MLL AT-hook sequence is strongly conserved in ...

Correspondence

1432 being in the circulation. This suggests that normal mechanisms for the rapid removal or degradation of endogenously produced IL-3 are not saturated by the levels attained in CML patients. The differences seen between patients with disease and the reported mouse transduction models may reflect differences in the amount of IL-3 produced per cell in the two situations as suggested by the observation of much higher levels of intracellular p210BCR–ABL in transduced cells.8 However, regardless of the mechanism, the present studies demonstrate that monitoring IL-3 serum levels in CML patients has no prognostic value. We have confirmed that serum G-CSF levels are normally severalfold higher than those reported for IL-3 and can be physiologically elevated. It was therefore even more surprising to find that the increased WBC count (and hence inferred increased numbers of CD34+ CML cells) characteristic of this disease is associated with a proportionate decrease in the serum levels of this growth factor. In summary, in CML patients, a presumed elevation in endogenously produced IL-3 by the neoplastic CD34+ cells does not increase the level of IL-3 in the peripheral blood including patients with advanced disease. This suggests that the functional role of the autocrine IL-3 produced by primitive CML cells may be locally restricted. In the case of G-CSF, serum G-CSF levels appear to be actively suppressed in CP patients by a mechanism that may be mediated by the more mature WBCs – possibly through the release of a soluble G-CSF-R. Importantly, an increase in serum G-CSF in imatinib-naive patients may presage transformation to blast crisis.

Acknowledgements We gratefully acknowledge Charlie Pearson and Michael Alcorn, Department of Haematology, Glasgow Royal Infirmary; Marta Taller and Bindy Bains, Terry Fox Laboratory, Vancouver; Alasdair Fraser, Susan Graham and Mark Drummond, GRI; Tim Bru¨mmendorf, University of Tu¨bingen; and Stephen O’Brien, Newcastle Royal Victoria Infirmary.

HG Jrgensen1 EK Allan1,2 X Jiang3 E Liakopoulou4 L Richmond4 CJ Eaves3 AC Eaves3 TL Holyoake1

1 Division of Cancer Sciences & Molecular Pathology, University of Glasgow, Glasgow, UK; 2 Scottish National Blood Transfusion Service, Glasgow Royal Infirmary, Glasgow, UK; 3 Terry Fox Laboratory, British Columbia Cancer Agency, Vancouver, Canada; 4 Department of Haematology, Glasgow Royal Infirmary, Glasgow, UK

References 1 Sattler M, Salgia R. Activation of hematopoietic growth factor signal transduction pathways by the human oncogene BCR/ABL. Cytokine Growth Factor Rev 1997; 8: 63–79. 2 Jiang X, Lopez A, Holyoake T, Eaves A, Eaves C. Autocrine production and action of IL-3 and granulocyte colony-stimulating factor in chronic myeloid leukaemia. Proc Nat Acad Sci USA 1999; 96: 12804–12809. 3 Jiang X, Fujisaki T, Nicolini F, Berger M, Holyoake T, Eisterer W et al. Autonomous multi-lineage differentiation in vitro of primitive CD34+ cells from patients with chronic myeloid leukemia. Leukemia 2000; 14: 1112–1121. 4 Hariharan IK, Adams JM, Cory S. BCR–ABL oncogene renders myeloid cell line factor independent: Potential autocrine mechanism in chronic myeloid leukemia. Oncogene Res. 1988; 3: 387–399. 5 Sirard C, Laneuville P, Dick J. Expression of bcr–abl abrogates factordependent growth of human hematopoietic M07E cells by an autocrine mechanism. Blood 1994; 83: 1575–1585. 6 Li S, Ilaria RL, Million RP, Daley GQ, Van Etten RA. The P190, P210, and P230 forms of the BCR/ABL oncogene induce a similar chronic myeloid leukemia-like syndrome in mice but have different lymphoid leukemogenic activity. J Exp Med 1999; 189: 1399–1412. 7 Zhang X, Ren R. BCR–ABL efficiently induces a myeloproliferative disease and production of excess interleukin-3 and granulocyte– macrophage colony-stimulating factor in mice: a novel model for chronic myelogenous leukemia. Blood 1998; 92: 3829–3840. 8 Chalandon Y, Jiang X, Hazlewood G, Loutet S, Conneally E, Eaves A et al. Modulation of p210-BCR–ABL activity in transduced primary human hematopoietic cells controls lineage programming. Blood 2002; 99: 3197–3204.

MLL AT-hook sequence is strongly conserved in infant acute leukemia with or without MLL gene rearrangement

Leukemia (2003) 17, 1432–1433. doi:10.1038/sj.leu.2402966

TO THE EDITOR Mixed lineage leukemia (MLL) gene disruptions, especially translocations t(4;11)(q21; q 23) and t(11;19)(q23; p13), account for 60– 70% of the rearrangements found in infant acute leukemia (AL).1 In such translocation events, the N-terminal region of MLL is maintained, while the MLL and fusion partner C-terminals are exchanged. The MLL gene located at 11q23 encodes for a predicted 431 kDa protein that is proteolytically processed into two fragments (300 and 180 kDa) accordingly.2 Fusion proteins that lack the cleavage site are thought to play an important role in the leukemogenesis process. The MLL gene has been extensively characterized and several important functional domains have been isolated including the central PHD finger and C-terminal SET domain. (reviewed in Ayton and Cleary3) N-terminal domains

Correspondence: Dr MS Pombo-de-Oliveira, Laborato´rio de Marcadores Celulares, Servic¸o de Hematologia, Prac¸a Cruz Vermelha, 23, CEP: 20 230-130, Rio de Janeiro, Brazil, Fax: +55 21 2285 4484 Received 13 February 2003; accepted 24 February 2003 Leukemia

include the AT hooks and a region with homology to DNA methyltransferase. Functional studies have tried to establish the role of these domains in the malignant process.3,4 Three short motifs, known as AT hooks are thought to mediate the targeting of MLL to its nuclear site4 and permit specific binding to the minor groove of ATrich DNA. These motifs, the theme of our study, are thought to be critical for leukemogenesis4 and may indirectly stabilize protein– DNA interactions by inducing conformational changes, such as DNA bending, which may in turn effect the binding of specific transacting factors or facilitate the protein–protein interactions that control gene expression. Taken together, this information suggested to us a possible role for mutations in the AT-hook region being a basis for cell transformation in those patients without detectable MLL involvement. In order to fully characterize the possible molecular changes in the MLL AT-hook motifs, we have studied the AT-hook DNA sequence and its variability in cases of infant AL. DNA samples from 23 infant AL were analyzed in this study and comprised 10 cases of ALL, eight of AML and five biphenotypic leukemias. Patients were separated into two groups, the first composed of 18 cases with MLL translocations, the second five cases without MLL disruption according to molecular analysis independent of leukemia subtype. The MLL translocations were

Correspondence

1433 characterized by Southern blot and or by RT-PCR. In summary, cDNA samples were subjected to PCR using primers specific to each MLL translocation: t(10;11), t(11;19), t(4;11). The G3PHD gene was used as an internal reaction control. From the five cases without MLL involvement, no rearrangement was detected in four cases by Southern blot analysis, while an inversion [inv(11;11)(q23;p13)] was found in a single case. PCR reactions were next made on cDNA using specific primers to the AT-hook region (CAGTACAAAATGGCCAGTGC and TGTAAGTGGAGGTGTTCCTTCC). For each reaction 50 ml mix was used: 10 pmol of each primer; 50–100 ng of cDNA; 200 mM dNTP; 2 U Taq Polymerase (Pharmacia); Taq buffer 1% and DMSO 1%. The PCR conditions consisted of an initial denaturation at 941C for 3 min followed by 30 cycles: denaturation of 941C for 45 s, annealing at 551C for 45 s, extending at 721C for 1 min and a final elongation of 5 min. The products were gel purified and subjected to DNA sequencing using a DYEnamic ET Terminator kit (Pharmacia). The Sequence Navigator program was used to analyze the results and compare sequence obtained from the patients to the standard MLL gene sequence (accession no. D14540). MLL fusions are very common in ALs in infants and probably arise in utero.6,7 via transplacental exposure to genotoxic chemicals.8 Although this selectivity of MLL to infant AL is not completely understood, it raises the possibility that alterations in MLL, other than by gene fusion, might also be involved in some cases. The AThook region was chosen for study because of its previously reported importance in the malignant process, with the hypothesis that alterations in these motifs might provoke MLL loss of function. Of the 23 MLL AT-hook sequences analyzed, all of them were conserved. No mutations were found in any of the studied cases with MLL gene fusion or of wild-type MLL in those cases that lacked a fusion gene. N-terminal MLL, including the AT-hook region is responsible for MLL nuclear localization, so either native or chimeric MLL proteins will share the same nuclear localization in vitro.5 Sequence conservation of the AT-hooks points to the fact that MLL nuclear localization in vivo will occur with both native and chimeric proteins. Considering that localization is important both

for DNA binding and protein action, the conservation of MLL AThook sequences that we have found (even in cases of infant AL without MLL gene rearrangement) might be essential for the transformation properties of the chimeric proteins.

CMT Macrini1 MS Pombo-de-Oliveira1 AM Ford2 G Alves1 2

1

Laborato´rio de Marcadores Celulares, Servic¸o de Hematologia, Instituto Nacional de Caˆncer, Rio de Janeiro, Brasil; Leukaemia Research Fund Centre, Institute of Cancer Research, London, UK

References 1 Biondi A, Cimino G, Peters R, Pui C-H. Biological and therapeutics aspects of infant leukemia. Blood 2000; 96: 24–33. 2 Yokoyama K, Kitabayashi I, Ayton PM, Cleary ML, Ohki M. Leukemia proto-oncoprotein MLL is proteolytically processed into two fragments with opposite transcriptional properties. Blood 2002; 100: 3710–3718. 3 Ayton PM, Cleary ML. Molecular mechanisms of leukemogenesis mediated by MLL fusion proteins. Oncogene 2001; 20: 5695–5707. 4 Slany RK, Lavau C, Cleary ML. The oncogenic capacity of HRX-ENL requires the trancriptional transactivation activity of ENL and the DNA binding motifs of HRX. Mol Cell Biol. 1998; 18: 122–129. 5 Caslini C, Alarco´n AS, Hess JL, Murti KG, Biondi A. The amino terminus targets the mixed linage leukemia (MLL) protein to the nucleolus, nuclear matrix and mitotic chromosomal scaffolds. Leukemia 2000; 14: 1898–1908. 6 Ford AM, Ridge SA, Cabrera ME, Mahmoud H, Steel CM, Chan LC, Greaves MF. In utero rearrangements in the trithorax-related oncogene in infant leukaemias. Nature 1993; 363: 358–360. 7 Gale KB, Ford AM, Repp R, Borkhardt A, Keller C, Eden OB, Greaves MF. Backtracking leukemia to birth: identification of clonotypic gene fusion sequences in neonatal blood spots. Proc Natl Acad Sci USA. 1997; 94: 13950–13954. 8 Alexander FE, Patheal SH, Biondi A, Brandalise S, Cabrera ME, Chan LC et al. Transplacental chemical exposure and risk of infant leukemia with MLL gene fusion. Cancer Res. 2001; 61: 2542–2546.

Low frequency of bcl-2 rearrangement in HCV-associated non-Hodgkin’s lymphoma tissue

Leukemia (2003) 17, 1433–1436. doi:10.1038/sj.leu.2402968

TO THE EDITOR The bcl-2 translocation is a genetic alteration involved in lymphomagenesis, especially in lymphomas for which an antigendriven pathogenetic mechanism has been hypothesized, such as follicular lymphoma (FL) and salivary gland non-Hodgkin’s lymphoma (NHL) in patients with Sjo¨gren’s syndrome. Previous studies of B-cell lymphoproliferation in hepatitis C virus (HCV)-infected patients are consistent with an antigen-driven process and support a role for antigens associated with HCV in chronic stimulation of Bcell proliferation, particularly in individuals with type II mixed cryoglobulinemia (MC) syndrome.1 Recent investigations revealed t(14;18) translocation in peripheral blood mononuclear cells (PBMCs) from MC patients infected with HCV. In particular, Zuckerman et al2 detected t(14;18) translocation Correspondence: Dr M Boiocchi, Experimental Oncology Division 1, Centro di Riferimento Oncologico Aviano, Via Pedemontana Occidentale, 12, Aviano 33081 (PN), Italy; Fax: +39 0434 659659

in PBMCs from 17 out of 44 individuals with MC (39%) and seven out of 59 without MC (12%), whereas Zignego et al3 observed t(14;18) translocation in PBMCs from 17 out of 20 individuals with MC (85%) and in 38 out of 101 without MC (38%). These findings support the possibility that bcl-2 translocation may be involved in the complex multistep mechanisms which, in the course of chronic HCV infection, promote polyclonal B-cell expansion that can subsequently evolve into NHLs. If this is the case, the high sensitivity of polymerase chain reaction (PCR) analysis (1/104–1/ 105) could help to identify patients with NHL at preclinical stages. To examine the possible relation between bcl-2/IgH translocation and HCV-associated NHLs, neoplastic biopsy specimens and PBMCs from 48 NHL patients infected with HCV were analyzed for bcl-2/IgH translocation. The majority of bcl-2 rearrangements occur at two distinct chromosomal sites known as the major breakpoint cluster region (MBR) and the minor cluster region (mcr). Each DNA sample (0.5 mg) was analyzed by PCR as described by Zuckerman et al2 to investigate MBR translocation and by Gribben et al4 to investigate mcr translocation. The sensitivity of PCR has been optimized to detect a single t(14;18) translocation event in as many as 104 cells. Each reaction was repeated three times to assure Leukemia