Microbial communities and chemical changes during fermentation of ...

World J Microbiol Biotechnol (2010) 26:1241–1250 DOI 10.1007/s11274-009-0294-x

ORIGINAL PAPER

Microbial communities and chemical changes during fermentation of sugary Brazilian kefir Karina Teixeira Magalha˜es • G. V. de M. Pereira Disney Ribeiro Dias • Rosane Freitas Schwan

•

Received: 8 November 2009 / Accepted: 17 December 2009 / Published online: 20 January 2010 Ó Springer Science+Business Media B.V. 2010

Abstract The microorganisms associated with sugary Brazilian kefir beverage were investigated using a combination of culture-dependent and -independent methods. A total of 289 bacteria and 129 yeasts were identified via phenotypic and genotypic methods. Lb. paracasei (23.8%) was the major bacterial isolate identified, followed by Acetobacter lovaniensis (16.31%), Lactobacillus parabuchneri (11.71%), Lactobacillus kefir (10.03%) and Lactococcus lactis (10.03%). Saccharomyces cerevisiae (54.26%) and Kluyveromyces lactis (20.15%) were the most common yeast species isolated. Scanning electron microscopy showed that the microbiota was dominated by lemon-shaped yeast cells growing in close association with Lactobacillus (long and curved). Some lactic acid bacteria detected by sequence analysis of DGGE (denaturing gradient gel electrophoresis) bands were not recovered at any time through fermentation by plating. Conversely, DGGE fingerprints did not reveal bands corresponding to some of the species isolated by culturing methods. The bacteria Acetobacter lovaniensis and the yeast Kazachstania aerobia are described for the first time in sugary kefir. During the 24 h of fermentation, the concentration of lactic acid ranged from 0.2 to 1.80 mg/ml, and that of acetic acid increased from 0.08 to 1.12 mg/ml. The production of ethanol was limited, reaching a final mean value of 1.24 mg/ml.

K. T. Magalha˜es G. V. de M. Pereira R. F. Schwan (&) Biology Department, Federal University of Lavras (UFLA), 37.200-000 Lavras, MG, Brazil e-mail: [email protected] D. R. Dias Unilavras, Centro Universita´rio de Lavras, 37.200-000 Lavras, MG, Brazil

Keywords PCR-DGGE Culture-dependent and -independent methods Microbial community Lactobacillus Saccharomyces

Introduction Kefir is a fermented beverage that is self-carbonated, has a sharp acidic taste and a yeasty flavour and contains a low percentage of alcohol [less than 2% (v/v)]. The beverage is commonly manufactured by fermenting milk with kefir grains by a complex microbial symbiotic mixture of lactic acid bacteria (LAB, as Lactobacillus, Lactococcus, Leuconostoc, and Streptococcus), and yeasts (Kluyveromyces, and Saccharomyces) (Simova et al. 2002; Jianzhong et al. 2009).The symbiosis between LAB and yeasts also occurs in the fermentation of traditional beverages such as shubat from camel milk (Rahman et al. 2009) and gari and cauim from cassava (Almeida et al. 2007). Kefir grains can be also cultivated in a solution of raw sugar and water, known as sugary kefir. Sugary kefir grains are very similar to milk kefir grains in terms of their structure, associated microorganisms and products formed during the fermentation process (Pidoux et al. 1990). This beverage is mainly consumed in Mexico and Brazil. In Brazil, the beverage is only homemade, and there are no reports regarding the microbiological and chemical compositions either of the grains or of the beverage. The microbial populations of sugary kefir include LAB, such as Lactobacillus paracasei, Lactobacillus hilgardii, Leuconostoc mesenteroides and Streptococcus lactis, acetic acid bacteria (AAB) such as Acetobacter, Bacillus, and a small proportion of yeasts, such as Zygosaccharomyces, Candida, and Kloekera (Pidoux 1989; Pidoux et al. 1990). These characterizations were restricted to the microbiota of

123

1242

the grains, and until recently, we were not aware of any reports of microbial ecological studies of sugary kefir. For many years, research on the microbiota of kefir grains has relied on conventional culturing methods followed by phenotypic and/or genotypic identification of a (randomly) selected subset of purified isolates. Recently, molecular culture-independent approaches have proven to be powerful tools in providing a more complete inventory of the microbial diversity in food samples (Giraffa 2004) and PCR-DGGE has been applied successfully to assess the microbiota in milk kefir grains (Chen et al. 2008; Jianzhong et al. 2009). Despite the limitations of conventional culturing methods, this remains the only way to obtain microbial strains of importance for biotechnology purposes and may still provide a useful means for investigating microbial succession by enumerating viable cells at every stage of fermentation. Thus, a combination of conventional culturing methods and PCR-DGGE is needed to describe in maximal detail the microbiota present within food (Chen et al. 2008). The main aim of this study was to assess the microbial diversity of sugary Brazilian kefir beverage made from raw sugar solution. For this purpose, a combined approach of conventional culturing and genotypic identification with culture-independent analysis using PCR-DGGE was performed. In parallel, physicochemical and scanning electron microscopy characterizations were used for both the grains and the beverage.

Materials and methods Samples and inoculation of Brazilian kefir grains Twenty-one samples of sugary Brazilian kefir grains were obtained from a private household in the city of Lavras, which is located in the southern State of Minas Gerais, Brazil. The grains (250 g) were washed with distilled water and inoculated in 2,250 ml of substrate (5% of brown sugar in distilled water) and were incubated for 24 h at 25°C. Samples of the beverage were aseptically taken every 6 h. Four fermentations were performed in the same conditions described above. Enumeration of different groups of bacteria and yeast Bacteria and yeasts were enumerated by the surface spread technique, plating in triplicate 100 ll of each diluted sample. Enumeration of microorganisms was carried out using 7 different culture media. Mesophilic bacteria were enumerated in Nutrient Agar medium (Oxoid, Hampshire, England). De Man, Rogosa and Sharpe Agar (MRS, Oxoid)

123

World J Microbiol Biotechnol (2010) 26:1241–1250

was used to enumerate Lactobacillus. M17 agar (Oxoid), 254 medium (DSMZ, Germany), Edwards modified medium (Oxoid) and LUSM medium (Rabat, Morocco) were used for the enumeration of Lactococcus, Acetobacter, Streptococcus and Leuconostoc, respectively. All media for bacterial enumeration were supplemented with 0.4 mg/ml nystatin (Sigma, St. Louis, USA). Yeasts were enumerated on MYGP agar containing 100 mg chloramphenicol and 50 mg chlortetracycline to inhibit bacterial growth (Schwan et al. 2007). After spreading, plates were incubated at 28°C for 48 h for bacteria, and 5 days for yeasts; and colony forming units (log10c.f.u./ml) were quantified. For each type of medium containing isolated colonies, the square root of the number of colonies was taken at random for identification (Holt et al. 1994). Identification of bacteria by conventional and molecular methods Gram-negative bacteria were identified using Bac-Tray Kits I, II and III (Difco) according to the manufacturer’s instructions. Gram-positive bacteria were subdivided into sporeformers and non-spore-formers by heating at 80°C for 10 min to kill the vegetative cells (Almeida et al. 2007). Subsequent identification was performed using biochemical and motility tests as recommended in Bergey’s Manual of Determinative Bacteriology (Holt et al. 1994) and The Prokaryotes (Hammes and Hertel 2003), and results were confirmed by using the API 50 CHB galleries (BioMerieux). Presumptive Lactobacillus were counted on Rogosa agar. Isolates were examined for colony and cell appearance, catalase activity, Gram staining, motility and production of CO2 from glucose in MRS broth with a Durham tube. Biochemical characterizations of the strains were performed with API ID 32 for Lactococcus and Enterococcus and API 50 CHL (BioMerieux) for Lactobacillus and Leuconostoc. Lactobacillus were recognised as Gram-positive, catalase-negative, oxidase-negative, regular fermentative rods. They were classified into obligately homofermentative, facultatively heterofermentative and obligately heterofermentative by their ability to produce CO2 from glucose and gluconate. The bacterial DNA from pure cultures was extracted according to Wang et al. (2006). Sequencing of portions of the 16S rDNA gene was used for identification of representative bacteria. The forward primer was 27f (50 AGAGTTTGATCCTGGCTCAG 30 ) and the reverse primer was 1512r (50 ACGGCTACCTTGTTACGACT 30 ). PCR was performed as described by Wang et al. (2006). Amplification products were separated by electrophoresis in a 0.7% agarose gel at 60–65 V in 0.59TAE for 1 h. The samples were analysed with an automated DNA sequencer


(Applied Biosystems, Foster City, CA, USA). GenBank searches (http://www.ncbi.nlm.nih.gov/BLAST/) were performed to determine the closest known relatives of the partial ribosomal DNA sequences obtained. Identification of yeast by conventional and molecular methods Phenotype characteristics of all yeast isolates was determining by their morphology, spore formation, assimilation and fermentation of different carbon sources according to Barnett et al. (2000). Yeast identities were verified using the keys of Barnett et al. (2000). Yeast DNA from pure cultures was extracted according to Makimura et al. (1999). Sequencing of portions of the ITS region was used for identification of representative yeast isolates. For amplification of the ITS region, the primers ITS1 (50 -TCCGTAGGTGAACCTGCGG-30 ) and ITS4 (50 -TCCTCCGCTTATTGATATGC-30 ) were used. PCR was performed as described by Naumova et al. (2004). The products were analysed as previously described for bacteria. DNA extraction and PCR-DGGE analysis of the sugary kefir Three ml of each sample was centrifuged at 17,500 9 g for 5 min, three times. Pellets were resuspended in 400 ll of sterilised water. Each sample was transferred into a plastic tube and was subjected to DNA extraction using a NucleoSpin Tissue kit (Macherey-Nagel, Du¨ren, Germany). DNA extraction was performed according to the manufacturer’s instructions. The genomic DNA was resuspended in sterilized water and stored at -20°C. The bacterial community DNA was amplified with primers 338fgc and 518r spanning the V3 region of the 16S rDNA gene (Ovreas et al. 1997). The yeast community DNA was amplified using the primers NS3 and YM951r (Haruta et al. 2006). The PCR mix (25 ll) contained: 0.625 ¯ Taq DNA polymerase (Promega, Milan, Italy), 2.5 ll of U 109 buffer, 0.1 mM dNTPs, 0.2 lM of each primer, 1.5 mM MgCl2 and 1 ll of DNA diluted to 10 ng/ll. The amplification was carried out as follows: template DNA was denatured for 5 min at 95°C followed by 30 cycles of denaturing at 92°C for 60 s, annealing at 55°C for 60 s and primer extension at 72°C for 60 s. The tubes were then incubated for 10 min at 72°C for the final extension. Aliquots (2 ll) of the amplification products were analysed by electrophoresis on 1% agarose gels before they were subjected to DGGE. The PCR products were analysed by DGGE using a BioRad DCode Universal Mutation Detection System (BioRad, Richmond, CA, USA). Samples were applied to 8%

1243

(w/v) polyacrylamide gels in 0.5 9 TAE. Optimal separation was achieved with a 15-55% urea-formamide denaturing gradient for the bacterial community and a 12-50% gradient for the yeast community, where 100% is defined as 7 M urea and 40% (v/v) formamide. Electrophoresis was carried out for 3 h at 200 V at 60°C, and the gels were stained with SYBR-Green I (Molecular Probes, Eugene, OR, USA) (1:10,000 v/v) for 30 min. The gels were visualised via u.v. transillumination, and images were captured using a Polaroid camera (Concord, USA). The bands were excised with a sterile surgical blade and stored at -20°C until further analysis. Identification and analysis of DGGE fragments DGGE bands were excised from the acrylamide gels and the fragments were purified using the QIAEXÒ II gel extraction kit (Qiagen, Chatsworth, CA, USA). DNA recovered from each DGGE band was reamplified using the primers 338f (without GC clamp) and 518r for bacteria and NS3 (without GC clamp) and YM951r for yeast. The PCR amplicons were then sequenced (Applied Biosystems, Foster City, CA, USA). GenBank searches (http://www. ncbi.nlm.nih.gov/BLAST/) were performed to determine the closest known relatives of the partial ribosomal DNA sequences obtained. The multiple alignment and phylogenetic tree was made with CLUSTALX 1.81 (Thompson et al. 1997) using the neighbour-joining method replicated 1,000 times. MEGA 3.1 (Kumar et al. 2008) was used to assess the phylogenetic tree. Substrates and metabolites Ethanol, organic acids (acetic acid and lactic acid) and carbohydrates (glucose, sucrose and fructose) were obtained from sample extracts every 6 h and analysed according Schwan et al. (2001) and Duarte et al. (2008). All samples were examined in triplicate. Chemical analysis At 0 and 24 h, the samples were characterized in relation to soluble solids, total titratable acidity and pH, vitamin C (ascorbic acid), ash, iron, moisture and dry matter content for the beverage as well as moisture and dry matter content for the grain, following the AOAC methodology (1995). Crude protein was determined in the beverage using the Kjeldahl method. Scanning electron microscopy (SEM) Kefir grains were sliced for SEM (Guzel-Seydim et al. 2005). Samples were collected from the outer and inner

123

1244

parts of the grains. The grains were fixed (Karnovisks solution) at pH 7.2 for 24 h. The samples were then transferred to 30% glycerol for 30 min and immersed in liquid nitrogen for subsequent fracture in the metal surface. Then grains were post-fixed in 10 g/l osmium tetroxide in phosphate buffer for 1 h at 25°C and dehydrated in acetone: 15, 30, 50 and 70%, three times. After dehydrating, samples were critical-point dried and coated with gold using a Bal-tec SDC 050. The preparations were observed using a scanning electron microscope (LEO EVO 040).

Results and discussion Physicochemical characterization Ethanol, organic acids (lactic and acetic acids) and carbohydrates (sucrose, glucose and fructose) were analysed during fermentation (Fig. 1a, b, respectively). The lactic acid decreased significantly during 24 h of fermentation. The ethanol concentration increased just after the initiation of fermentation and reached the maximum at 12 h (Fig. 1a). Yeasts of the genera Saccharomyces, Candida, Kluyveromyces and Torulaspora seem to be the main types responsible for the production of ethanol in kefir. However,


some representatives of the heterolactic bacterial genera, as Lactobacillus, and homofermentative Lactococcus may also have produced a fraction of the concentration of ethanol found in the beverage. The production of acetic acid increased during the fermentation process, and the final concentration was approximately 1.4 mg/ml (Fig. 1a). These observations indicated that the simultaneous process of saccharification and alcohol fermentation was followed by the production of acetic acid. Part of the ethanol content may have been converted to acetic acid by heterofermentative bacteria of the genus Acetobacter (Tables 1 and 2) after 12 h of fermentation (Fig. 1a). These bacteria have alcohol dehydrogenase activity, which converts ethanol to acetaldehyde (Beshkova et al. 2003). The low pH value (4.1) present at the end of fermentation appears to be responsible for the presence of Lactobacillus as the major bacterial species at 24 h (Tables 1 and 2). The increase in concentration of reducing sugars (glucose and fructose) correlated with the decrease of sucrose (Fig. 1b) and total soluble solids (8Brix) at the end of fermentation (Table 3). The hydrolysis of sucrose by yeast invertase resulted in an increase of glucose and fructose levels (Fig. 1b). The protein content increased after 24 h of fermentation (Table 3), which might be correlated with the increase of microbial biomass during this process and consequently secretion of protein molecules, contributing to nutritional value of sugary kefir (Simova et al. 2006). Moisture, dry matter and ash contents showed no differences after 24 h of fermentation. However, an increase in moisture and dry matter was observed in kefir grain (Table 3). The kefir grain itself is a matrix constituted in part by dextran (kefiran), which is a glucose polymer that is capable of retaining water during the fermentation process. Additionally, the increase in microbial biomass explains the higher concentration of dry matter found in grains of kefir (Garrote et al. 2001; Giraffa 2004). Enumeration and identification of isolates by a culture-dependent method

Fig. 1 Chemical parameters of the fermentation process. a Lactic acid, black up pointing triangle; acetic acid, wide square and ethanol, Black diamond suit. b Fructose, Lozenge; glucose, Black square and sucrose, Increment

123

Descriptions of the different types of yeast and bacteria present in different batches of milk kefir grains have been provided by different authors (Garrote et al. 2001; Witthuhn et al. 2004; Jianzhong et al. 2009). However, these studies were restricted to the grains, and none of them analysed the beverage. Using conventional culture techniques, we have monitored for the first time the development of bacterial and fungal communities during fermentation of sugary kefir. Previous results have shown that two groups of microorganisms co-exist in milk kefir grains: lactic acid bacteria and yeast (Chen et al. 2008). In order to establish the different species of bacteria and yeast present during fermentation, a representative number of

World J Microbiol Biotechnol (2010) 26:1241–1250 Table 1 Mean counts (log c.f.u./g) of microorganisms in fermentation of sugary Brazilian kefir beverage

LC, Lactococcus; LB, Lactobacillus; TMAB, total mesophilic aerobic bacteria; LE, Leuconostoc; AC, Acetobacter; YM, Yeasts; SWI, substrate without inoculum; ND, not detected; ±, SD

Table 2 Distribution of bacteria and yeast isolated during 24 h of sugary Brazilian kefir beverage produced from raw sugar

Time (h)

1245

LC

LB

TMAB

LE

AC

YM

SWI

ND

ND

ND

ND

ND

ND

0

6.62 ± 0.01

6.82 ± 0.01

5.81 ± 0.07

6.03 ± 0.04

6.11 ± 0.05

5.63 ± 0.01

6

6.54 ± 0.01

6.94 ± 0.01

5.62 ± 0.09

6.61 ± 0.21

6.92 ± 0.01

6.14 ± 0,03

12

7.41 ± 0.02

7.82 ± 0.01

6.53 ± 0.04

7.62 ± 0.01

7.62 ± 0.01

6.31 ± 0.01

18

7.52 ± 0.01

7.62 ± 0.01

7.12 ± 0.01

7.43 ± 0.01

7.63 ± 0.01

6.91 ± 0.05 7.31 ± 0.07

24

8.41 ± 0.08

8.32 ± 0.04

8.21 ± 0.12

8.41 ± 0.06

8.31 ± 0.06

Min

6.62 ± 0.01

6.82 ± 0.01

5.81 ± 0.07

6.03 ± 0.04

6.11 ± 0.05

5.63 ± 0.01

Max

8.41 ± 0.08

8.32 ± 0.04

8.21 ± 0.12

8.41 ± 0.06

8.31 ± 0.06

7.31 ± 0.07

Closest relative

Identity (%)

Accession number

Distribution (%) (identified number/ total isolates)

Fermentation time (h)

Lactobacillus paracasei

98

AB368902.1 23.8(69/289)

?(12) ?(9)

?(14) ?(11) ?(23)

Lactobacillus parabuchneri

99

AB368914.1 11.76(34/289)

?(7)

?(2)

?(9)

?(4)

?(12)

Lactobacillus kefiri

99

AB362680.1 10.03(29/289)

?(2)

?(6)

?(6)

?(3)

?(12)

Lactococcus lactis

99

EU194346.1 10.03(29/289)

?(3)

?*

?*

?(8)

?(18)

Lactobacillus casei

99

EU626005.1 8.6(25/289)

?(2)

?*

?(6)

?(8)

?(9)

Lactobacillus paracasei subsp. paracasei

99

NR025880.1 7.96(23/289)

?(8)

?(8)

?(*)

?(*)

?(7)

Leuconostoc citreum

99

FJ378896.1

?*

?*

?(4)

?(3)

?(9)

Lactobacillus paracasei subsp. tolerans

98

AB181950.1 3.11(9/289)

-(*)

-(*)

-(*)

-(*)

-(9)

Lactobacillus buchneri

99

FJ867641.1

-(*)

-(*)

-(*)

-(*)

-(7)

Acetobacter lovaniensis

98

AB308060.1 16.61(48/289)

?(9)

?(8)

?(8)

?(7)

?(16)

0

6

12

18

24

Bacteria

5.54(16/289)

2.42(7/289)

Total

289

Yeast ? detected by PCR-DGGE and sequencing of the DNA fragment upon excision from the gel; -, not detected by PCRDGGE; values in parentheses are numbers of colonies detected by culturing and identified by sequencing of 16S rDNA; * species not isolated by culturing methods

Saccharomyces cerevisiae Kluyveromyces lactis

100

EU649673.1 54.26(70/129)

?(15) ?(16) ?(8)

?(9)

?(22)

99

AJ229069.1

20.15(26/129)

?(3)

?(4)

?*

?(4)

?(15)

Lachancea meyersii

99

AY645661.1 10.85(14/129)

-(*)

-(2)

-(3)

-(*)

-(9)

Kazachstania aerobia Total

99

AY582126.1 14.73(19/129)

-(*)

-(*)

-(5)

-(8)

-(6)

isolates from each culture medium were identified (Table 1). Lactobacillus was the most frequently found microorganism, showing an initial population of around 6.82 log10 c.f.u./ml that reached 8.32 log10 c.f.u./ml.

129

The average number of yeast, which was \6.00 log10 c.f.u./ml early in the fermentation process, increased to 7.31 log10 c.f.u./ml by the end of 24 h of fermentation. This yeast growth during fermentation was favoured by

123

1246


Table 3 Physicochemical characterization of grains and sugary Brazilian kefir beverage Characteristics

Fermentation time (h) 0

24

Beverage Total titratable acid (g/100 ml)

0.02 ± 0.01

0.07 ± 0.01

pH Total soluble solids°Brix

5.6 ± 0.1 5.2 ± 0.2

4.1 ± 0.1 4.1 ± 0.1

Protein (%)

0.2 ± 0.1

0.4 ± 0.1

Vitamin C (%)

ND

ND

Fe (%)

2.4 ± 0.2

2.5 ± 0.2

Moisture (%)

95.3 ± 0.1

95.3 ± 0.1

Dry matter (%)

4.7 ± 0.1

4.7 ± 0.1

Ash (%)

0.2 ± 0.1

0.2 ± 0.1

Grains Moisture (%)

80.5 ± 0.1

91.5 ± 0.5

Dry matter (%)

13.1 ± 0.2

22.1 ± 0.3

ND, not detected; ±, SD

acidification of the environment created by bacteria, and the growth of bacteria was stimulated by the presence of yeast, which can provide growth factors such as vitamins and soluble nitrogen compounds (Giraffa 2004; Almeida et al. 2007). Acetobacter, total mesophilic aerobic bacteria, Leuconostoc and Lactococcus showed similar behaviour for growth, ranging from *6.00 log10 c.f.u./ml to 8.00 log10 c.f.u./ml. In general, lactic acid bacteria were more numerous (108–109) than yeast (105–106) and acetic acid bacteria (105–106) in milk kefir grains, although fermentation conditions can affect this pattern (Garrote et al. 2001). A total of 418 isolates were obtained from sugary Brazilian kefir (Table 2). Among the isolates, 289 were bacteria and 129 were yeast. During the fermentative process, the predominant microorganisms identified were lactic acid bacteria (57.65%), followed by yeast (30.86%) and acetic acid bacteria (11.48%). The culture-dependent approach indicated that Lb. paracasei represents the largest and most commonly identified LAB isolates, with 69 of a total of 289 isolates, followed by Lactobacillus parabuchneri (34 isolates; 11.76%), Lactobacillus kefiri (29 isolates; 10.03%) and Lactococcus lactis (29 isolates; 10.03%) (Table 2). Lactobacillus casei (25 isolates; 8.6%), Lactobacillus paracasei subsp. paracasei (23 isolates; 7.96%) and Leuconostoc citreum (16 isolates; 5.54%) were the other identified members of the LAB population. Isolates of Lactobacillus paracasei subsp. tolerans (9 isolates, 3.11%) and Lactobacillus buchneri (7 isolates; 2.42%) were also sporadically identified.

123

Our data indicated that the sugary kefir contained a diverse spectrum LAB group including Lactobacillus, Lactococcus and Leuconostoc. Lactobacillus kefiri is another important bacterium found during kefir fermentation. There are reports on the presence of Lactobacillus kefiri as a prevailing member of the lactic acid microbiota in milk Kefir (Garrote et al. 2001; Chen et al. 2008). In our study, Lb. kefiri fixed on the grain surface might be easily freed from kefir grains into the substrate of raw sugar with water, thus resulting in the increased cell counts. The following LAB were also commonly found: Lactobacillus parabuchneri, Lactococcus lactis and Lactobacillus casei, while the only representative of the Leuconostoc group, Leuconostoc citreum, was sporadically isolated after 12 h of fermentation. Previous studies showed that a variety of different species of Lactobacillus and Lactococcus have been isolated and identified in milk kefir grains from around the world (Simova et al. 2002). The acetic acid species, Acetobacter lovaniensis, was also identified (48 isolates, 16.61%). Acetobacter lovaniensis species belongs to the A. pasteurianus group. The species Acetobacter pasteurianus consists of five subspecies, and Acetobacter pasteurianus subsp. lovaniensis has been also described in fermented food from Indonesia and the Philippines (Lisdiyanti et al. 2000). The lactose-fermenting yeast, Kluyveromyces lactis, was found in the Brazilian kefir beverage together with non-lactose-fermenting yeast (S. cerevisiae, Lachancea meyersii and Kazachstania aerobia) (Table 2). The yeast flora of sugary kefir was dominated by lactose-negative strains. Among them, S. cerevisiae predominated, followed by Kazachstania aerobia and Lachancea meyersii. S. cerevisiae represented the largest and most commonly identified yeast isolates. This species, which exhibits strong fermentative metabolism and tolerance to ethanol, is known to be superior to non-Saccharomyces yeast in the process of alcohol fermentation, as regards spontaneous fermented sugar cane (Schwan et al. 2001). The presence of S. cerevisiae contributes to the enhancement of the organoleptic quality of the kefir beverage, promoting a strong and typically yeasty aroma as well as its refreshing, pungent taste (Simova et al. 2002). This yeast also reduces the concentration of lactic acid, removes the hydrogen peroxide and produces compounds that stimulate the growth of other bacteria, thus increasing the production of exopolysaccharides (Cheirsilp et al. 2003). It is worth noting that the yeast species, Kazachstania aerobia, whose presence in kefir has not been reported previously, was detected after 12 h of fermentation. Its presence in sugary Brazilian kefir could be connected with the presence of glucose and with the assimilation of some acids produced by lactic acid bacteria.


Culture-independent analysis of bacterial and yeast communities Traditionally, many plating procedures are only partially selective and exclude members of the microbial community (Chen et al. 2008). Thus, to determinate the total composition of microbiota in the Brazilian kefir beverage, PCR-DGGE analysis was used. The V3 region of the 16S rDNA gene of the bacteria and NS3 region of the 18S rDNA gene of the yeast were amplified, and representative DGGE fingerprints are shown in Fig. 2a, b. No differences in community structure during fermentation were found for both bacteria and yeast. To determine the composition of microbiota, individual bands observed in the DGGE profiles were excised from the acrylamide gel and re-amplified to provide a template for sequencing. After BLAST analysis, sequence results showed 99–100% identity with the sequences retrieved from GenBank accession numbers. DGGE bands a and d were clearly identified as Lb. kefiri and Lb.parabuchneri, band b as Lc. lactis subsp. lactics/ cremoris, band g as Leuconostoc citreum, band h as Acetobacter lovaniensis/uncultured Acetobacter sp., band j as Lb. paracasei/Lb. casei, band k as Kazachstania sp., band l

1247

as Kluyveromyces lactis, band m as Saccharomyces sensu stricto group and band n as Lachancea sp. It was not possible to identify the minor bands e, f and i; they were excised from the gel, but could not be recovered for sequencing. Band c could not be assigned to any bacterial species. PCR-DGGE analysis showed that species of the genus Lactobacillus were the dominant bacteria in the beverage, as already indicated by plating results. The presence of Lb. kefiri, Lb. paracasei, Lb. parabuchneri, Lb. casei and Leuconostoc citreum was confirmed (Fig. 2a). However, the species Lb. paracasei subsp. tolerans and Lb. buchneri were not detected by PCR-DGGE (Table 2). The representatives of Lactobacillus could be differentiated according to the migration distances of their respective 16S rDNA fragments, with the exception of Lb. kefiri, which comigrated with Lb. parabuchneri (previously designated Lb. kefiri/Lb. parabuchneri) and Lb. paracasei, which comigrated with Lb. casei (previously designated Lb. paracasei/Lb. casei). In fact, only a few differences in base pairs between 16S rDNA sequences among these species were found. Therefore, the differentiation of these species could not be obtained from the complex mixture of

Fig. 2 a DGGE profiles of bacterial 16S rDNA gene V3 fragments amplified from sugary Brazilian kefir beverage samples; b DGGE profiles of the NS3 region of the 18S rDNA gene amplified from the sugary Brazilian kefir beverage. Lane 1–0 h of fermentation; Lane 2–6 h of fermentation; Lane 3–12 h of fermentation; Lane 4–18 h of fermentation; Lane 5–24 h of fermentation

123

1248

microorganisms in sugary kefir based solely on the migration of their 16 rDNA V3 regions by DGGE analysis. Additionally, the Lb. kefiri/Lb. parabuchneri species were found at different positions (Fig. 2a). These multiple banding patterns may be due to sequence heterogeneity among multiple copies of the 16S rDNAs of any given strain (Haruta et al. 2006; Jianzhong et al. 2009). At the subspecies level, sequence analysis of the V3 region of Lc. lactis subsp. lactis and Lc. lactis subsp. cremoris also could not be distinguished (Fig. 2a). The three subtaxa of Lc. lactis, i.e., subsp. lactis, subsp. lactis biovar diacetylactis and subsp. cremoris are phylogenetically very highly related and cannot be separated by DGGE of 16S rDNA V3 amplicons because the few polymorphisms in the 16S rDNA sequence are localised outside the V3 region (Ercolini et al. 2001). The non-lactic acid bacteria band h in the DGGE analysis corresponded to Acetobacter lovaniensis. Interestingly, this was the only species of non-lactic acid bacteria found by culture-dependent methods (Table 2). The bands a, d and j, which have the highest sequence similarity to Lb. kefiri/Lb. parabuchneri and Lb. paracasei/ Lb. casei, showed lower intensities and could be related to the presence of low numbers of specific targets in the samples. The DNA template number can affect the amplification in complex template mixtures (Chandler et al. 1997). The culture-dependent approach also indicated that these species were among the most commonly recovered (Table 2). In fungal analysis, PCR-DGGE showed a good correlation with the culture-independent methods. Band m represented the Saccharomyces sensu stricto group (Fig. 2b). This group of yeast consists of very closely related species which, in some cases, never seem to show a clear-cut separation (Giraffa 2004). Among the yeasts present in the Saccharomyces sensu stricto group, Saccharomyces cerevisiae was the most probable strain identified because according to culture-based isolations, this species was the most commonly recovered yeast in the fermentation of sugary kefir (Table 2). S. cerevisiae has been reported previously to play a significant role in the fermentation of kefir (Latorre-Garcıá et al. 2007). Fragments most closely related to Lachancea sp. and Kazachstania sp. were also detected. Despite the fact that these amplicons were derived only at the genus level, Lachancea meyersii and Kazachstania aerobia were the most probable species to be identified because they were sporadically isolated during the fermentation processes (Table 2). Scanning electron microscopy of sugary Brazilian kefir grains As described previously by some authors (Guzel-Seydim et al. 2005; Jianzhong et al. 2009), a complex and tightly

123


Fig. 3 Electron micrographs of sugary Brazilian kefir grains. a Kefir grain, b Outer portion of the kefir grain, c Inner portion of kefir grain. Arrow—Yeast cells

packed biofilm could be observed on the exterior of the grains, while the interior was comprised mainly of unstructured material. In Fig. 3, the association of the kefir microbiota could be observed by scanning electron microscopy (SEM). The kefir grains showed a smooth surface (Fig. 3a) and its outer portion was covered by an agglomerate of microorganisms (Fig. 3b). The microbiota in the outer portion of the grain was dominated by lemon-shaped yeast cells growing in association with bacteria (long and curved) (Fig. 3b). The microbial cells on the inner portion were less than that on the outer portion (Fig. 3b, c). The arrow in Fig. 3c shows the presence of yeast cells in the inner portion of the kefir grains. The visual appearance of the sugary kefir grains in terms of the distribution of microorganisms was distinct from grains grown in milk. Milk kefir grains have a higher distribution of bacterial cells both in the outer and inner


portions of the grains as compared to the distribution of yeast cells (Cheirsilp et al. 2003; Guzel-Seydim et al. 2005). In this study, the yeast cells dominated the outer portion of the grains and bacteria were not visualized within the inner portion of the grain. Based on the results from both plating and PCR-DGGE, Lactococcus lactis and Leuconostoc citreum were identified as members of the LAB population (Table 2). Lactococcus lactis and Leuconostoc citreum could not be seen on the SEM graph in our study, thus suggesting the weak adherence of these two species on sugary kefir grains. This weak adherence may have resulted in the bacteria falling into the raw sugar substrates, a possibility that coincides with the results reported by Guzel-Seydim et al. (2005) for Turkey kefir and by Jianzhong et al. (2009) for Tibetan kefir. The approach described here showed that both direct PCR-DGGE of total community DNA and culture-dependent techniques yielded similar descriptions of the microbial population in fermented kefir.

Conclusion Our results indicated that bacteria, such as Lactobacillus paracasei, Lactobacillus kefiri, Lactobacillus parabuchneri and Acetobacter lovaniensis as well as yeast, such as Saccharomyces cerevisiae and Kluyveromyces lactis, were the predominant microorganisms present in the beverage. To the best of our knowledge, this is the first study evaluating chemical and microbiological composition, and isolation and identification of LAB, yeasts and AAB of sugary kefir. Interestingly, two species that had not been described as belonging to the microbiota of milky and sugary kefir were found: Acetobacter lovaniensis and Kazachstania aerobia. Our results indicated that conventional culturing and PCR-DGGE need to be combined in order to describe in maximal detail the microbiota associated with sugary Brazilian kefir. Acknowledgments The Brazilian agencies Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico do Brasil (CNPQ), Fundaçaõ de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG) and CAPES (Coordenaçaõ de Aperfeiçoamento de Pessoal de Nı´vel Superior) are acknowledged for financial support and scholarships for KTM and GVMP.

References Almeida EG, Rachid CCTC, Schwan RF (2007) Microbial population present in fermented beverage ‘cauim’ produced by Brazilian Amerindians. Int J Food Microbiol 120:146–151. doi:10.1016/ j.ijfoodmicro.2007.06.020

1249 AOAC (1995) Official methods of analysis of the association of official analytical chemists, 16th edn. AOAC, Washington Barnett JA, Payne RW, Yarrow D (2000) Yeast—characteristic and identification. Cambrige University Press, Cambrige Beshkova DM, Simova ED, Frengova GI, Simov ZI, Dimitrov ZHO (2003) Production of volatile aroma compounds by kefir starter cultures. Int Dairy J 13:529–535. doi:10.1016/S0958-6946(03) 00058-X Chandler DP, Fredrickson JK, Brockman FG (1997) Effect of PCR template concentration on the composition and distribution of total community 16S rDNA clone libraries. Mol Ecol 6:475–482 Cheirsilp B, Shoji H, Shimizu H, Shioya S (2003) Enhanced kefiran production by mixed culture of Lactobacillus kefiranofaciens and Saccharomyces cerevisiae. J Biotechnol 100:43–53. doi:10.1016/S0168-1656(02)00228-6 Chen HC, Wang SY, Chen MJ (2008) Microbiological study of lactic acid bacteria in kefir grains by culture-dependent and cultureindependent methods. Food Microbiol 25:492–501. doi:10.1016/ j.fm.2008.01.003 Duarte WF, Dias DR, Pereira GVM, Gerva´sio IM, Schwan RF (2008) Indigenous and inoculated yeast fermentation of gabiroba (Campomanesia pubescens) pulp for fruit wine production. J Ind Microbiol Biotechnol 36:557–569. doi:10.1007/s10295-0090526-y Ercolini D, Moschetti G, Blaiotta G, Coppola S (2001) Behavior of variable V3 region from 16S rDNA of lactic acid bacteria in denaturing gradient gel electrophoresis. Curr Microbiol 42:199– 202. doi:10.1007/s002840010204 Garrote GL, Abraham AG, De Antoni GL (2001) Chemical and microbiological characterization of kefir grains. J Dairy Res 68:639–652. doi:10.1017/S0022029901005210 Giraffa G (2004) Studying the dynamics of microbial populations during food fermentation. FEMS Microbiol Rev 28:251–260. doi:10.1016/j.femsre.2003.10.005 Guzel-Seydim Z, Wyffels JT, Sedydim AC, Greene AK (2005) Turkish Kefir and kefir grains: microbial enumeration and electron microscopic observation. Int J Dairy Technol 58:25–29. doi:10.1111/j.1471-0307.2005.00177.x Hammes WP, Hertel C (2003) The genera Lactobacillus and Carnobacterium. In: Dworkin M, Flakow S, Rosenberg E, Schleifer KH, Stackbrandt E (eds) The prokaryotes: an evolving electronic resource for the microbiological community, release 3.15. Springer-Verlag, New York, NY Haruta S, Ueno S, Egawa I, Hashiguchi K, Fujii A, Nagano M, Ishii M, Igarashi Y (2006) Sucession of bacterial and fungal communities during a traditional pot fermentation of rice vinegar assessed by PCR-mediated denaturing gradient gel electrophoresis. Int J Food Microbiol 109:79–87. doi:0.1016/j.ijfoodmicro. 2006.01.015 Holt JG, Krieg NR, Sneath PHA, Stanley JT, Williams ST (1994) Bergey’s manual of determinative bacteriology. Williams & Wilkins, Baltimore Jianzhong Z, Xiaoli L, Hanhu J, Mingsheng D (2009) Analysis of the microflora in Tibetan kefir grains using denaturing gradient gel electrophoresis. Food Microbiol 26:770–775. doi:10.1016/ j.fm.2009.04.009 Kumar S, Dudley J, Nei M, Tamura K (2008) MEGA: a biologistcentric software for evolutionary analysis of DNA and protein sequences. Brief Bioinform 9:299–306 Latorre-Garcıá L, del Castillo-Agudo L, Polaina J (2007) Taxonomical classification of yeasts isolated from kefir based on the sequence of their ribosomal RNA genes. World J Microbiol Biotechnol 23:785–791. doi:10.1007/s11274-006-9298-y Lisdiyanti P, Kawasaki H, Seki T, Yamada Y, Uchimura T, Komagata K (2000) Systematic study of the genus Acetobacter with descriptions of Acetobacter indonesiensis sp. nov., Acetobacter

123

1250 tropicalis sp. nov., Acetobacter orleanensis (Henneberg 1906) comb. nov., Acetobacter lovaniensis (Frateur 1950) comb. nov., Acetobacter estunensis (Carr 1958) comb nov. J General Appl Microbiol 46:147–165. doi:10.2323/jgam.46.147 Makimura K, Tamura Y, Mochizuki T, Hasegawa A, Tajiri Y, Hanazawa R, Uchida K, Saito H, Yamaguchi H (1999) Phylogenetic classification and species identification of dermatophyte strains based on DNA sequences of nuclear ribosomal internal transcribed spacer 1 regions. J Clin Microbiol 37:920–924 Naumova ES, YuV Ivannikova, Naumov GI (2004) Genetic differentiation of the sherry yeasts Saccharomyces cerevisiae. Appl Biochem Microbiol 41:578–582. doi:10.1007/s10438-005-0105-6 Ovreas L, Forney L, Daae FL, Torsvik V (1997) Distribution of bacterioplankton in meromictic lake Saelenvannet, as determined by denaturing gradient electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Appl Environ Microbiol 63:3367–3373 Pidoux M (1989) The microbial flora of sugary kefir grain (the gingerbeer plant): biosynthesis of the grain from Lactobacillus hilgardii producing a polysaccharide gel. World J Microbiol Biotechnol 5:223–238. doi:10.1007/BF01741847 Pidoux M, Marshall VM, Zanoni P, Brooker B (1990) Lactobacilli isolated from sugary kefir grains capable of polysaccharide production and minicell formation. J Appl Microbiol 69:311– 320. doi:10.1111/j.1365-2672.1990.tb01521.x Rahman N, Xiaohong C, Meiqin F, Mingsheng D (2009) Characterization of the dominant microflora in naturally fermented camel milk shubat. World J Microbiol Biotechnol 25:1941–1946. doi:10.1007/s11274-009-0092-5

123

World J Microbiol Biotechnol (2010) 26:1241–1250 Schwan RF, Mendonça AT, JJ Silva Jr, Rodrigues V, Wheals AE (2001) Microbiology and physiology of cachaça (aguardente) fermentations. Anton Leeuw Int J G 79:89–96. doi:10.1023/ A:1010225117654 Schwan RF, Almeida EG, Souza Dias MAG, Jespersen L (2007) Yeast diversity in rice-cassava fermentations produced by the indigenous Tapirape people of Brazil. FEMS Yeast Res 7:966– 972. doi:10.1111/j.1567-1364.2007.00241.x Simova E, Beshkova D, Angelov A, Hristozova T, Frengova G, Spasov Z (2002) Lactic acid bacteria and yeasts in kefir grains and kefir made from them. J Ind Microbiol Biotechnol 28:1–6. doi:10.1038/sj/jim/7000186 Simova E, Simov Z, Beshkova D, Frengova G, Dimitrov Z, Spasov Z (2006) Amino acid profiles of lactic acid bacteria, isolated from kefir grains and kefir starter made from them. Int J Food Microbiol 107:112–123. doi:10.1016/j.ijfoodmicro.2005.08.020 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24:4876–4882 Wang X, Haruta S, Wang P, Ishii M, Igarashi Y, Cui Z (2006) Diversity stable enrichment culture which is useful for silage inoculant and its succession in alfalfa silage. FEMS Microbiol Ecol 57:106–115. doi:10.1111/j.1574-6941.2006.00099.x Witthuhn RC, Schoeman T, Britz TJ (2004) Isolation and characterization of the microbial population of different South African kefir grains. Int J Dairy Technol 57:33–37. doi:10.1111/j.14710307.2004.00126.x