mice lacking Mtf1 in the liver survive well under non-stress conditions, the defect apparently is at an embryonic differentiation step, rather than a failure to detoxify cellular components. Organogenesis of the liver requires proper control of proteins that also have a role in various forms of cell stress response, like c-Jun, XBP, SEK, HGF/SF, c-Met, and Rel-A. Mice mutated in any of these genes show similar embryonic liver degeneration phenotypes, namely, parenchymal hypoplasia and apoptosis in hepatocytes (24, 25, 30 –34). However, MTF-1 probably does not belong to this signaling cascade(s), since Mtf1⫺/⫺ hepatocytes do not undergo apoptosis and there is no sign of hematopoietic failure, a phenotype shared by null mutants of most of the proteins mentioned above (23–25, 30). In contrast, histology of precrisis livers on day 12.5 p.c. revealed a normal representation of hematopoietic cells; cells from an embryonic KO liver were able to reconstitute the hematopoietic system of a recipient mouse. From this we conclude that the embryonic hematopoietic system is not significantly affected by the lack of MTF-1. As mentioned, we noted the absence, from the earliest time point of the culture period, of transcripts for a well-established liver marker, carbamoyl phosphate synthetase (CPSase I; EC 6.3.4.16), which catalyzes the first step of the urea cycle in mitochondria. Thus the gene encoding this enzyme might be a direct or indirect target of MTF-1 (see ref 9 for other targets). CPSase deficiency by itself, however, is unlikely to cause the loss of Mtf1 null mutant hepatocytes, since mice and humans lacking this essential enzyme survive until after birth (35). Deletion of the Mtf1 gene in adult mouse liver by conditional knockout did not obviously affect a major liver function under laboratory conditions and in the absence of heavy metal stress. Cell culture data had indicated before that MTF-1 is important for metal detoxification: fibroblasts derived from Mtf1⫺/⫺ embryos displayed increased sensitivity to cadmium and to H2O2 cytotoxicity (14). The in vivo data from conditional Mtf1 knockout mice presented here reveal an essential role of MTF-1 in heavy metal detoxification: in spite of normal viability under laboratory conditions, KoTgCre mice are sensitive to cadmium toxicity. Intoxication symptoms 1–2 days post-treatment were followed by lethality in male KoTgCre mice, whereas the control mice appeared completely unaffected and showed no adverse signs thereafter. Since male fertility was not determined after cadmium treatment, we cannot exclude a potential effect on testes/male fertility, which seems to be particularly susceptible to cadmium 1077
toxicity (36). KoTgCre females were less severely affected than males, which agrees with an independent study where female mice lacking metallothioneins Mt-I and Mt-II were found to be less sensitive to cadmium intoxication than males (6). In spite of greater sensitivity, KoTgCre mice accumulated only one-third the amount of cadmium in their livers and half the amount in kidneys as control mice. Since chelation of heavy metals by MTs represents a prominent protection mechanism against heavy metal toxicity (37, 38), this result, at first glance counterintuitive, most likely reflects the severe reduction of metallothionein expression in the absence of MTF-1. In line with this notion, we recently observed low metallothionein expression with concomitant heavy metal sensitivity in MTF-1 null mutant Drosophila (39). We tested our conditional knockout mice for increased sensitivity to oxidative stress by treatment with paraquat and for liver regeneration by partial hepatectomy. Preliminary data indicate that in both cases there was no difference to control mice (data not shown). The latter finding suggests that the absence of MTF-1 does not grossly impair adult hepatocyte proliferation, in contrast to the situation in livers with impaired c-Jun or NF-B functions (40, 41). Finally, we genotyped peripheral blood cells from conditional knockout mice after polyI/C treatment and found quantitative cMTF-1 excision, which is consistent with the extensive inducibility of Mx-Cre in bone marrow and spleen (2). Surprisingly, and in contrast to the seemingly normal hematopoiesis in Mtf1 KO embryos (see above), reduced numbers of white blood cells, especially lymphocytes, were observed in the conditional knockout mice. This suggests a role for MTF-1 in the proliferation/maintenance of adult leukocytes. Independently, an involvement of MTF-1 in antimicrobial defense was suggested by treatments of dendritic cells by bacterial LPS (lipopolysaccharide) or influenza virus A, which induce an elevated expression of MTF-1 mRNA (42). Since in our studies all mice were kept under high hygiene standard facilities, no particular susceptibility to infections was detected and the life span of these mice was similar to the control group. In conclusion, we show here that the "metal-responsive transcription factor-1" (MTF-1) is essential for embryonic liver formation; null mutant hepatocytes suffer from a cell-autonomous defect, resulting in liver degeneration in the embryo. Moreover, null mutant mice are fully rescued by a cDNA transgene; finally, excision of this transgene in the liver, bone marrow, and some other tissues renders mice susceptible to cadmium toxicity and reduces leukocyte titers, especially lymphocyte titers, suggesting a novel function of MTF-1 in the hematopoietic system.
immunology, Rolf Zinkernagel and Hans Lutz for discussions, and Jason Kinchen for critical reading of the manuscript. We thank Till Strassen for excellent technical assistance and Fritz Ochsenbein for preparing the figures. This work was supported by the Kanton Zu¨ rich and the Swiss National Science Foundation.
REFERENCES 1. 2.
3.
4. 5. 6. 7.
8.
9.
10. 11.
12.
13.
14.
15.
We are indebted to Drs. Paula Grest for help with microscopy, Michel Aguet (Epalinges-Lausanne) for the gift of Mx-Cre mice, Peter Angel (Heidelberg) and Erwin Wagner (Vienna) for the gift of the pUbi-JunB construct, Madeleine Bart and Beat Hauser for examination of bone marrow and liver sections, Stefan Freigang for sharing his expertise in 1078
Vol. 18
July 2004
16.
Kuhn, R., Schwenk, F., Aguet, M., and Rajewsky, K. (1995) Inducible gene targeting in mice. Science 269, 1427–1429 Radtke, F., Wilson, A., Stark, G., Bauer, M., van Meerwijk, J., MacDonald, H. R., and Aguet, M. (1999) Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity 10, 547–558 Zhang, B., Egli, D., Georgiev, O., and Schaffner, W. (2001) The Drosophila homolog of mammalian zinc finger factor MTF-1 activates transcription in response to heavy metals. Mol. Cell. Biol. 21, 4505– 4514 Lichtlen, P., and Schaffner, W. (2001) Putting its fingers on stressful situations: the heavy metal-regulatory transcription factor MTF-1. Bioessays 23, 1010 –1017 Andrews, G. K. (2000) Regulation of metallothionein gene expression by oxidative stress and metal ions. Biochem. Pharmacol. 59, 95–104 Kelly, E. J., Quaife, C. J., Froelick, G. J., and Palmiter, R. D. (1996) Metallothionein I and II protect against zinc deficiency and zinc toxicity in mice. J. Nutr. 126, 1782–1790 Heuchel, R., Radtke, F., Georgiev, O., Stark, G., Aguet, M., and Schaffner, W. (1994) The transcription factor MTF-1 is essential for basal and heavy metal-induced metallothionein gene expression. EMBO J. 13, 2870 –2875 Andrews, G. K., Lee, D. K., Ravindra, R., Lichtlen, P., Sirito, M., Sawadogo, M., and Schaffner, W. (2001) The transcription factors MTF-1 and USF1 cooperate to regulate mouse metallothionein-I expression in response to the essential metal zinc in visceral endoderm cells during early development. EMBO J. 20, 1114 –1122 Lichtlen, P., Wang, Y., Belser, T., Georgiev, O., Certa, U., Sack, R., and Schaffner, W. (2001) Target gene search for the metal-responsive transcription factor MTF-1. Nucleic Acids Res. 29, 1514 –1523 Langmade, S. J., Ravindra, R., Daniels, P. J., and Andrews, G. K. (2000) The transcription factor MTF-1 mediates metal regulation of the mouse ZnT1 gene. J. Biol. Chem. 275, 34803–34809 Green, C. J., Lichtlen, P., Huynh, N. T., Yanovsky, M., Laderoute, K. R., Schaffner, W., and Murphy, B. J. (2001) Placenta growth factor gene expression is induced by hypoxia in fibroblasts: a central role for metal transcription factor-1. Cancer Res. 61, 2696 –2703 Lacal, P. M., Failla, C. M., Pagani, E., Odorisio, T., Schietroma, C., Falcinelli, S., Zambruno, G., and D'Atri, S. (2000) Human melanoma cells secrete and respond to placenta growth factor and vascular endothelial growth factor. J. Invest. Dermatol. 115, 1000 –1007 Cao, Y., Chen, H., Zhou, L., Chiang, M. K., Anand-Apte, B., Weatherbee, J. A., Wang, Y., Fang, F., Flanagan, J. G., and Tsang, M. L. (1996) Heterodimers of placenta growth factor/vascular endothelial growth factor. Endothelial activity, tumor cell expression, and high affinity binding to Flk-1/KDR. J. Biol. Chem. 271, 3154 –3162 Gunes, C., Heuchel, R., Georgiev, O., Muller, K. H., Lichtlen, P., Bluthmann, H., Marino, S., Aguzzi, A., and Schaffner, W. (1998) Embryonic lethality and liver degeneration in mice lacking the metal-responsive transcriptional activator MTF-1. EMBO J. 17, 2846 –2854 Lichtlen, P., Georgiev, O., Schaffner, W., Aguzzi, A., and Brandner, S. (1999) The heavy metal-responsive transcription factor-1 (MTF-1) is not required for neural differentiation. Biol. Chem. 380, 711–715 Masters, B. A., Kelly, E. J., Quaife, C. J., Brinster, R. L., and Palmiter, R. D. (1994) Targeted disruption of metallothionein I and II genes increases sensitivity to cadmium. Proc. Natl. Acad. Sci. USA 91, 584 –588
The FASEB Journal
WANG ET AL.
17.
18. 19. 20. 21. 22. 23.
24. 25.
26.
27. 28.
29. 30.
Radtke, F., Heuchel, R., Georgiev, O., Hergersberg, M., Gariglio, M., Dembic, Z., and Schaffner, W. (1993) Cloned transcription factor MTF-1 activates the mouse metallothionein I promoter. EMBO J. 12, 1355–1362 Westin, G., and Schaffner, W. (1988) A zinc-responsive factor interacts with a metal-regulated enhancer element (MRE) of the mouse metallothionein-I gene. EMBO J. 7, 3763–3770 Schulz, W. A., Crawford, N., and Locker, J. (1988) Albumin and alpha-fetoprotein gene expression and DNA methylation in rat hepatoma cell lines. Exp. Cell Res. 174, 433– 447 Nagy, P., Bisgaard, H. C., and Thorgeirsson, S. S. (1994) Expression of hepatic transcription factors during liver development and oval cell differentiation. J. Cell Biol. 126, 223–233 Shiojiri, N., and Koike, T. (1997) Differentiation of biliary epithelial cells from the mouse hepatic endodermal cells cultured in vitro. Tohoku J. Exp. Med. 181, 1– 8 Cantor, A. B., and Orkin, S. H. (2001) Hematopoietic development: a balancing act. Curr. Opin. Genet. Dev. 11, 513–519 Reimold, A. M., Etkin, A., Clauss, I., Perkins, A., Friend, D. S., Zhang, J., Horton, H. F., Scott, A., Orkin, S. H., Byrne, M. C., et al. (2000) An essential role in liver development for transcription factor XBP-1. Genes Dev.14, 152–157 Hilberg, F., Aguzzi, A., Howells, N., and Wagner, E. F. (1993) c-jun is essential for normal mouse development and hepatogenesis. Nature (London) 365, 179 –181 Beg, A. A., Sha, W. C., Bronson, R. T., Ghosh, S., and Baltimore, D. (1995) Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature (London) 376, 167–170 Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A., and Birchmeier, C. (1995) Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud. Nature (London) 376, 768 –771 Birchmeier, C., Bladt, F., and Yamaai, T. (1997) The functions of HGF/SF and its receptor, the c-Met tyrosine kinase, in mammalian development. Ciba Found. Symp. 212, 169 –177 Erickson, J. C., Hollopeter, G., Thomas, S. A., Froelick, G. J., and Palmiter, R. D. (1997) Disruption of the metallothionein-III gene in mice: analysis of brain zinc, behavior, and neuron vulnerability to metals, aging, and seizures. J. Neurosci. 17, 1271–1281 Michalska, A., and Choo, K. (1993) Targeting and germ-line transmission of a null mutation at the metallothionein I and II loci in mouse. Proc. Natl. Acad. Sci. USA 90, 8088 – 8092 Schmidt, C., Bladt, F., Goedecke, S., Brinkmann, V., Zschiesche, W., Sharpe, M., Gherardi, E., and Birchmeier, C. (1995) Scatter
LIVER FORMATION AND HEAVY METAL HANDLING VIA MTF-1
31.
32. 33. 34. 35.
36.
37. 38. 39.
40.
41.
42.
factor/hepatocyte growth factor is essential for liver development. Nature (London) 373, 699 –702 Ganiatsas, S., Kwee, L., Fujiwara, Y., Perkins, A., Ikeda, T., Labow, M. A., and Zon, L. I. (1998) SEK1 deficiency reveals mitogen-activated protein kinase cascade crossregulation and leads to abnormal hepatogenesis. Proc. Natl. Acad. Sci. USA 95, 6881– 6886 Giroux, S., and Charron, J. (1998) Defective development of the embryonic liver in N-myc-deficient mice. Dev. Biol. 195, 16 –28 Zaret, K. S. (2001) Hepatocyte differentiation: from the endoderm and beyond. Curr. Opin. Genet. Dev. 11, 568 –574 Zaret, K. S. (2000) Liver specification and early morphogenesis. Mech. Dev. 92, 83– 88 Schofield, J. P., Cox, T. M., Caskey, C. T., and Wakamiya, M. (1999) Mice deficient in the urea-cycle enzyme, carbamoyl phosphate synthetase I, die during the early neonatal period from hyperammonemia. Hepatology 29, 181–185 Ren, X. Y., Zhou, Y., Zhang, J. P., Feng, W. H., and Jiao, B. H. (2003) Expression of metallothionein gene at different time in testicular interstitial cells and liver of rats treated with cadmium. World J. Gastroenterol. 9, 1554 –1558 Palmiter, R. D. (1998) The elusive function of metallothioneins. Proc. Natl. Acad. Sci. USA 95, 8428 – 8430 Nordberg, M., and Nordberg, G. F. (2000) Toxicological aspects of metallothionein. Cell. Mol. Biol. (Noisy-le-grand) 46, 451– 463 Egli, D., Selvaraj, A., Yepiskoposyan, H., Zhang, B., Hafen, E., Georgiev, O., and Schaffner, W. (2003) Knockout of 'metalresponsive transcription factor' MTF-1 in Drosophila by homologous recombination reveals its central role in heavy metal homeostasis. EMBO J. 22, 100 –108 Plumpe, J., Malek, N. P., Bock, C. T., Rakemann, T., Manns, M. P., and Trautwein, C. (2000) NF-kappa B determines between apoptosis and proliferation in hepatocytes during liver regeneration. Am. J. Physiol. 278, G173–G183 Behrens, A., Sibilia, M., David, J. P., Mohle-Steinlein, U., Tronche, F., Schutz, G., and Wagner, E. F. (2002) Impaired postnatal hepatocyte proliferation and liver regeneration in mice lacking c-jun in the liver. EMBO J. 21, 1782–1790 Huang, Q., Liu, D., Majewski, P., Schulte, L. C., Korn, J. M., Young, R. A., Lander, E. S., and Hacohen, N. (2001) The plasticity of dendritic cell responses to pathogens and their components. Science 294, 870 – 875 Received for publication December 2, 2003. Accepted for publication March 24, 2004.
1079
