Methamphetamine causes differential regulation ... - The FASEB Journal

Methamphetamine causes differential regulation of pro-death and anti-death Bcl-2 genes in the mouse neocortex SUBRAMANIAM JAYANTHI, XIAOLIN DENG, MARC BORDELON, MICHAEL T. MCCOY, AND JEAN LUD CADET1 Molecular Neuropsychiatry Section, NIDA-IRP, National Institutes of Health, Baltimore, Maryland 21224, USA Bcl-2, an inner mitochondrial membrane protein, inhibits apoptotic neuronal cell death. Expression of Bcl-2 inhibits cell death by decreasing the net cellular generation of reactive oxygen species. Studies by different investigators have provided unimpeachable evidence of a role for oxygen-based free radicals in methamphetamine (METH) -induced neurotoxicity. In addition, studies from our laboratory have shown that immortalized rat neuronal cells that overexpress Bcl-2 are protected against METH-induced apoptosis in vitro. Moreover, the amphetamines can cause differential changes in the expression of Bcl-X splice variants in primary cortical cell cultures. These observations suggested that METH might also cause perturbations of Bcl-2-related genes when administered to rodents. Thus, the present study was conducted to determine whether the use of METH might indeed be associated with transcriptional and translational changes in the expression of Bcl-2-related genes in the mouse brain. Here we report that a toxic regimen of METH did cause significant increases in the pro-death Bcl-2 family genes BAD, BAX, and BID. Concomitantly, there were significant decreases in the anti-death genes Bcl-2 and Bcl-XL. These results thus support the notion that injections of toxic doses of METH trigger the activation of the programmed death pathway in the mammalian brain.—Jayanthi, S., Deng, X., Bordelon, M., McCoy, M. T., Cadet, J. L. Methamphetamine causes differential regulation of pro-death and anti-death Bcl-2 genes in the mouse neocortex. FASEB J. 15, 1745–1752 (2001) ABSTRACT

Key Words: neurotoxicity 䡠 apoptosis 䡠 bcl-2 gene family 䡠 cDNA array Methamphetamine (METH) is an illicit drug of abuse that can cause neuropsychiatric and neurotoxic damage in humans (1– 4) and animals (5). Recently, it was shown that in addition to its toxic damage to monoaminergic terminals (6 –9), METH can cause deleterious effects to brain regions such as the cortex that have very little dopamine innervation (10 –13). For example, METH was shown to cause apoptosis of nonmonoam-

0892-6638/01/0015-1745 © FASEB

inergic cells both in vivo (13, 14) and in vitro (11, 15). Although most of METH-induced abnormalities had been thought to be related to the production of oxygen-based radicals including superoxide and hydroxyl radicals (14, 16, 17), the possible role of Bcl-2 family genes has recently been suggested (11, 15). Specifically, studies from our laboratory have shown that overexpression of Bcl-2 protects against METHinduced apoptosis of immortalized neural cells (15) and Stumm et al. (11) had reported that METH-treated primary cortical neurons showed differential regulation of the Bcl-X splice variants with induction of the pro-apoptotic Bcl-XS and inhibition of the anti-apoptotic Bcl-XL variant. Bcl-2 family proteins are functionally categorized into death-inhibiting or death-inducing members. Bcl-2, Bclw, and Bcl-XL are known to enhance cell survival whereas BAX, BAK, BAD, and BID are proapoptotic proteins of the Bcl-2 family (18, 19). Bcl-2related proteins are important regulators of apoptosis, acting by controlling the fluxes of ions (K⫹, H⫹, Cl⫺, Ca2⫹) (20) and the generation of reactive oxygen species (21). Their effects also depend on the release of apoptogenic factors from mitochondria (AIF, cytochrome c) (22–24), changes in the mitochondrial membrane permeability transition pore (25, 26), as well as the functional modulation of the executors of apoptosis (caspases, DNases) (27–29). Therefore, the response of Bcl-2 proteins to pro- and anti-apoptotic signals is dependent on the activation of transcription and translation, phosphorylation, proteolytic cleavage, interactions with Bcl-2-related and other (structurally unrelated) proteins, as well as translocation from the cytosol to intracellular membranes with subsequent release of pro-apoptogenic substances (30), with the apoptotic end points being heavily dependent on the ratio of death promoters to death inhibitors (18, 31, 32). 1 Correspondence: Molecular Neuropsychiatry Section, NIH/NIDA Intramural Research Program, 5500 Nathan Shock Dr., Baltimore, MD 21224, USA. E-mail: JCADET@ intra.nida.nih.gov

1745

In addition to the possible involvement of pro- and anti-death genes of the Bcl-2 family (11, 15), METH toxicity appears to be associated with increases in caspase-3 activity and stimulation of PARP cleavage (14). These are important regulatory events through which death promoters, activated by substances released from the mitochondria, can execute apoptosis (27–29). To further identify pathways that might be involved in METH-induced apoptosis, we have used the cDNA array approach (33) to examine the temporal profile of the patterns of gene expression in the brains of mice treated with METH. These experiments had suggested that METH administration could cause significant up-regulation of pro-apoptotic genes of the Bcl-2 family several hours after its injection. Here we provide further evidence for the possible involvement of pro-apoptotic Bcl-2-related genes in METH-induced apoptosis in nonmonoaminergic cell bodies in the mouse neocortex. These observations suggest that METH can activate a complex cell death signaling cascade whose results are derived from a balance between pro-apoptotic and anti-apoptotic mechanisms.

MATEIALS AND METHODS Animals and drug treatment Male CD-1 mice (Charles River, Raleigh, NC), weighing 30 – 45 g, were used. Mice received a single dose of 40.0 mg/kg METH or saline via the intraperitoneal route. All animal use procedures were according to the NIH Guide for the Care and Use of Laboratory Animals and were approved by the local NIDA Animal Care Committee. The mice were killed at various times after drug treatment. Brain tissues were processed for use in terminal deoxynucleotidyl transferasemediated dUTP nick-end labeling (TUNEL) staining, cDNA array, RT-PCR analyses, and Western blotting as described below. TUNEL histochemistry After death, mice brains were removed rapidly from their skulls and stored at ⫺70°C. Stored brains were cut into 30 ␮m sections using a cryostat and immediately mounted onto slides. Subsequently, the sections were fixed in 4% paraformaldehyde at 4°C for 30 min and washed in tap water to remove the fixative solution. A TUNEL procedure for frozen tissue sections was performed according to the manufacturer’s manual with some modifications (Boehringer Mannheim Corporation, Indianapolis, IN) as previously reported by us (13). Slide-mounted sections were rinsed in 0.3% hydrogen peroxide-methanol in order to block endogenous peroxidase. They were then rinsed in 80°C 0.5% triton X-100/0.01M PBS for 20 min to increase permeabilization of the cells. To label damaged nuclei, 50 ␮l of the TUNEL reaction mixture was added onto each sample in a humidified chamber, followed by 60 min incubation at 37°C. The peroxidase reaction was visualized with DAB substrate solution. Procedures for negative controls were carried out as described in the manufacturer’s manual; the label solution (terminal deoxynucleotidyl transferase) was not added to the TUNEL reaction mixture. No TUNELpositive cells were observed in the negative controls. TUNEL1746

Vol. 15

August 2001

positive cells were counted in the frontal cortex region using a Zeiss microscope. Probing, hybridization, and analysis of cDNA arrays cDNA array analysis was performed by using Atlas Mouse Arrays (Clontech Laboratories, Palo Alto, CA) that contain a total of 588 cDNA segments spotted in duplicate side-by-side on a nylon membrane. Probing of cDNA arrays was performed as described in the Clontech Atlas cDNA Expression Arrays User Manual (PT3140 –1). Total RNA was isolated from the frontal cortex of saline- and METH-treated mice killed at 2, 4, and 16 h after the single dose of saline or METH. All tissues were pulverized in liquid nitrogen and immediately placed in denaturing solution, homogenized, and extracted with phenol-chloroform by using Atlas Pure RNA isolation kit (Clontech), then digested with DNase-I to remove any trace of DNA. After confirmation of the integrity of total RNA on a denaturing formaldehyde gel, 50 ␮g of total RNA was used for templates in a 10 ␮l reverse transcription reaction. A pooled set of primers complementary to the genes represented on the array (Clontech) was used for the reverse transcription probe synthesis, which was radiolabeled with 32 P-dATP and purified by passage over CHROMA SPIN-200 columns (Clontech). The cDNA expression array filters were prehybridized in ExpressHyb (Clontech) for 30 min at 71°C and hybridized overnight with 32P-labeled first-strand cDNA probes at 71°C. After a high-stringency wash, the membranes were exposed to a PhosphorImaging screen for 24 h at room temperature. The exposed screen was scanned on Storm 840 PhosphoImager (Molecular Dynamics, Inc., Sunnyvale, CA) at 100 ␮m resolution and stored as MD(.gel) files. The array spots on the array images were analyzed using a theoretical pattern of template of Array Vision software for Windows NT (version 4, Imaging Research Inc., St. Catherine’s, ON). The template elements were aligned over the true array spot and the spot intensity value was quantified after subtraction of set background. The signal for any given gene was calculated as the average of the signals from the two duplicate cDNA spots. For further analysis, the data were imported into GeneSpring (version 4.0.1, Silicon Genetics, Redwood City, CA) by Excel (Microsoft) spreadsheet formatted as a tab-limited text file, and ratio measures of METH-treated to time-matched saline-treated control were generated. A hierarchical cluster analysis with standard correlation (dendrogram) of the ratio measure was generated using GeneSpring software (34). To make sense of the large data sets, color coding was used; the primary coding scheme in GeneSpring is to map relative expression levels to colors. The program maps a confidence value for each data point to the intensity of coloring. RT-PCR and detection of mRNA expression RNA expression of the Bcl-2 family genes was analyzed by RT-PCR with gene specific Custom Atlas Array primers (Clontech) to confirm changes in the level of expression of some genes. Total RNA (1 ␮g) was reverse transcribed with oligo dT primer. For PCR amplification of cDNA, the following primers were used: The PCR reactions followed the standard protocol for AmpliTaq Gold (Perkin-Elmer, Foster City, CA) and required 95°C for 10 min, repeated cycles of 95°C for 30 s, 64°C for 30 s, 72°C for 30 s, and 72°C for 7 min. The PCR products were run on a 1.5% agarose gel at 100 V and stained with SYBR Green (Molecular Probes, Eugene, OR). SYBR intensity in each band was measured using an IS-1000 Digital Imaging

The FASEB Journal

JAYANTHI ET AL.

Gene of interest

Upstream primer

Downstream primer

BAX

AAGCTGAGCGAGTGTCTCCGGCG

GCCACAAAGATGGTCACTGTCTGCC

BAK

AGTGAGGGCAGAGGTGAGAGTTCA

CACAGTTGCTTCTGCTGGAGTAGTT

BAD

CCAGTGATCTTCTGCTCCACATCCC

CAACTTAGCACAGGCACCCGAGGG

BID

ACAAGGCCATGCTGATAATGACAAT

CAGATACACTCAAGCTGAACGCAG

Bcl-2

CTCGTCGCTACCGTCGTGACTTCG

CAGATGCCGGTTCAGGTACTCAGTC

Bcl-w

CGAGTTTGAGACCCGTTTCCGCC

GCACTTGTCCCACCAAAGGCTCC

Bcl-XL

TGGAGTAAACTGGGGGTCGCATCG

AGCCACCGTCATGCCCGTCAGG

System (Alpha Innotech Corp., San Leandro, CA) (35) and quantitated using Flurochem version 2.0 software Western blot analysis Immunoblot analysis was carried out in the frontal cortex of METH- and saline-treated wild-type mice. Mouse cortex was homogenized in buffer containing 320 mM sucrose, 5 mM HEPES, 1 ␮g/ml leupeptin, 1 ␮g/ml aprotinin, and 1 ␮g/ml pepstatin. Homogenates were centrifuged at 5000 g for 5 min and the supernatant fraction was subsequently centrifuged at 30,000 g for 30 min. The resulting pellet was resuspended in the sample buffer (62.5 mM Tris-HCl, 10% glycerol, 2% SDS, 0.1% bromphenol blue, and 50 mM dithiothreitol) and subjected to SDS-polyacrylamide gel electrophoresis. Proteins were electrophoretically transferred to Hybond-P™ membrane (Amersham Pharmacia Biotech. Piscataway, NJ). Membrane blocking, primary and secondary antibody incubations, and chemiluminescence reactions were carried out according to the protocol described by the individual antibody suppliers. Antibodies included rabbit polyclonal for BAD (New England BioLabs, Beverly, MA), rabbit polyclonal for BAX and Bclw, goat polyclonal for BID (R&D Systems, Flanders, NJ), rabbit polyclonal for BAK and Bcl2, Bcl-XL (BD PharMingen, San Diego, CA), and mouse monoclonal tubulin (Sigma, St. Louis, MO). The relative amounts of protein were quantified using densitometric analysis (IS-1000 Digital Imaging System, Alpha Innotech Corp., San Leandro, CA).

using GeneSpring revealed different patterns of gene expression in mice killed at 2, 4, or 16 h after METH administration (37). Specifically, METH caused induction (⬎1.9-fold) of 149, 116, 219 genes at 2, 4, and 16 h, respectively (37). These genes fell within different classes, with those coding for transcription factors and oncogenes being stimulated early and those coding for

RESULTS A single injection of METH induces apoptosis in the mouse cortex As expected from previous studies in our laboratory (13, 14), administration of METH causes time-dependent appearance of apoptotic cells in the mouse neocortex (Fig. 1). Confocal laser scanning microscopy revealed that cortical cells in the METH-treated mice had shrunk and exhibited nuclear DNA condensation and fragmentation (Fig. 1A). The quantitative data are provided in Fig. 1B. Expression of Bcl-2 genes We used a comprehensive approach (36), including Clontech mouse cDNA expression arrays, to assess METH-induced transcriptional effects. Cluster analysis METHAMPHETAMINE NEUROTOXICITY AND BCL-2 FAMILY GENES

Figure 1. A) Representative photomicrograph of TUNELstained frontal cortices of mice. METH caused significant increases in TUNEL-positive cells. Photomicrographs were generated by a Carl Zeiss Laser Scanning Confocal System with Axiovert 153-inverted microscopy. The objective lens was 20⫻. Scale bar ⫽ 200 ␮m. Quantitative data are provided in Fig. 1B. METH caused a significant time-dependent increase in the number of TUNEL-positive cells. Values represent means ⫾ se of five to eight mice per time point. *P ⬍ 0.001 in comparison to saline-treated mice. 1747

cell death and DNA repair being stimulated somewhat later (37). The latter included those of the Bcl-2 family of pro-death genes. We will now report further characterization of the pattern of changes observed in these genes by analysis of the cDNA array results and provide RT-PCR confirmation and extension of the pattern of changes. Western blot analysis was performed to assess whether the changes in mRNA were reflected in protein synthesis. METH caused up-regulation of pro-death Bcl-2 genes Figure 2 shows a cluster analysis of the pattern of changes in Bcl-2 family genes. The analysis showed that the prodeath genes cluster together and are induced at 16 h in the cDNA array (Fig. 2). They all showed increases greater than twofold at that time with a substantial correlation, as shown by the dendrogram, of the two pro-death genes BAK and BAX, which both contain the distinct proapoptotic BH3 domain (Fig. 2A) (38). To provide confirmation for the changes that occurred in the Bcl-2 family of genes, we undertook more detailed time course experiments using both RT-PCR and Western blot analysis. Figure 3A, B provides confirmation of the array data showing that METH treatment does indeed cause marked induction of the pro-death

Figure 3. A) RT-PCR from RNA obtained from saline- and METH-treated CD-1 mice show up-regulation of Bcl-2 family pro-death genes. (B) METH caused significant increases in pro-death mRNAs. The values represent means ⫾ se obtained from three mice per time point. !P ⬍ 0.05; #P ⬍ 0.001 and *P ⬍ 0.0001 in comparison to saline-treated mice. ␤-Actin is included as a control and shows no changes during the course of the experiments.

Figure 2. Cluster analysis of the effects of METH on a Bcl-2 family of genes. The expression level for each gene was quantified after background correction. The differences in gene expression between saline- and METH-treated mice were expressed as ratios of the hybridization signals obtained from each group. Each row represents changes in the expression of a single gene whereas each column shows the variation in the ratio of the 7 genes of interest within a single sample. The Bcl-2 family pro-death genes emerged as a discrete subset from the gene tree cluster analysis. The dendrogram on the left side of the cluster shows the statistical relationships between the various genes: the shorter the branches, the more closely they are related. A pseudocolor intensity scale is provided on the left of the dendrogram. 1748

Vol. 15

August 2001

genes BAX, BAK, BAD, and BID. The increases in mRNAs were time dependent, becoming significant 6 h after METH administration. The up-regulation of Bcl-2 pro-death genes precedes apoptotic cell death, which appears at ⬃16 h and is maximal at around 24 h to 3 days after METH injections (Fig. 1; see also ref 13). Western blot analysis also showed that changes in the mRNAs were reflected in protein synthesis, with the levels of protein peaking around 16 h postdrug and approaching basal level after 1 wk (Fig. 4A, B). METH caused down-regulation of anti-death Bcl-2 genes In contrast to the pro-death genes, cluster analysis of anti-death Bcl-2 family genes-Bcl-2, Bcl-XL, and Bclw showed a downward profile (Fig. 2). The RT-PCR assessment also confirmed that mRNA expression of anti-death genes of the Bcl-2 family was significantly decreased in a time-dependent fashion (Fig. 5A, B). The most prominent decreases (⬃50%) were observed

The FASEB Journal

JAYANTHI ET AL.

Figure 4. Western blot analysis of Bcl-2 family pro-death proteins. A) Representative photographs of protein levels in the cortical tissue of mice at different times after administration of METH. B) Quantification of these changes show that METH-induced increases in protein expression occur as early as 1–2 h, peak around 8 –16 h, and return to basal level by 1 wk post-treatment.

in Bcl-2 and Bcl-XL mRNAs (Fig. 5), which were still on a downward trend 24 h after drug administration. Western blot analysis also shows that Bcl-2 and Bcl-XL protein levels were most affected by treatment with METH and remained low even at 1 wk (Fig. 6A, B). Bclw showed an intermediate course and, unlike Bcl-2 and Bcl-XL, had returned toward basal level after 1 wk (Fig. 6A, B). Pro-death/anti-death ratios Cell survival is thought to depend critically on a molecular balancing act that regulates the ratios of Bcl-2 to BAX (39) or of BAD to Bcl-XL (40, 41) or Bcl-2 (40). Because apoptosis is thought to result from changes in these ratios, with consequent release of cytochrome c and activation of effector caspases (for a review, see refs 42– 44), we opted

to generate relative ratios based on the pattern of protein expression obtained from the Western blots. Figure 7 shows there were substantial increases in the pro-death/ anti-death ratios: from ⬃0.3 to 1 for BAX/Bcl-2, from 0.4 to 1.5 for BAD/Bcl-XL, and from 0.4 to 1.1 for BAD/Bcl-2. When taken together, these data suggest that METH treatment can cause a shift in the intrinsic ratio of death promoters to death repressors that might facilitate cell death in some cortical neurons as shown in Fig. 1 and by Deng et al. (13).

DISCUSSION A major finding of this study is that a single dose of METH can cause apoptosis in nonmonoaminergic cells

Figure 5. A) RT-PCR from RNA obtained from saline- and METH-treated CD-1 mice shows differential regulation of Bcl-2 family anti-death genes with decrease in expression of Bcl-2, Bcl-XL, and Bcl-w. Quantitative data for the anti-death Bcl-2 family proteins are provided in panel B. The values represent means ⫾ se obtained from three mice per time point. !P ⬍ 0.05, #P ⬍ 0.001, and *P ⬍ 0.0001 in comparison to saline-treated mice. ␤-Actin is included as a control and shows no changes during the course of the experiments. METHAMPHETAMINE NEUROTOXICITY AND BCL-2 FAMILY GENES

1749

Figure 6. Western blotting analysis of Bcl-2 family anti-death proteins. A) Representative photographs of protein levels in the cortical tissue of mice at different times after the administration of METH. B) Quantification of these changes shows that METH-induced proportional decreases in the expression of anti-death genes Bcl-2, Bcl-XL, and Bcl-w, with respect to time. Bcl-w reverted to basal value by 1 wk but Bcl-2 and Bcl-XL remained down-regulated.

of the frontal cortex. These results are consistent with our earlier observations showing that multiple injections of METH can cause apoptosis in the frontal cortex (13). Whereas most studies have focused almost exclusively on METH toxicity on dopaminergic systems, showing persistent decreases in markers of dopamine cell function and structure (6, 8, 45– 48), the effects of the drug on nondopaminergic systems have drawn much less attention during the past 2 decades. Earlier studies had shown that D-amphetamine caused degeneration in the frontal cortex of rats (49). More recently, intrinsic cortical nonmonoaminergic neurons were also identified as sites of METH-induced toxicity in animals (50 –52) and humans (12). Furthermore, both in vitro (11) and in vivo (13) studies have now clearly shown that METH can cause cell death in these regions by a process that is akin to apoptosis even though the associated cellular and molecular mechanisms remain to be fully clarified. To further elucidate the molecular events associated with the METH-induced apoptotic changes observed in cortical cells, we have used various approaches to show specific changes in Bcl-2 family of genes. Specifically, 1) 1750

Vol. 15

August 2001

cluster analysis of the data obtained from cDNA array of cortical tissues of mice killed at various times after METH injections led to two separate clusters made up of pro-death and anti-death Bcl-2 genes, respectively; 2) RT-PCR analysis confirmed the changes observed in the cDNA array analyses, with 3) pro-apoptotic, BAX and BID genes showing significant up-regulation, but 4) the anti-death genes Bcl-2 and Bcl-XL showing prolonged down-regulation. Bcl-2 and its homologs can form homo- and heterodimers and BAX homodimers actively promote cell death unless neutralized by heterodimerization with Bcl-2 or Bcl-XL (39, 53, 54). The present results suggest that METH administration might cause increases in pro-death/anti-death ratio of Bcl-2 family genes with the resulting effects being METH-induced apoptosis in some brain regions (13, 14). Studies of the neurotoxic effects of METH had led to the conclusion that oxidative stress might play an important role in damaging dopaminergic systems (16, 55) and nonmonoaminergic cell bodies (14, 17, 56). Nevertheless, Stumm et al. (11) had reported that cortical neuronal cells exposed to amphetamine analogs showed decreases in Bcl-XL but no changes in BAX and Bcl-2 expression. It could be argued that their observations are not consistent with our present findings of significant METH-induced increases in BAX but decreases in Bcl-2. However, this would not be correct, since these discrepancies are probably due to the different time courses used in the two studies. Specifically, Stumm et al. (11) made their measurements at 1, 24, and 96 h after METH exposure, whereas we had a detailed time course for the RT-PCR and for the Western blots that included multiple times during the

Figure 7. Linear representations of the ratio of pro-death to anti-death Bcl-2 family protein levels. These lines were generated by dividing the levels of expression of pro-death proteins by those of anti-death proteins based on hypothetical heterodimerization patterns. The patterns suggest that METH injections may cause its deleterious effects by changing the cellular balance of anti-death and pro-death proteins in the mammalian brain.

The FASEB Journal

JAYANTHI ET AL.

24 h of the study (see times listed in the various figures). This idea is borne out by the fact that we observed the highest increases in BAX expression at 8 and 16 h and the onset of decreases in Bcl-2 expression at 4 h after the METH injections. The report that amphetamine administration can cause increases in BAX and decreases in Bcl-2 and Bcl-XL mRNA in liver tissue 4 h after METH injections provides further support for this argument (57). Because BAD, BID, and BAX are all induced by METH, the apoptogenic effects of METH might be compounded by their differential ratios with their anti-death heterodimeric partners as shown in Fig. 7. If that idea were correct, then it would explain the findings that METH exposure can cause caspase 3 activation and PARP cleavage (14), since an important function of these pro-death proteins is to promote cytochrome c release (22, 24, 58, 59) and subsequent activation of downstream caspases [reviewed in (30)]. The Bcl-2 protein, which is associated with the mitochondrial membrane (60) and acts to prevent the efflux of cytochrome c (22, 24), also showed a decrease in its expression after METH administration. Thus, these changes together support the idea that METH acts to promote a shift in the pro-death/anti-death balance, the ultimate results being the death of the cells within which this shift has occurred. This suggestion is in accordance with our previous report that METHinduced apoptosis is attenuated by Bcl-2 overexpression (15). In addition, similar to the reports of Stumm et al. (11), we found that METH also causes marked decreases in the expression of the anti-apoptotic gene Bcl-XL, which acts by maintaining the mitochondrialcytosolic coupling of oxidative phosphorylation (61, 62). These observations all support the notion of a METH-induced increase in pro-death/anti-death ratios with resulting apoptosis in cortical cells. In summary, this is the first in vivo demonstration that a neurotoxic dose of METH can cause differential regulation of several Bcl-2 family genes with two distinct clustering consisting of up-regulation of pro-death and down-regulation of anti-death gene expression. These results bring further highlight the role that cell death might play in METH neurotoxicity. The present observations also underscore the utility of using the cDNA approach to identify genes of interest whose specific roles in neurotoxicity can be further analyzed. Finally, this approach promises to revolutionize our understanding of the molecular events that occur during the repeated administration of illicit drugs.

2.

3.

4. 5.

6.

7. 8.

9.

10. 11.

12.

13. 14. 15. 16.

17.

18.

19. 20.

REFERENCES 1.

Wilson, J. M., Kalasinsky, K. S., Levey, A. I., Bergeron, C., Reiber, G., Anthony, R. M., Schmunk, G. A., Shannak, K., Haycock, J. W., and Kish, S. J. (1996) Striatal dopamine nerve terminal markers in human, chronic methamphetamine users. Nat. Med. 2, 699 –703

METHAMPHETAMINE NEUROTOXICITY AND BCL-2 FAMILY GENES

21. 22.

McCann, U. D., Wong, D. F., Yokoi, F., Villemagne, V., Dannals, R. F., and Ricaurte, G. A. (1998) Reduced striatal dopamine transporter density in abstinent methamphetamine and methcathinone users: evidence from positron emission tomography studies with [11C]WIN-35,428. J. Neurosci. 18, 8417– 8422 Volkow, N. D., Wang, G. J., Fowler, J. S., Logan, J., Gatley, S. J., Wong, C., Hitzemann, R., and Pappas, N. R. (1999) Reinforcing effects of psychostimulants in humans are associated with increases in brain dopamine and occupancy of D(2) receptors. J. Pharmacol. Exp. Ther. 291, 409 – 415 Ernst, T., Chang, L., Leonido-Yee, M., and Speck, O. (2000) Evidence for long-term neurotoxicity associated with methamphetamine abuse: A 1H MRS study. Neurology 54, 1344 –1349 Ricaurte, G. A., Guillery, R. W., Seiden, L. S., Schuster, C. R., and Moore, R. Y. (1982) Dopamine nerve terminal degeneration produced by high doses of methylamphetamine in the rat brain. Brain Res. 235, 93–103 Ricaurte, G. A., Schuster, C. R., and Seiden, L. S. (1980) Long-term effects of repeated methylamphetamine administration on dopamine and serotonin neurons in the rat brain: a regional study. Brain Res. 193, 153–163 O’Callaghan, J. P., and Miller, D. B. (1994) Neurotoxicity profiles of substituted amphetamines in the C57BL/6J mouse. J. Pharmacol. Exp. Ther. 270, 741–751 Preston, K. L., Wagner, G. C., Schuster, C. R., and Seiden, L. S. (1985) Long-term effects of repeated methylamphetamine administration on monoamine neurons in the rhesus monkey brain. Brain Res. 338, 243–248 Steranka, L. R., and Sanders-Bush, E. (1980) Long-term effects of continuous exposure to amphetamine on brain dopamine concentration and synaptosomal uptake in mice. Eur. J. Pharmacol. 65, 439 – 443 Eisch, A. J., and Marshall, J. F. (1998) Methamphetamine neurotoxicity: dissociation of striatal dopamine terminal damage from parietal cortical cell body injury. Synapse 30, 433– 445 Stumm, G., Schlegel, J., Schafer, T., Wurz, C., Mennel, H. D., Krieg, J. C., and Vedder, H. (1999) Amphetamines induce apoptosis and regulation of bcl-x splice variants in neocortical neurons. FASEB J. 13, 1065–1072 Volkow, N. D., Chang, L., Wang, G. J., Fowler, J. S., Franceschi, D., Sedler, M. J., Gatley, S. J., Hitzemann, R., Ding, Y. S., Wong, C., and Logan, J. (2001) Higher cortical and lower subcortical metabolism in detoxified methamphetamine abusers. Am. J. Psychiatry 158, 383–389 Deng, X., Ladenheim, B., Tsao, L. I., and Cadet, J. L. (1999) Null mutation of c-fos causes exacerbation of methamphetamine-induced neurotoxicity. J. Neurosci. 19, 10107–10115 Deng, X., and Cadet, J. L. (2000) Methamphetamine-induced apoptosis is attenuated in the striata of copper-zinc superoxide dismutase transgenic mice. Mol. Brain Res. 83, 121–124 Cadet, J. L., Ordonez, S. V., and Ordonez, J. V. (1997) Methamphetamine induces apoptosis in immortalized neural cells: protection by the proto-oncogene, bcl-2. Synapse 25, 176 –184 LaVoie, M. J., and Hastings, T. G. (1999) Dopamine quinone formation and protein modification associated with the striatal neurotoxicity of methamphetamine: evidence against a role for extracellular dopamine. J. Neurosci. 19, 1484 –1491 Jayanthi, S., Ladenheim, B., and Cadet, J. L. (1998) Methamphetamine-induced changes in antioxidant enzymes and lipid peroxidation in copper/zinc-superoxide dismutase transgenic mice. Ann. N.Y. Acad. Sci. 844, 92–102 Korsmeyer, S. J., Shutter, J. R., Veis, D. J., Merry, D. E., and Oltvai, Z. N. (1993) Bcl-2/Bax: a rheostat that regulates an anti-oxidant pathway and cell death. Semin. Cancer Biol. 4, 327–332 Reed, J. C. (1996) Mechanisms of Bcl-2 family protein function and dysfunction in health and disease. Behring Inst. Mitt. 72–100 Lam, M., Dubyak, G., Chen, L., Nunez, G., Miesfeld, R. L., and Distelhorst, C. W. (1994) Evidence that BCL-2 represses apoptosis by regulating endoplasmic reticulum-associated Ca2⫹ fluxes. Proc. Natl. Acad. Sci. USA 91, 6569 – 6573 Bogdanov, M. B., Ferrante, R. J., Mueller, G., Ramos, L. E., Martinou, J. C., and Beal, M. F. (1999) Oxidative stress is attenuated in mice overexpressing BCL-2. Neurosci. Lett. 262, 33–36 Kluck, R. M., Bossy-Wetzel, E., Green, D. R., and Newmeyer, D. D. (1997) The release of cytochrome c from mitochondria: a

1751

23.

24.

25.

26.

27. 28. 29.

30. 31.

32. 33.

34.

35. 36. 37.

38.

39. 40.

41.

42. 43.

1752

primary site for Bcl-2 regulation of apoptosis. Science 275, 1132–1136 Susin, S. A., Zamzami, N., Castedo, M., Hirsch, T., Marchetti, P., Macho, A., Daugas, E., Geuskens, M., and Kroemer, G. (1996) Bcl-2 inhibits the mitochondrial release of an apoptogenic protease. J. Exp. Med. 184, 1331–1341 Yang, J., Liu, X., Bhalla, K., Kim, C. N., Ibrado, A. M., Cai, J., Peng, T. I., Jones, D. P., and Wang, X. (1997) Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science 275, 1129 –1132 Marchetti, P., Castedo, M., Susin, S. A., Zamzami, N., Hirsch, T., Macho, A., Haeffner, A., Hirsch, F., Geuskens, M., and Kroemer, G. (1996) Mitochondrial permeability transition is a central coordinating event of apoptosis. J. Exp. Med. 184, 1155–1160 Marzo, I., Brenner, C., Zamzami, N., Susin, S. A., Beutner, G., Brdiczka, D., Remy, R., Xie, Z. H., Reed, J. C., and Kroemer, G. (1998) The permeability transition pore complex: a target for apoptosis regulation by caspases and bcl-2-related proteins. J. Exp. Med. 187, 1261–1271 Cohen, G. M. (1997) Caspases: the executioners of apoptosis. Biochem. J. 326, 1–16 Satoh, M. S., and Lindahl, T. (1992) Role of poly(ADP-ribose) formation in DNA repair. Nature (London) 356, 356 –358 Shimizu, S., Eguchi, Y., Kamiike, W., Akao, Y., Kosaka, H., Hasegawa, J., Matsuda, H., and Tsujimoto, Y. (1996) Involvement of ICE family proteases in apoptosis induced by reoxygenation of hypoxic hepatocytes. Am. J. Physiol. 271, G949 –G958 Allen, R. T., Cluck, M. W., and Agrawal, D. K. (1998) Mechanisms controlling cellular suicide: role of Bcl-2 and caspases. Cell. Mol. Life Sci. 54, 427– 445 Boyd, J. M., Gallo, G. J., Elangovan, B., Houghton, A. B., Malstrom, S., Avery, B. J., Ebb, R. G., Subramanian, T., Chittenden, T., Lutz, R. J., and et al. (1995) Bik, a novel deathinducing protein shares a distinct sequence motif with Bcl-2 family proteins and interacts with viral and cellular survivalpromoting proteins. Oncogene 11, 1921–1928 White, E. (1996) Life, death, and the pursuit of apoptosis. Genes Dev. 10, 1–15 DeRisi, J., Penland, L., Brown, P. O., Bittner, M. L., Meltzer, P. S., Ray, M., Chen, Y., Su, Y. A., and Trent, J. M. (1996) Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat. Genet. 14, 457– 460 Nau, M. E., Emerson, L. R., Martin, R. K., Kyle, D. E., Wirth, D. F., and Vahey, M. (2000) Technical assessment of the affymetrix yeast expression GeneChip YE6100 platform in a heterologous model of genes that confer resistance to antimalarial drugs in yeast. J. Clin. Microbiol. 38, 1901–1908 Zamorano, P. L., Mahesh, V. B., and Brann, D. W. (1996) Quantitative RT-PCR for neuroendocrine studies. A minireview. Neuroendocrinology 63, 397– 407 Diehn, M., Eisen, M. B., Botstein, D., and Brown, P. O. (2000) Large-scale identification of secreted and membrane-associated gene products using DNA microarrays. Nat. Genet. 25, 58 – 62 Cadet, J. L., Jayanthi, S., McCoy, M. T., Vawter, M., and Ladenheim, B. (2001) Temporal profiling of methamphetamine-induced changes in gene expression in the mouse brain: evidence from cDNA array. Synapse 41, 40 – 48 Chittenden, T., Flemington, C., Houghton, A. B., Ebb, R. G., Gallo, G. J., Elangovan, B., Chinnadurai, G., and Lutz, R. J. (1995) A conserved domain in Bak, distinct from BH1 and BH2, mediates cell death and protein binding functions. EMBO J. 14, 5589 –5596 Oltvai, Z. N., Milliman, C. L., and Korsmeyer, S. J. (1993) Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609 – 619 Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B., and Korsmeyer, S. J. (1995) Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell 80, 285–291 Kelekar, A., Chang, B. S., Harlan, J. E., Fesik, S. W., and Thompson, C. B. (1997) Bad is a BH3 domain-containing protein that forms an inactivating dimer with Bcl-XL. Mol. Cell. Biol. 17, 7040 –7046 Patel, T., Gores, G. J., and Kaufmann, S. H. (1996) The role of proteases during apoptosis. FASEB J. 10, 587–597 Kumar, S. (1995) ICE-like proteases in apoptosis. Trends Biochem. Sci. 20, 198 –202

Vol. 15

August 2001

44. 45. 46. 47. 48.

49.

50. 51.

52.

53.

54. 55. 56.

57.

58.

59.

60.

61.

62.

Henkart, P. A. (1995) Apoptosis: O death, where is thy sting? J. Immunol. 154, 4905– 4908 Gibb, J. W., Bush, L., and Hanson, G. R. (1997) Exacerbation of methamphetamine-induced neurochemical deficits by melatonin. J. Pharmacol. Exp. Ther. 283, 630 – 635 Seiden, L. S., and Sabol, K. E. (1996) Methamphetamine and methylenedioxymethamphetamine neurotoxicity: possible mechanisms of cell destruction. NIDA Res. Monogr. 163, 251–276 Wagner, G. C., Seiden, L. S., and Schuster, C. R. (1979) Methamphetamine-induced changes in brain catecholamines in rats and guinea pigs. Drug Alcohol Depend. 4, 435– 438 Won, L., Kontur, P. J., Choi, H. K., Hoffmann, P. C., Heller, B., and Heller, A. (1992) Acute and persistent effects of methamphetamine on developing monoaminergic neurons in reaggregate tissue culture. Brain Res. 575, 6 –12 Ryan, L. J., Linder, J. C., Martone, M. E., and Groves, P. M. (1990) Histological and ultrastructural evidence that D-amphetamine causes degeneration in neostriatum and frontal cortex of rats. Brain Res. 518, 67–77 Eisch, A. J., Schmued, L. C., and Marshall, J. F. (1998) Characterizing cortical neuron injury with Fluoro-Jade labeling after a neurotoxic regimen of methamphetamine. Synapse 30, 329 –333 Robinson, T. E., and Kolb, B. (1997) Persistent structural modifications in nucleus accumbens and prefrontal cortex neurons produced by previous experience with amphetamine. J. Neurosci. 17, 8491– 897 Yamamoto, H., Yamamoto, T., Goji, K., Yang, X., Kawai, N., Baba, A., and Moroji, T. (1996) Non-aminergic effects of amphetamine on the NMDA receptor in primary cultured cortical cells. Ann. N.Y. Acad. Sci. 801, 327–339 Sedlak, T. W., Oltvai, Z. N., Yang, E., Wang, K., Boise, L. H., Thompson, C. B., and Korsmeyer, S. J. (1995) Multiple Bcl-2 family members demonstrate selective dimerizations with Bax. Proc. Natl. Acad. Sci. USA 92, 7834 –7838 Yin, X. M., Oltvai, Z. N., and Korsmeyer, S. J. (1995) Heterodimerization with Bax is required for Bcl-2 to repress cell death. Curr. Top. Microbiol. Immunol. 194, 331–338 Cadet, J. L., and Brannock, C. (1998) Free radicals and the pathobiology of brain dopamine systems. Neurochem. Int. 32, 117–131 Acikgoz, O., Gonenc, S., Kayatekin, B. M., Pekcetin, C., Uysal, N., Dayi, A., Semin, I., and Gure, A. (2000) The effects of single dose of methamphetamine on lipid peroxidation levels in the rat striatum and prefrontal cortex. Eur. Neuropsychopharmacol. 10, 415– 418 De Miglio, M. R., Muroni, M. R., Simile, M. M., Calvisi, D. F., Tolu, P., Deiana, L., Carru, A., Bonelli, G., Feo, F., and Pascale, R. M. (2000) Implication of Bcl-2 family genes in basal and D-amphetamine-induced apoptosis in preneoplastic and neoplastic rat liver lesions. Hepatology 31, 956 –965 Jurgensmeier, J. M., Xie, Z., Deveraux, Q., Ellerby, L., Bredesen, D., and Reed, J. C. (1998) Bax directly induces release of cytochrome c from isolated mitochondria. Proc. Natl. Acad. Sci. USA 95, 4997–5002 Rosse, T., Olivier, R., Monney, L., Rager, M., Conus, S., Fellay, I., Jansen, B., and Borner, C. (1998) Bcl-2 prolongs cell survival after Bax-induced release of cytochrome c. Nature (London) 391, 496 – 499 Krajewski, S., Tanaka, S., Takayama, S., Schibler, M. J., Fenton, W., and Reed, J. C. (1993) Investigation of the subcellular distribution of the bcl-2 oncoprotein: residence in the nuclear envelope, endoplasmic reticulum, and outer mitochondrial membranes. Cancer Res. 53, 4701– 4714 Vander Heiden, M. G., Chandel, N. S., Schumacker, P. T., and Thompson, C. B. (1999) Bcl-xL prevents cell death following growth factor withdrawal by facilitating mitochondrial ATP/ ADP exchange. Mol. Cell 3, 159 –167 Gross, A., Yin, X. M., Wang, K., Wei, M. C., Jockel, J., Milliman, C., Erdjument-Bromage, H., Tempst, P., and Korsmeyer, S. J. (1999) Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death. J. Biol. Chem. 274, 1156 –1163

The FASEB Journal

Received for publication January 8, 2001. Revised for publication April 12, 2001.

JAYANTHI ET AL.