Mitochondrial DNA-like Sequences in the Nuclear Genome of the ...

Mitochondrial DNA-like Sequences in the Nuclear Genome of the Opossum Genus Didelphis (Marsupialia: Didelphidae) B. Lemos, F. Canavez, and M. A. M. Moreira

This study reports the occurrence of mtDNA-like sequences in the nuclear genome of the opossum genus Didelphis (Didelphidae, Marsupialia). A specific primer pair designed to amplify a region encompassing a 39 terminal 118 bp region of the cytochrome b gene, the Thr and Pro tRNA genes, and a 489 bp region of the Dloop of the D. virginiana mtDNA, was used in highly stringent PCR reactions. These PCR reactions resulted in several fragments per individual varying in size from 259 bp to 1 kb. The sequencing of some of these fragments showed the occurrence of paralogous mtDNA-like sequences among the PCR amplified fragments. Analyses of qualitative aspects of these sequences, their transition/transversion ratios, and phylogenetic relationships were conclusive in showing the occurrence of mtDNAlike sequences in the nuclear genome of the genus Didelphis. Comparisons and phylogenetic analysis of orthologous mtDNA from the four Didelphis species and paralogous nuclear sequences suggested that mtDNA migration to the nuclear genome occurred more than once in Didelphis evolution.

From the Laborato´rio de Vertebrados, Departamento de Ecologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil ( Lemos), Genetics Section, Pesquisa Ba´sica, Instituto Nacional de Ca ˆncer, Prac¸a da Cruz Vermelha 23, 20230-130 Rio de Janeiro, RJ, Brazil ( Lemos and Moreira), and Department of Structural Biology and Microbiology & Immunology, Stanford University School of Medicine, Stanford, California (Canavez). Address correspondence to Miguel A. M. Moreira at the address above or e-mail: genetics @inca.org.br. We are grateful to Dr. He´ctor Seua´nez for his careful revision of the manuscript and to Dr. Rui Cerqueira for laboratory facilities and encouragement throughout the project. Drs. Rui Cerqueira, He´ctor Seua´nez, and Cibele Bonvicino kindly provided us with tissue samples. This work was supported by Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico ( Brazil), Fundac¸a˜o Jose´ Bonifa´cio ( Brazil), Fundac¸a˜o de Amparo a Pesquisa do Estado do Rio de Janeiro ( Brazil), Programa de Biodiversidade—Ministe´rio do Meio Ambiente ( Brazil), Fundac¸a˜o Ary Frauzino para Pesquisa e Controle do Ca ˆncer ( Brazil). q 1999 The American Genetic Association 90:543–547

Mitochondrial DNA (mtDNA) has become the marker of choice in studies of genetic diversity, population genetics, phylogeography, and phylogenetic reconstruction (Avise 1994; Avise et al. 1987; Harrison 1989). Its applicability is mainly due to several characteristics including (1) maternal inheritance, resulting in a smaller effective population size than nuclear genes; (2) a relatively fast evolutionary rate that makes it specially suited for studying recently diverged taxa; and (3) lack of intraindividual heterogeneity due to homoplasmy. However, there are many exceptions to these advantageous characteristics. For instance, length and site heteroplasmy (i.e., intraindividual sequence variation) are frequently found at the mtDNA control region ( Buroker et al. 1990; Casane et al. 1994; Janke et al. 1994) and this might be a source of ambiguity in analyses of mtDNA RFLP data. Recently special attention has been given to another serious difficulty arising from mtDNA-like sequences present in the nuclear genome which have been extensively reported in a variety of taxonomic groups (Arctander 1995; Lopez et al. 1994; Smith et al. 1992; Zhang and Hewitt 1996a). These sequences, originated by migration of mtDNA to the nuclear genome, might become a source of error in population or phylogenetic studies

based on mtDNA markers (see Zhang and Hewitt 1996b for a review). Here we report the occurrence of nuclear mtDNA-like sequences in the nuclear genome of the representatives of the neotropical genus Didelphis ( Didelphidae, Marsupialia). Comparisons and phylogenetic analysis of orthologous mtDNA from the four Didelphis species (D. aurita, D. marsupialis, D. albiventris, and D. virginiana) and paralogous nuclear sequences suggest that mtDNA migration to the nucleus occurred more than once in Didelphis evolution.

Materials and Methods Total DNA was isolated from liver samples preserved in alcohol by the phenolchloroform procedure described by Smith et al. (1987). The following specimens were collected: one D. aurita (field number FU09, from Fazenda Unia˜o, Casimiro de Abreu, Rio de Janeiro, Brazil), two D. marsupialis (field numbers H45, from Ilha Grande, Camata´, Para´, Brazil; and H31, from Vila Macacoam, Itaubal, Amapa´, Brazil), and two D. albiventris (field numbers CRB684 and CRB698, from Terezina de Goia´s, Goia´s, Brazil). A primer set (M5–59ACAAACTTATGACCCTGAAGTAACAACCAG39 and M7– 59ACCTGAATCGGAGGACAACCAGTAGA39)

543

was constructed based on the D. virginiana mtDNA sequence (Janke et al. 1994). It was designed to amplify a region encompassing a 39 terminal 118 bp region of the cytochrome b gene; the Thr and Pro tRNA genes; and the 59 terminal 489 bp region of the D-loop by annealing at positions 15,958 (M5) and 15,207 (M7) of D. virginiana mtDNA (Janke et al. 1994). PCR reactions with M5–M7 were carried out with 50–100 ng of total DNA, 100 pmol of each primer, 1 mM of each dNTP, 6.7 mM MgSO4, 66 mM Tris (pH 8.8), and 1 unit of Taq DNA polymerase in a final volume of 100 ml. We used 35 cycles of 1 min at 958C (denaturation), 1 min at 708C (annealing), and 1 min at 728C (extension) in a 480 Perkin-Elmer thermal cycler. PCR products were visualized in silver-stained (5%) polyacrylamide gels; after electrophoresis gels were fixed in methanol (10%)/acetic acid (0.5%) for 10 min, soaked in AgNO3 0.13% (w/v) in 3% methanol/0.2% acetic acid solution for 10 min, washed with distilled water, developed in 3% (w/v) NaOH/0.3% formaldehyde solution, and fixed in methanol (10%)/acetic acid (0.5%). PCR products were either selected for cloning following isolation from (5%) polyacrylamide gels by the ‘‘crush and soak’’ method (Sambrook et al. 1989) or were directly cloned. Cloning was carried out with the Sure Clone Ligation kit (Pharmacia) in pUC 18 and sequenced with the T7 sequencing kit (Pharmacia) using forward and reverse universal primers. A combination of internal primers A3 (59TTCCCCAAGAAAACATCAAT39), A4 (59CTACCATCAACACCCAAAGC39), A5 (59GCTAGGGGTAAATAAATCCAT39), A6 (59ATATACATGACTATCCTTAACCTAAT39), and A7 (59AGCCAGTCAAAGGAACAAGGT39) were used to sequence clones with the largest inserts. All sequences have been deposited in the GenBank (accession numbers AF089796–AF089805). Sequences were aligned and checked for open reading frames (ORFs) with the Eyeball Sequence Editor ( XESEE, version 3.0; Cabot 1994). Transition:transversion ( TS: TV) ratios, Kimura’s two-parameter distance estimates ( Kimura 1980), and neighbor-joining ( NJ) trees were obtained with MEGA (version 1.02; Kumar et al. 1993). The standard error test of Rzhetsky and Nei (1992, 1993) and bootstrap analysis with 1,000 replicates ( Felsenstein 1985) were performed for evaluating the internal nodes of the tree.

544 The Journal of Heredity 1999:90(5)

Figure 1. Silver-stained polyacrylamide gel (5%) with amplified PCR products using primers M5 and M7. Lane 1: 100 bp DNA ladder; lane 2: D. aurita ( FU09); lane 3: D. marsupialis ( H45); lane 4: D. marsupialis ( H31); lane 5: D. albiventris (CRB698); lane 6: D. albiventris (CRB684). The lowest band of the 100 bp DNA ladder is of 200 bp.

Results and Discussion When considering sequence data from D. virginiana (GenBank accession number Z29573), we expected a PCR product of approximately 807 bp with primers M5–M7. However, we found several fragments per individual varying approximately from 300 bp to 1 kb ( Figure 1) in D. aurita, D. marsupialis, and D. albiventris. The high temperature of annealing in PCR reactions indicated that these fragments were not artifacts but rather were due to heteroplasmy resulting in different fragment length (as previously observed in D. virginiana for another D-loop sequence region; Janke et al. 1994) and/or of parallel amplification of nuclear mtDNA-like sequences. Ten fragments from different specimens were cloned and sequenced, revealing the occurrence of nuclear mtDNA-like sequences in the three Didelphis species. In the CRB698 specimen of D. albiventris, four clones were sequenced resulting in several fragments of the following length

(excluding primers): two of 259 bp (CRB698.2 and CRB698.7), one of 696 bp (CRB698.3), and one of 748 bp (CRB698.1). In the CRB684 specimen of D. albiventris, three clones were sequenced: one of 259 bp (CRB684.4), a second one of 624 bp (CRB684.15), and a third one of 903 bp (CRB684.5). In the FU09 specimen of D. aurita, one clone of 728 bp ( FU09.11) was sequenced, while in the H45 specimen of D. marsupialis, two clones of 739 bp ( H45.2 and H45.7) were sequenced (see Figure 2). Sequence Characterization and Comparisons Only the initial 59 bp region of the short clones of 259 bp (CRB698.2, CRB698.7, and CRB684.4) could be aligned to all longer clones ( Figure 2), while the remaining 39 end could not be aligned. The average sequence divergence of this common 59 bp region, when comparing each short fragment with each of the longer ones ranged from 15.2% with CRB698.3 to 33.8% with FU09.11. The remaining 200 bp of the short clones showed no significant similarity to

Figure 2. Aligned sequences obtained from cloned PCR fragments. Clone FU09.11 is from D. aurita; H45.2 and H45.7 from D. marsupialis; CRB684.4, CRB684.5, CRB684.15, CRB698.1, CRB698.3, and CRB698.7 from D. albiventris. D. virginiana sequence is from Janke et al. (1994). The termination-associated sequence ( TAS) and subsequence A (Sub. A) (Gemmell et al. 1996) are indicated. Points (.) indicate identical nucleotides with D. virginiana mtDNA; dashes (–) indicate alignment gaps; the asterisk (*) indicates the last nucleotide of cytochrome b; the arrow (↓) indicates the last nucleotide of Thr tRNA; and the solid triangle (.) indicates the last nucleotide of Pro tRNA. Repeat sequence motives at the control region are overlined and indicated by numbers. Partial sequences from clones CRB698.7, CRB698.2, and CRB684.4 are shown.

Lemos et al • Nuclear mtDNA-like Sequences in Didelphis 545

Table 1. Transition:transversion ratio (TS:TV) and Kimura two-parameter distances (Kimura 1980) among cloned sequences (below and above diagonals, respectively) Species

Code

Origin

Size ( bp)

CRB698.1

D. D. D. D. D. D. D. D.

CRB698.1 CRB698.3 FU09.11 H45.2 H45.7 CRB684.15 CRB684.5

mtDNA Nuclear mtDNA mtDNA mtDNA ? mtDNA

748 696 728 739 739 624 903 751

1.2 6.7 10.5 11.0 2.3 5.0 3.9

albiventris albiventris aurita marsupialis marsupialis albiventris albiventris virginiana

CRB698.3 0.135 1.3 1.2 1.1 1.3 1.3 1.4

FU09.11

H45.2

H45.7

CRB684.15

CRB684.5

D. virginiana

0.047 0.135

0.047 0.135 0.034

0.049 0.132 0.032 0.010

0.053 0.154 0.066 0.066 0.064

0.036 0.140 0.049 0.049 0.047 0.016

0.081 0.140 0.070 0.072 0.070 0.081 0.064

16.0 15.0 2.6 5.0 3.9

* 3.0 7.0 3.4

2.9 6.7 3.3

0.6 2.3

3.4

Sequence code numbers, origins, and lengths are given. D. virginiana sequence is from Janke et al. (1994). Asterisk (*) denotes absence of transversions.

any GenBank mtDNA sequence. All larger fragments contained ORFs in their first 118 bp using the mitochondrial genetic code of mammals. The 259 bp sequences lacked similar ORFs in the aligned regions and in nonaligned regions containing several stop codons along the fragment. Comparisons of CRB698.2, CRB698.7, and CRB684.4 sequences using the Blast search program (Altschul et al. 1990; see GenBank database) showed that the common 59 bp region has 80% of average similarity with the cytochrome b 39-end region of the Australian marsupial Murexia longicaudata ( Dasyuromorphia: Dasyuridae; GenBank accession number M99455). The remaining 200 bp portion was most similar to a human ‘‘hot spot’’ recombination region (GenBank sequence accession number U41166) as indicated by the highest blast search score of this pairing. Thus short clones CRB698.2, CRB698.7, and CRB684.4 contain the same mtDNA-like sequence that could have resulted from independent migration events of mtDNA or from duplication of mtDNA-like sequences in the nucleus. Clones ranging from 624 to 903 bp showed potentially functional ORFs at their first 118 bp corresponding to the 39 end of the cytochrome b gene. The two 739 bp clones of H45 differed from one another by five transitions, indicating site heteroplasmy, since nucleotide differences were higher than expected by errors in Taq DNA polymerase activity (Saiki et al. 1998). Clone CRB684.15 showed a 122 bp deletion at the D-loop region when compared to D. virginiana sequence data ( Figure 2). The deletion encompasses the termination associated sequence ( TAS), which is involved in termination of mtDNA synthesis ( Doda et al. 1981; Mackay et al. 1986). Clone CRB684.5 differed from the D. virginiana mtDNA by a 156 bp insertion adjacent to its TAS sequence motif, which consisted of five nearly identical 26 bp repeats and a truncated repeat. All clones ranging from 624 to 903 bp, except for

546 The Journal of Heredity 1999:90(5)

CRB698.3, presented an identical motif (GAGAGATCATCATCCCGCCA) in their control region that was similar to a presumed functional sequence named subsequence A (Gemmell et al. 1996) that shows 88% of similarity among vertebrates (Saccone et al. 1991). However, clone CRB698.3 showed one transition and one transversion in this conserved motif and presented one nucleotide insertion in the Thr tRNA and another in the Pro tRNA, as well as several deletions in the D-loop region, when compared to D. virginiana ( Figure 2). These unusual characteristics of clones CRB698.3 and CRB684.15 indicated that these sequences are unlikely to be functional. TS:TV Ratios Estimates of TS:TV ratios are shown in Table 1. The high transition bias expected in mtDNA sequences ( Brown 1985) was evident in comparisons involving clones CRB698.1, FU09.1, H45.2, and H45.7. However, it is important to remark that TS:TV bias estimates were low in comparisons involving D. virginiana mtDNA sequences (see Janke et al. 1994). As this latter sequence was obtained from purified mitochondrial extracts, they are unlikely to be of nuclear origin. Thus the low TS:TV ratios observed in comparisons with D. virginiana are likely to result from transition saturation, as this species is an early divergent Didelphis offshoot ( Kirsch et al. 1993; Patton et al. 1996). For this reason, distinguishing between nuclear mtDNAlike and mtDNA sequences based exclusively on TS:TV ratios might be misleading because saturation of transitions might result in a decrease in TS:TV ratios consequent to increasing sequence divergence. The lowest TS:TV values were observed in comparisons involving clone CRB698.3 of D. albiventris. This sequence showed TS:TV estimates approximately equal to 1, even in comparisons with clone CRB698.1 of the same animal. The transition bias was also low in comparisons involving

CRB684.15. These findings, taken together with the unusual sequence characteristics described above, suggest that CRB684.15 and CRB698.3 are mtDNA nuclear inserts. Phylogenetic Relationships When longer clones were analyzed for establishing phylogenetic relationships by neighbor-joining (Figure 3), clone CRB698.3 of D. albiventris appeared as a basal offshoot. A separate analysis (tree not shown) using the first 118 bp, corresponding to the cytochrome b region of these clones, and the homologous region of some Didelphidae (Patton et al. 1996) showed that CRB698.3 sequence of D. albiventris split before the emergence of the Philander/Didelphis group. Table 1 shows distance estimates among sequences.

Conclusions The evidences stated above establish the occurrence of nuclear mtDNA-like sequences in Didelphis. Sequence characterizations and phylogenetic analysis indicate that pseudogenes are responsible for some PCR fragments amplified in Didelphis. The TS:TV ratio revealed by comparisons with the D. albiventris CRB698.3 clone excludes the possibility of this sequence resulting from an intramitochondrial gene duplication or heteroplasmy as found in lizards (Stanton et al. 1994). This finding points to the existence of an mtDNA-like pseudogene in the nuclear genome of D. albiventris and phylogenetic analysis suggests that this pseudogene might be present in other Didelphis species as well. Characterizations of the pseudogenes studied here (clones CRB698.2, CRB698.3, CRB698.7, CRB684.4, and probably CRB684.15) suggest that nuclear integration of mtDNA sequences occurred several times during the evolution of the Didelphidae. As the CRB698.3 clone includes a nontranscribed mtDNA region ( Dloop), migration to the nucleus might have occurred by a DNA transfer process with-

trol region—comparisons of control region sequences between monotreme and therian mammals. Mol Biol Evol 13:798–808. Harrison RG, 1989. Animal mitochondrial DNA as a genetic marker in population evolutionary biology. Trends Ecol Evol 4:6–11. Janke A, Feldmaier-Fuchs G, Thomas WK, von Haeseler A, and Pa¨a¨bo S, 1994. The marsupial mitochondrial genome and the evolution of placental mammals. Genetics 137:243–256. Kimura M, 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16: 111–120. Kirsch JAW, Bleiweiss RE, Dickerman A, and Reig OA, 1993. DNA–DNA hybridization studies of carnivorous marsupials. III. Relationships among species of Didelphis ( Didelphidae). J Mamm Evol 1:75–97. Kumar S, Tamura K, and Nei M, 1993. MEGA: molecular evolutionary genetics analysis, version 1.02. University Park, PA: Pennsylvania State University. Lopez JV, Yuhki N, Masuda R, Modi W, and O’Brien SJ, 1994. Numt, a recent transfer and tandem amplification of mitochondrial DNA to the nuclear genome of the domestic cat. J Mol Evol 39:174–190. Figure 3. Unrooted neighbor-joining tree constructed with some cloned and aligned sequences ( Figure 2) from Didelphis species; distances were estimated using Kimura’s two-parameter method. Numbers above and below nodes are bootstrap values ( Felsenstein 1985) and confidence limits, respectively, based on the standard error test of Rzhetsky and Nei (1992, 1993). The inferred origins of sequences are indicated in brackets; question mark (?) indicates an unknown origin.

out involving any RNA intermediate as suggested by Blanchard and Schmidt (1996). This alternative pathway cannot be inferred with short clones of 259 bp. The presence of conserved mtDNA-like nuclear sequences represents a serious difficulty for molecular systematics studies using mtDNA markers. In some cases, paralogous nuclear sequences could not be readily distinguishable from a set of orthologous sequences (Arctander 1995; Zhang and Hewitt 1996b). Differences in TS:TV bias, unexpected insertions/ deletions, occurrence of frameshift mutations, appearance of stop codons in protein coding genes, and unexpected phylogenetic arrangements must be evaluated when considering nuclear, mtDNAlike paralogous sequences, as suggested by Zhang and Hewitt (1996b). However, each piece of evidence pointing to paralogous sequences has its pitfalls and care must be taken when using mtDNA as a molecular marker in phylogenetic and population studies. For instance, the above mentioned criteria do not allow us to discriminate whether CRB684.15 is an orthologous or paralogous mtDNA sequence. This is because, despite lacking a TAS region and showing a relatively low TS:TV ratio, suggesting nonfunctionality and nuclear origin, respectively, it is closely related to mtDNA sequences, as indicated by phylogenetic analysis.

References Altschul SF, Gish W, Miller W, Myers EW, and Lipman DJ, 1990. Basic local alignment search tool. J Mol Biol 215:403–410. Arctander P, 1995. Comparison of a mitochondrial gene and a corresponding nuclear pseudogene. Proc R Soc Lond 262:13–19. Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, and Saunders NC, 1987. Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Annu Rev Ecol Syst 18:489–522. Avise JC, 1994. Molecular markers, natural history and evolution. New York: Chapman & Hall. Blanchard JL and Schmidt GW, 1996. Mitochondrial DNA migration events in yeast and humans: integration by a common end-joining mechanism and alternative perspectives on nucleotide substitution patterns. Mol Biol Evol 13:537–548. Brown WM, 1985. The mitochondrial genome of animals. In: Molecular evolutionary genetics (MacIntyre RJ, ed). New York: Plenum Press; 95–129. Buroker NE, Brown JR, Gilbert TA, O’Hara PJ, Beckenbach AT, Thomas, WK, and Smith MJ, 1990. Length heteroplasmy of sturgeon mitochondrial DNA: an illegitimate elongation model. Genetics 124:157–163. Cabot EL, 1994. XESEE. The eyeball sequence editor, version 3.0. Chicago: University of Chicago. Casane D, Dennebouy N, de Rochambeau H, Mounolou, JC, and Monnerot M, 1994. Genetic analysis of systematic mitochondrial heteroplasmy in rabbits. Genetics 138:471–480. Doda JN, Wright DT, and Clayton DA, 1981. Elongation of displacement-loop strands in human and mouse mitochondrial DNA is arrested near specific template sequences. Proc Natl Acad Sci USA 78:6116–6120. Felsenstein J, 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791. Gemmell NJ, Western PS, Watson JM, and Graves JAM, 1996. Evolution of the mammalian mitochondrial con-

Mackay SLD, Olivo PD, Laipis PJ, and Hauswirth WW, 1986. Templated-directed arrest of mammalian mitochondrial DNA synthesis. Mol Cell Biol 6:1261–1267. Patton JL, dos Reis SF, and da Silva MNF, 1996. Relationships among didelphid marsupials based on sequence variation in the mitochondrial cytochrome b gene. J Mammal Evol 3:3–29. Rzhetsky A and Nei M, 1992. A simple method for estimating and testing minimum-evolution trees. Mol Biol Evol 9:945–967. Rzhetsky A and Nei M, 1993. Theoretical foundation of the minimum-evolution method of phylogenetic inference. Mol Biol Evol 10:1073–1095. Saccone C, Pesole G, and Sbisa´ E, 1991. The main regulatory region of mammalian mitochondrial DNA: structure-function model and evolutionary pattern. J Mol Evol 33:83–91. Saiki RK, Gelfand DH, Stofell S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, and Erlich HA, 1988. Primer-direct enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487–491. Sambrook J, Fritsch EE, and Maniatis T, 1989. Molecular cloning: laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Smith LJ, Braylan RC, Nutkis JE, Edmundson KB, Downing JR, and Wakeland EK, 1987. Extraction of cellular DNA from human cells and fixed in ethanol. Anal Biochem 160:135–138. Smith MF, Thomas WK, and Patton JL, 1992. Mitochondrial DNA-like sequence in the nuclear genome of an akodontine rodent. Mol Biol Evol 9:204–215. Stanton DJ, Daehler LL, Moritz CC, and Brown WM, 1994. Sequences with the potential to form stem-andloop structures are associated with coding-region duplications in animal mitochondrial DNA. Genetics 137: 233–241. Zhang D-X and Hewitt GM, 1996a. Highly conserved nuclear copies of the mitochondrial control region in the desert locust Schistocerca gregaria: some implications for population studies. Mol Ecol 5:295–300. Zhang D-X and Hewitt GM, 1996b. Nuclear integrations: challenges for mitochondrial DNA markers. Trends Ecol Evol 11:247–251. Received October 29, 1998 Accepted May 31, 1999 Corresponding Editor: Stephen J. O’Brien

Lemos et al • Nuclear mtDNA-like Sequences in Didelphis 547