ISSN 1990519X, Cell and Tissue Biology, 2010, Vol. 4, No. 6, pp. 511–519. © Pleiades Publishing, Ltd., 2010. Original Russian Text © B.V. Popov, A.M. Zaichik, M.B. Budko, N.A. Nitsa, E.N. Tolkunova, O.V. Zhidkova, N.S. Petrov, S.A. Koshkin, B.K. Komyakov, 2010, published in Tsitologiya, Vol. 52, No. 10, 2010, pp. 844–852.
Model to Study in vivo Transdifferentiation of Somatic Cells into Urothelium B. V. Popova, A. M. Zaichikb, M. B. Budkob, N. A. Nitsac, E. N. Tolkunovaa, O. V. Zhidkovaa, N. S. Petrova, S. A. Koshkina, and B. K. Komyakovd a
Institute of Cytology, Russian Academy of Sciences, St. Petersburg, Russia b GOU DPO SPbMAPO Roszdrava, St.Petersburg, Russia c St. Petersburg State University, Russia d Mechnikov St. Petersburg State Medical Academy, Russia email:
[email protected]
Abstract—The development of reconstructive therapy of the urinary tract using pluripotent and somatic stem cells, e.g., mesenchymal stem cells (MSC), is currently in the stage of experimental studies. These studies include the investigation of the main functions of MSC and the urothelium lining the organs of the urinary tract. An important role in the regulation of proliferation and differentiation of urothelium belongs to EGF and Wnt/βcatenin signaling pathways, the activity of which may be evaluated by the level of Her4 and Tcf 3, 4, respectively. We found that MSC labeled by transgenic green fluorescence protein (GFP) did not pro duce Her4 and Tcf3, 4 in vitro, but activated their production after cell grafting into the cryoinjured bladders of the syngenic mice. In mice transplanted with these MSC GFP was detected by RTPCR in the bladder. GFP colocalization with Her4 or Tcf3, 4 in a few urothelial cells was detected by immunohistochemical staining with specific antibodies. These results suggest that MSC labeled with GFP an be used as a proper model to study the transdifferentiation of somatic cells into urothelium. Keywords: mesenchymal stem cells, transdifferentiation, bladder, EGF and Wnt/β–catenin signaling, Her4 and Tcf3, 4 proteins. DOI: 10.1134/S1990519X10060015
Abbreviations used: MSC, mesenchymal stem cell; BrdU, bromodeoxyuridine; SC, stem cell; EGF, epidermal growth factor; LRC, Labelretaining cells; RTPCR, reverse transcription polymerase chain reaction; Wnt/βcatenin signaling. The urothelium that lines the inner surface of the urinary tract plays a key function in the urogenital sys tem. The urothelium produces a functional barrier that prevents the penetration of nitrogen metabolism toxic products that contain urea and ammonium into the organism (Staack et al., 2005). The urothelium is a common target of malignant transformation. The fre quency of bladder carcinoma in industrial countries is 5% of the total number of cancer patients (fifth place), a number that increases with increasing human life expectancy (Schulz, 2006). An increase rate of sick ness increases the requirements in tissuespecific donor cells for recovery therapy based on pluripotent or somatic stem cells (SC) capable for selfrenewal and differentiation into urothelium (Anumanthan et al., 2008; Thomas et al., 2008). The application of SC in therapy is currently at the stage of the experimental study of urothelial cell renewal (Kurzrock et al., 2008); the involvement of
various signaling processes in the selfrenewal of the urothelium under normal and pathological conditions (Varley et al., 2004; Schulz, 2006); the functioning of various populations in urinary tract after autologous plastic surgery, e.g., by intestinal tissue (Atala, 2009); and the possible application of embryonic and somatic SC for the replacement of a damaged urothelium (Kinebuchi et. al., 2008; Oottamasathien et al., 2007; Shukla et al., 2008). The urothelium represents the transition epithe lium; its size and cell shape is modified with the blad der filling. Three major layers are recognized in the urothelium, i.e., a basal layer in contact with the basal membrane, and intermediate and apical layers com posed of differentiated umbrellalike cells that are in physical contact with urea. In the basal layer, cells have a cubic shape; in the intermediate layer, cells are enlarged or round; and, in the apical surface (flowing), they are flattened (Staack et al., 2005). Cells that are in contact with the basal membrane are characterized by the presence of keratins 5 and 14 and p63 protein. Cells of the intermediate and luminal layer express keratins 7, 8, 18 and 19. The unique feature of umbrellalike cells is asymmetric plasma membrane with plaques containing uroplakins (tissuespecific
511
512
POPOV et al.
TGFα EGF AR
BTC EPR Hereregulins
Receptor domains
HBEGF
Intercellular space
Receptor dimers Tyrosine kinase domain
HER1 Cytoplasm
HER2
HER3
HER4
HER11 HER12 HER13 HER23 HER24 HER34
Fig. 1. Scheme of EGF family ligand interaction with spe cific receptor dimers. See text for explanations.
proteins) engaged in the control of urothelium perme ability (Wu et al., 1994). Labeling with bromodeox yuridine (BrdU) in vivo demonstrated that it was incorporated into most epithelial cell nuclei. However, after 1 year, only 9% of basal cells retained the label. These cells express cytokeratin 14, β4integrin, Bcl2 and p63 proteins, but their level is similar to that in neighboring cells of the basal layer (Kurzrock et al., 2008). Urothelium is distinguished from other mamma lian epithelium types by the extraordinarily low rate of cell proliferation. Urothelium cells are divided once or twice a year (Cooper, 1972). Active proliferation in the urothelium is observed in the development or as a response to damage. Proliferating cells are visible in all epithelial layers, including differentiated umbrella like cells in the surface layer. Although the phenome non of the rapid activation and intensive proliferation of urothelium cells is well known, the mechanisms of its regulation has not been sufficiently studied. The reported data show that the division of urothelial cells is mediated by receptors and ligands of the epidermal growth factor (EGF) family (Varley et al., 2005). The members of the family, such as tumor growth factor α (TGFα, heparin binding epidermal growth factor (HBEGF) and amphiregulin (AR) are expressed in urothelial cells in vitro. TGFα production is activated in vivo in a damaged urothelium. The EGF receptor family includes four proteins, i.e., EGFR (Her1), ErbB2 (Her2), ErbB3 (Her3), and ErbB4 (Her4), which form receptor complexes by the generation of homo or heterodimers. TGFα and AR bind only EGFR dimmers (Her1), whereas HBEGF, betacel lulin (BTC), and epiregulin (EPR) bind dimers that contain Her1 and Her4. Hereregulins (neuregulins or neuronal differentiation factors) do not bind Her1,
but are ligands for Her3 and Her4 dimers. The Her 2 receptor does not bind the ligand, but rather facili tates and stabilizes receptor dimerization accompa nied by enhanced signal potential (Fig. 1). Her2 amplification and overexpression is registered in mammary carcinoma cells, lungs, stomach, the uter ine cervix. Her3 does not possess tyrosine kinase activity and, like Her2, is able to bind the ligand in the heterodimer form, which activates the underlying signal pathways (Varley et al., 2005). Her1 and Her2 are identified in isolated bladder cells. In these cells cultured in vitro, Her1 production is increased two to five times and the amount of Her2 is reduced three times. Her3 expression is very low in isolated bladder cells and is not detected in cells that proliferate in vitro. Her4 is at a high level in both nor mal and malignant bladder cells (Rötterud et al., 2005), that shows that Her4 expression is a marker of selfrenewal of tumor and stem cells (Nusse et al., 2008) and, therefore, can probably be used as a marker of urothelial stem cells. The effector regulation of cellular functions of EGF family proteins involves MAP and PI3kinase signaling. ERK kinase of MAPkinase pathway is phosphorylated as little as 1 h after the addition of EGF to the utrothelium culture. The inhibition of Mek or PI3 kinases or other kinases of this pathway, suppresses the proliferation and migration in the urothelium (Varley et al., 2005). The role of Wnt/βcatenin signaling in the regula tion of the proliferation and differentiation of the urothelium is not clearly understood. However, well documented data on the implication of this signaling in the regulation of stem cells with various tissue spec ificities and tumor stem cells (Nusse et al., 2008) makes it possible to suggest that particular Wnt/β catenin signals are required for the renewal of urothe lial SC and that the hyperactivation of this signaling facilitates malignant transformation. Indeed, it was demonstrated that the activation of Wnt/βcatenin signaling evident as nuclear and cytoplasmic βcate nin accumulation results in bladder carcinomas (Kas tritis et al., 2009). Wnt/βcatenin signal transfer and βcatenin accu mulation is accompanied by the enhanced activity of their targets—transcription factors of the LEF/TCF family. The inactivation of the family proteins, e.g., Tcf4, results in the depletion of stem and proliferating cells in the small intestine (Van der Flier et al., 2007). The therapeutic potential of MSC is based on their capacity to differentiate into all three germ layers, including the endoderm, which gives rise to most epi thelial tissues of inner organs, e.g., the intestines and bladder (Friedenstein, 1976; Prockop, 1997; Pittenger et al., 1999; Bajada et al., 2008). The goal of this work was to develop the experimental model on mice to study in vivo the transdifferentiation of somatic stem cells into the bladder urothelium. For this purpose MSC expressing transgenic GFP were transplanted CELL AND TISSUE BIOLOGY
Vol. 4
No. 6
2010
MODEL TO STUDY IN VIVO TRANSDIFFERENTIATION OF SOMATIC CELLS
into the cryoinjured bladder of C57BL syngeneic mice. According to literature data cryoinjury facili tates MSC transdifferentiation into bladder cells (De Coppy et al., 2007). Our results showed that MSC may be applied to study the transdifferentiation of somatic cells into urothelium. MATERIALS AND METHODS Cell cultivation in vitro. Mesenchymal stem cells were obtained from the bone marrow of transgenic C57BL/6Tg(ACTbEGF)1Osb/J male mice (GFP mice) that express GFP in all tissues (Popov et al., 2007). Longterm cultured MSC were characterized for their clogenic, proliferative, adhesive, and tumori genic activity, as wells for their capacity to differentiate in cells of a mesodermal origin (Popov et al., 2009). Here, we used MSC at the 12–25th passages. These cells expressed GFP; had normal differentiation, adhesive, and clonogenic activities; and did not form tumors in syngeneic C57BL mice. The cells were cul tured in DMEM/F12 medium with 25 mM HEPES and 10% fetal calf serum. Assessment of MSC transdifferentiation in urothelium cells in vivo. MSC were transplanted into syngeneic mice. The cells were washed with PBS twice, removed from the plastic surface with trypsin, sedimented by centrifugation for 5 min at 1000 rpm and 5 × 106 cells/ml were suspended in serumfree medium with 50 units/ml of heparin. To induce the transdiffer entiation of MSC into urothelial cells in vivo, cells were grafted to the bladder wall of C57BL mice. Sur gery was performed in mice set on the back, limbs fixed with adhesive bandage under intraperitoneal tio pental narcosis (10 mg/kg). Surgery area was treated with disinfectant and then low midline laparotomy was done in layers. The surgery was controlled under the surgery OptonVario microscope (Zeiss, Ger many). Peritoneal edges were fixed with microsurgical retractor and then the bladder was taken out. Cryoin juries were produced by five closely located pricks of the bladder wall on the both sides of the middle blad der artery. The cryoinjury of the whole bladder wall was pro duced with a G21 needle cooled to the temperature of liquid nitrogen. The MSC suspension was introduced by a syringe with a G30 needle in 10 min after the cry oinjury. The cryoinjured area in the bladder wall was labeled with knotty Prolene 10/0 stitches (Ethicon Inc., United Kingdom). The bladder was returned to the peritoneal cavity and the cavity was washed with 0.2 ml cefazolin sodium salt (0.001g/ml). The laporo tomy wound closure was done layer by layer with single knotty stitches (muscles–PDS6/0 (Ethicon Inc., United Kingdom) and skin–polypropylene 4/0 (Lim tex, Russia). Skin stitches were strengthened with a BF6 glue bandage (Vertex, Russia). MSC transplanted into mice with undamaged or sublethally irradiated bladders served as the control. CELL AND TISSUE BIOLOGY
Vol. 4
No. 6
2010
513
MSC were injected intravenously into the retroorbital sinus 1 day after irradiation. 8–12weekold C57BL females weighing 18–22 g were used in the experi ments. The animals were obtained from the Rap polovo Animal Facility, Russia). Thirty minutes prior to intravenous cell injections, mice received 30 units of heparin intraperitoneally in 0.5 ml growth medium. Retroorbital cell injections were given under anesthe sia produced by ethyl either inhalation. Mice were irradiated with 5 Gy (dose power 0.451 Gy/min, volt age 200 kV, current 14 mA, 0.5 mm Cu and 1.0 mm Al filters, focus 50 cm). MSC were introduced in 0.5 ml serumfree growth medium 24 h after irradiation. Bladders from GFP transgeneic mice for his tochemical analysis were kindly provided by V.M. Mikhailov (Institute of Cytology Russian Acad emy of Sciences, Russia). GFP mice (generous gift from Children’s Hospital, Oakland Research Insti tute, California) were maintained in the vivarium at the Institute of Cytology in a routine feeding and light regime. Immunofluorescent staining. MSC were stained for GFP, Tcf3,4, Her4 according to the following proto col. Coverslips with spread cells were placed into 35mm Petri dishes. Cells were washed once with PBS for 5 min and fixed with 4% paraformaldehyde for 15 min, then with 70% ethanol at 4°C overnight, treated with 0.2% Triton X100, washed with PSC twice for 5 min, blocked in 3% bovine serum albumin (BSA) with 0.1% Twin 20, treated with specific anti bodies (dilution 1 : 50 to 1 : 200) in blocking solution for 1 h at room temperature, washed three times with PBS for 5 min, treated with fluorescence labeled spe ciesspecific antibodies to primary antibodies for 1 h at the room temperature, and washed three times with PBS for 5 min. Cell nuclei were stained with 1 μg/ml DAPI in the blocking solution for 30 min at the room temperature. Samples were washed twice with PBS and mounted into АntiFade medium reducing unspecific fluorescence. Histochemical staining of frozen and paraformalde hyde fixed tissues. Frozen sections were prepared from tissue kept in the liquid nitrogen. Before cryotome cut tissue was embedded into specific medium TissueTek (Sakura Finetek, United States). Sections on slides were airdried, fixed with ethanol/acetone mixture (1:1) for 3 min at 20°C and stained as described above for immunofluorescence. Sections were also prepared from fixed tissue. Tissues were placed in 4% formalde hyde for 24 h. Before paraffin embedding tissues were dehydrated with ethanol of increasing concentrations (50–96°). Ethanol from dehydrated material was removed by chloroform, after which samples were treated with chloroform mixture with paraffin (1 : 1) for 12 h at 37°C, then with three changes of melted paraffin for 60 min in each at 56–58°C. Paraffin blocks were mounted on wooden blocks. 5–7μm sec tions prepared on microtome were placed on slides treated with 2% aminopropyltriethoxysilane. Sections
514
POPOV et al.
were incubated for 30 min in a thermostat and then treated twice with xylene for 3 min at 65°C. Samples were deparaffinized with alcohols with decreasing concentrations for 3 min in each. Sections were incu bated with 3% hydrogen peroxide for 5 min and etched with 0.1 M citrate buffer, pH 6.0, for 10 min in micro wave at 650W. Sections were cooled for 20 min and then placed into 0.05 M TrisCl, pH 7.5, for 10 min. Unspecific binding was blocked by BSA in PBS with 0.01% Twin 20 for 30 min at 37°C. Samples were washed in PBS and treated with antibodies as described above. Electrophoresis and immunoblotting. Electrophore sis was performed in 8% polyacrylamide gel with sodium dodecyl sulfate. Cells grown in culture plates were washed twice with PBS, removed from the sur face with a silver scrapper, and sedimented by centrif ugation; then, the pellet was lysed for 30 min on ice in three volumes of buffer (25 mM TrisCl, pH 7.4, 250 mM NaCl, 0.25% NP40 detergent, 1 mM PMSF, protease inhibitor cocktail, 1 : 100). To prepare C57BL mouse bladder extracts, tissue was cut with scissors, homogenized, and lysed as described above. Cell extracts were centrifuged at 13000 g for 15 min at 4°C. Samples were equilibrated for the amount of pro tein determined with Bradford reagent, transferred into microtubes with equal volumes of buffer for sam ple loading into gel (4% sodium dodecylsulfate, 20% glycerol, 200 mM dithiotreitol, 120 mM TrisHCL, pH 6.8, 0.002% bromphenol blue) and boiled in a water bath. The 25 μl probes containing 30 μg total protein were loaded in each lane of polyacrylamide gel. After electrophoretic separation, the proteins were transferred to a PVDF membrane by semidry elec trotransfer. Membrane proteins were visualized with specific antibodies and ECL reagent. For RTPCR, total RNA was isolated from the liv ers, lungs, intestines, kidneys, and bladders of control and experimental C57BL mice with or without the addition of MSC after cryoinjury, as well as from GFP mouse bladders. RNA was isolated with RNEasy Mini Kit (Qiagen, United States). The RNA concentration was measured by a spectrophotometer. 0.5–1.0 μg RNA were applied for RTPCR. Reverse transcription and specific amplification of the Gfp gene was per formed with buffer and enzyme mixture from Qiagen One Step for RTPCR suitable to perform both reac tions and containing HotStar Taq polymerase and mixture of Omniscript and Sensiscript reverse poly merases. To amplify a GFP gene fragment of 372 bp, we applied 5'GCAAGCTGACCCTGAAGTTCATC3' and 5'TCACCTTGATGCCGTTCTTCTG3' primers. PCR was performed using a thermocycler with the fol lowing program: reverse transcription (30 min, 50°C), DNA activation with HotStar Taq polymerase to inac tivate reverse transcripts and denature cDNA template (15 min, 95°C), 30 cycles of DNA denaturing (94°C, 30 s), synthesis (72°C, 1 min), and the terminal stage
of the synthesis (72°C, 10 min). The products were assayed by electrophoresis in 1.2% agarose gel. Antibodies. In the experiments, we used mouse monoclonal antibodies to Tcf3, 4 (Abcam, United Kingdom); mouse monoclonal antibodies to βactin (Sigma, United States); rabbit polyclonal antibodies to GFP (Sigma, United States and Abcam, United Kingdom); mouse monoclonal antibodies to Her4 (Abcam, United Kingdom); rabbit polyclonal anti bodies to βcatenin (Abcam, United States and Sigma, United States); speciesspecific antibodies Alexa Fluor 568, Fabfragment of rabbit antibodies to mouse antibodies (Invitrogen, United States), Alexa Fluor 568, Fabfragment of goat immunoglobulins to light and heavy chains of rabbit immunoglobulins (Invitrogen, United States); and Fabfragment of goat and rabbit immunoglobulins conjugated with horse reddish peroxidase to light and heavy chains of rabbit or mouse immunoglobulins (Jackson Immunolabs, United States). Reagents. In the experiments, we used AntiFade, PVDF, polyacrylamide for electrophoresis, Bradford reagent (BioRad, United States); bovine serum albu min, sodium dodecyl sulfate, protease inhibitor cock tail, colchicine, NP40, DAPI, PMSF, paraformalde hyde, Triton X100, Tris (Sigma, United States); trypsin with 1 mM EDTA, DMEM/F12 medium, fetal calf serum (Invitrogen, United States); RNA iso lation kit (RNEasy Mini Kit); Qiagen OneStep kit for RTPCR (Qiagen, United States); ECL (Millipore, United States); cell culture plastic plates (Sarstedt, Germany); Twin 20 (BioChemica, Germany); etha nol (Vekton, Russia); KCl, methanol, acetic acid (Reachim, Russia); heparin (Belmedpreparates, Belorussia); nonfluorescent immersion oil (Carl Zeiss, Switzerland), Giemsa dye, PBS buffer in tablets (BHD, United Kingdom); an atraumatic needle with a Prolene rolene 10/0 suture; surgery stitch suture Pds 6/0 (Ethicon Inc., United Kingdom); polypropylene surgery suture 4/0 (Lintex, Russia); BF6 glue (ZAO Vertex, Russia); sodium tiopenthal, cephazolin (OAO Synthesis, Russia). RESULTS Expression of MSC marker proteins. GFP MSC obtained from the bone marrow of transgeneic GFP mice were assayed at the 12th–25th passages. The GFP expressed was visualized by immunoblotting, protein green fluorescence, and fluorescence with specific antibodies to GFP (Figs. 2a, 2b) (Popov et al., 2009). Tcf3, 4 or Her4 were not revealed in these cells with immunofluorescence (Fig. 2a). MSC lacked Tcf3, 4 and Her4 and marked with GFP are an appro priate model to observe their differentiation into urothelial cells. In normal mice, urothelial cells do not produce GFP and may potentially produce Tcf3, 4. Development of experimental model in mice to assess transdifferentiation of somatic cells into urothelium. Ini CELL AND TISSUE BIOLOGY
Vol. 4
No. 6
2010
MODEL TO STUDY IN VIVO TRANSDIFFERENTIATION OF SOMATIC CELLS Antibodies
GFP
+
−
Tcf3, 4
515
Her4
1
2
1
2
1
2
3
4
3
4
3
4
1
2
1
2
1
2
3
4
3
4
3
4
Fig. 2. Expression of GFP, Tcf3,4 and Her4 in cultured MSC from transgenetic GFP mice assayed by immunofluorescence. (1) Specific antibodies; (2) intrinsic fluorescence; (3) DAPI stain; (4) merged images. Here and in Figs. 3 and 4, the images are recorded on Pascal scanning microscope, lasers with 488 and 633 nm wave length. Obj. 100×.
Mouse strain
C57BL
GFP
C57BL
− −
− +
+ +
MSC Antibodies to GFP
1
2
1
2
1
2
3
4
3
4
3
4
Fig. 3. Expression of GFP in mice C57BL bladder epithelium after MSC transplantation. Immunofluorescence. Other designa tions are the same as in Fig. 2.
tially, it was attempted to induce MSC transdifferenti ation in the urothelium by injecting the cells into an undamaged bladder and histochemically evaluating GFP expression 2 and 4 weeks after transplantation. In these experiments, we did not observe GFP expres sion in the bladders of recipient mice (data are not pre sented). The sublethal irradiation of animals 1 day before MSC were injected into an undamaged bladder CELL AND TISSUE BIOLOGY
Vol. 4
No. 6
2010
also did not result in the implication of MSC in blad der histogenesis. Taking into account the method pre viously suggested (De Coppy et al., 2007) in subse quent experiments, MSC were transplanted into a cry oinjured bladder. In this paper, it was shown that MSC were incorporated mostly in cells of bladder serous membrane and muscles; therefore, we modified the cryoinjury procedure. In the paper cited (De Coppy et
516
POPOV et al. (a) Bladder
MSC βcatenin Tcf3, 4 Actin GFP
MSC
−
Antibodies to Tcf3, 4 or Her4 Antibodies to GFP
− −
Antibodies to
Tcf3, 4
Her4
(b)
−
+
+ −
+ +
1
2
1
2
1
2
3
4
3
4
3
4
1
2
1
2
1
2
3
4
3
4
3
4
Fig. 4. GFP; Tcf3,4; and Her4 expression in bladder of C57BL mice with grafted GFPproducing MSC. (a) Expression of GFP, Tcf3, 4 and βcatenin in bladder of normal C57BL mice and in MSC derived from GFP trangeneic mice, immunoblotting; (b) double immunohistochemical detection of GFP, Tcf3, 4 and Her4 expression in bladder of MSC recipient mice. Designa tions are the same as in Fig. 2.
al., 2007), the procedure was performed by a metal rod with a blunt end. We believe that this approach may damage the serous membrane by physical contact with the rod, whereas urothelial zones beyond the contact area can be undamaged. Thus, the bladder was injured by puncturing all layers, including the urotheilum, with a G21 needle cooled to the temperature of liquid nitrogen. Under these conditions, 2 and 4 weeks after MSC transplantation, we detected GFP in the bladder of recipient mice; it was visualized in urothelial cells
by its intrinsic green fluorescence and using specific antibodies (Fig. 3). GFP was also revealed in the blad der tissue with RTPCR although its expression was lower than in the bladder of transgenic GFP mice (data not shown). Evaluation of tissuespecific modifications in MSC transplanted into bladder of syngeneic mice. Immunob lotting results showed expression of transcription fac tors Tcf3, 4 visible as 50 and 60 kDa bands in C57BL mouse bladder but not GFP and βcatenin expression. CELL AND TISSUE BIOLOGY
Vol. 4
No. 6
2010
MODEL TO STUDY IN VIVO TRANSDIFFERENTIATION OF SOMATIC CELLS
MSC from transgenic GFP mice cultured in vitro pro duced GFP and βcatenin but not transcription fac tors Tcf3, 4 (Fig. 4a). Immunofluorescence assay demonstrated that Tcf3, 4 factors are expressed in the bladder epithelium and are localized predominately in cytoplasm (Fig. 3b). Her4 was typically localized in the cyto plasm membrane, but was occasionally distributed evenly in the nuclear area (Fig. 4b). Double fluores cence with antibodies to Tcf3, 4 or Her4 with red flu orochrome and antibodies to GFP with green fluoro chrome revealed singlecell groups stained with both dyes (Fig. 4b). DISCUSSION Stem cell therapy may be effective under comple mentary molecular and cell conditions in regenerative tissue, e.g., in urothelium and stem cells engaged in recipient tissue regeneration, which may serve as molecular targets for pharmacological regulation of replacement therapy. MSC are recognized as undiffer entiated cells from various tissues of the adult organ ism with high proliferative and differentiation poten tials (Kuhn and Tuan, 2010). It was demonstrated in experiments in vivo and in vitro that MSC differenti ated into cells of mesodermal and ectodermal origins (Prockop, 1997; Pittenger et al., 1999). The differen taition of MSC into endoderm derivates is less effec tive and only occurs under conditions common for traumatic damage of recipient tissue (Ortiz et al., 2003). Most likely, damaged cells in the recipient pro duce factors that facilitate MSC tissuespecific differ entiation. The biochemical nature of these factors is still unknown. It has been reported recently that the cryoinjury of the bladder facilitates MSC transdifferentiation into the urothelium (De Coppi et al., 2007). Cryoinjury rapidly induces the division of urothelial cells that are normally at rest, which restores the damaged tissue. The ability of the urotheium to respond to damage by rapid changes in the proliferation state, induction of urothelium phenotype in bone marrow derived mes enchymal cells by tissuespecific signals as well as urothelium capacity for benign and malignant meta plasia under external signals show that bladder tissue is a system with dynamic plasticity able to respond to transdifferentiation signals (Staack et al., 2005). Here we attempted to develop the model system appropriate for MSC transdifferentiation into urothe lium in mice. This model may be useful for the exper imental analysis of MSC transdifferentiation into the urothelium, intestines, and other tissues with prospec tive applications as donor cells for bladder autoplasty in clinics (Komjakov et al., 2007). It is known that ligands and receptors of the EGF family, in particular Her4 receptor, which is highly expressed in normal and malignant urothelium cells, play an important role in the regulation of urothelium CELL AND TISSUE BIOLOGY
Vol. 4
No. 6
2010
517
proliferation (Røtterud et al., 2005). Wnt/βcatenin signaling is activated in malignant urotelium cells, and, probably, play an important role in the regulation of tissuespecific bladder SC which are not yet identi fied. We found that GFP that marked MSC cultured in vitro did not produce Her4 and Tcf3,4 (Fig. 2). GFP production revealed via RTPCR (data not shown) was found in a cryoinjuryd bladder after MSC trans plantation. GFP was visible in the urothelium of a cry oinjured mice bladder by intrinsic protein green fluo rescence or with specific antibodies to GFP (Fig. 3). Cryoinjury stimulates the production of tissuespecific factors that facilitate MSC differentiation into the endothelium. MSC grafted into control mice without bladder injury did not induce GFP expression (data not shown). Double fluorescence with antibodies to GFP and Her4 or Tcf3, 4 demonstrated, that in some bladder epithelial cells GFP is expressed with Her4 or Tcf3, 4 (Fig. 4b). Cells labeled with double fluores cence were assembled in clusters, which presumably indicates that they originate from a single precursor by its active proliferation. However, the number of epi thelial cells labeled by double fluorescence did not exceed 1–2% of the total epithelial cells. These results are in agreement with the data on GFP identification in bladder of experimental animals by RTPCR that demonstrated that GFP amount in experimental ani mals was significantly lower than in GFP mice (data not shown). Our results showed that βcatenin was not identi fied in bladder cells of C57BL mice under normal con ditions, but these cells synthesized transcription fac tors Tcf3, 4 (Fig. 4a). It is known that the loss of Wnt signals and the low level of nuclear βcatenin in some tissues, e.g., in the skin epithelium, stimulates Tcf3 production, which inhibits the differentiation of hair follicle SC. Tcf3 overexpression inhibits the differenti ation of all three epithelial lineages that originated from one hair follicle SC (Nguyen et al., 2006). It is possible that the functional role of Tcf3 expres sion in the bladder at a lack of Wnt/βcatenin signaling is the same as in the epidermis. This assumption is in accordance with the data that bladder cells in vivo are in a quiescent state (Cooper, 1972; Varley et al., 2004, 2005). We believe that supporting epithelium cells in qui escence may play the role of differentiation inhibitors in the bladder by suppressing the transcription factor PPARγ, which promotes the differentiation of urothe lial cells (Varley et al., 2004). It is known that PPARγ sustains SC differentiation in the epidermis; its inhibi tion in epidermal stem cells is controlled by transcrip tion factor Tcf3 (Nguyen et al., 2006). In skin and the bladder epithelium, the function of which is to main tain the water balance, PPARγ plays a similar role that facilitates the differentiation of SC into functionally mature cells. In the urothelium, PPARγ activates the transcription of uroplakins, which form apical mem
518
POPOV et al.
brane in umbrellalike cells contacting with urea (Var ley et al., 2004). The implication of similar mecha nisms that regulate differentiation in the bladder and skin is confirmed by the involvement of Get1 product in both cases, which mediates the effect of PPARγ on the terminal differentiation of cells (Yu et al., 2009). ACKNOWLEDGMENTS The work was supported by the Russian Founda tion for Basic Research (project 090400595). REFERENCES Anumanthan, G., Makari, J.H., Honea, L., Thomas, J.C., Wills, M.L., Bhowmick, N.A., Adams, M.C., Hayward, S.W., Matusik, R.J., Brock, J.W., 3rd, and Pope, J.C. 4th., Directed Differentiation of Bone Marrow Derived Mesen chymal Stem Cells into Bladder Urothelium, J. Urol., 2008, vol. 180, pp. 1778–1783. Atala, A., Engineering Organs, Curr. Opin. Biotechnol., 2009, vol. 20, pp. 575–592. Bajada, S., Mazakova, I., Richardson, J.B., And Asham makhi, N., Updates on Stem Cells and Their Applications in Regenerative Medicine, J. Tissue Eng. Regen. Med., 2008, vol. 2, pp. 169–183. Cooper, E.H., The Biology of Bladder Cancer, Ann. R. Coll. Surg. Engl., 1972, vol. 51, pp. 1–16. De Coppi, P., Callegari, A., Chiavegato, A., Gasparotto, L., Piccoli, M., Taiani, J., Pozzobon, M., Boldrin, L., Oka be, M., Cozzi, E., Atala, A., Gamba, P., and Sartore, S., Amniotic Fluid and Bone Marrow Derived Mesenchymal Stem Cells Can Be Converted to Smooth Muscle Cells in the CryoInjured Rat Bladder and Prevent Compensatory Hypertrophy of Surviving Smooth Muscle Cells, J. Urol., 2007, vol. 177, pp. 369–376. Friedenstein, A.J., Precursor Cells of Mechanocytes, Int. Rev. Cytol., 1976, vol. 47, pp. 327–359. Kastritis, E., Murray, S., Kyriakou, F., Horti, M., Tamva kis, N., Kavantzas, N., Patsouris, E.S., Noni, A., Lega ki, S., Dimopoulos, M.A., and Bamias, A., Somatic Muta tions of Adenomatous Polyposis Coli Gene and Nuclear βCatenin Accumulation Have Prognostic Significance in Invasive Urothelial Carcinomas: Evidence for Wnt Pathway Implication, Int. J. Cancer, 2009, vol. 124, pp. 103–108. Kinebuchi, Y., Johkura, K., Sasaki, K., Imamura, T., Mimura, Y., and Nishizawa, O., Direct Induction of Lay ered Tissues from Mouse Embryonic Stem Cells: Potential for Differentiation into Urinary Tract Tissue, Cell Tissue Res., 2008, vol. 331, pp. 605–615. Komyakov, B.K., Novikov, A.I., Fadeev, V.A., Zuban’, O.N., Strokova, L.A., Darienko, R.O., and Muslim, M.M., Results of Orthopedic Plastic of the Bladder with the Stom ach and Ileum, Urologiya, 2007, no . 6, pp. 23–28. Kuhn, N.Z. and Tuan, R.S., Regulation of Stemness and Stem Cell Niche of Mesenchymal Stem Cells: Implications in Tumorigenesis and Metastasis, J. Cell. Physiol., 2010, vol. 222, pp. 268–277. Kurzrock, E.A., Lieu, D.K., Degraffenried, L.A., Chan, C.W., and Isseroff, R.R., LabelRetaining Cells of the Bladder: Candidate Urothelial Stem Cells, Am. J. Phys iol. Renal. Physiol., 2008, vol. 294, pp. 1415–1421.
Nguyen, H., Rendl, M., and Fuchs, E., Tcf3 Governs Stem Cell Features and Represses Cell Fate Determination in Skin, Cell, 2006, vol. 127, pp. 171–183. Nusse, R., Fuerer, C., Ching, W., Harnish, K., Logan, C., Zeng, A., Ten Berge, D., and Kalani, Y., Wnt Signaling and Stem Cell Control, Cold Spring Harb. Symp. Quant. Biol., 2008, vol. 73, pp. 59–66. Oottamasathien, S., Wang, Y., Williams, K., Franco, O.E., Wills, M.L., Thomas, J.C., Saba, K., SharifAfshar, A.R., Makari, J.H., Bhowmick, N.A., Demarco, R.T., Hipkens, S., Magnuson, M., Brock, J.W., 3rd, Hayward, S.W., Pope, J.C., 4th, and Matusik, R.J., Directed Differentia tion of Embryonic Stem Cells into Bladder Tissue, Dev. Biol., 2007, vol. 304, pp. 556–566. Ortiz, L.A., Gambelli, F., Mcbride, C., Gaupp, D., Bad doo, M., Kaminski, N., and Phinney, D.G., Mesenchymal Stem Cell Engraftment in Lung Is Enhanced in Response to Bleomycin Exposure and Ameliorates Its Fibrotic Effects, Proc. Natl. Acad. Sci. USA, 2003, vol. 100, pp. 8407–8411. Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonet ti, D.W., Craig, S., and Marshak, D.R., Multilineage Potential of Adult Human Mesenchymal Stem Cells, Sci ence, 1999, vol. 284, pp. 143–147. Popov, B.V., Petrov, N.S., Mikhaylov, V.M., Tomilin, A.N., Alekseenko, L.L., Grinchuk, T.M., and Zaychik, A.M., Spontaneous Transformation and Immortalization of Mes enchymal Stem Cells in vitro, Tsitologiia, 2009, vol. 51, no. 2, pp. 91–102. Popov, B.V., Serikov, V.B., Petrov, N.S., Izusova, T.V., Gupta, N., and Matthay, A., Lung Epithelial Cells A549 Induce Epithelial Differentiation in Mouse Mesenchymal BM Stem Cells by Paracrine Mechanism, Tissue Eng., 2007, vol. 13, pp. 2441–2450. Prockop, D.J., Marrow Stromal Cells as Stem Cells for Nonhematopoietic Tissues, Science, 1997, vol. 276, pp. 71– 74. Røtterud, R., Nesland, J.M., Berner, A., and Foss, S.D., Expression of the Epidermal Growth Factor Receptor Family in Normal and Malignant Urothelium, B. J. U. Int., 2005, vol. 95, pp. 1344–1350. Schulz, W.A., Understanding Urothelial Carcinoma through Cancer Pathways, Int. J. Cancer, 2006, vol. 119, pp. 1513–1518. Shukla, D., Box, G.N., Edwards, R.A., and Tyson, D.R., Bone Marrow Stem Cells for Urologic Tissue Engineering, World J. Urol., 2008, vol. 26, pp. 341–349. Staack, A., Hayward, S.W., Baskin, L.S., and Cunha, G.R., Molecular, Cellular and Developmental Biology of Urothe lium as a Basis of Bladder Regeneration, Differentiation, 2005, vol. 73, pp. 121–133. Thomas, J.C., Oottamasathien, S., Makari, J.H., Honea, L., SharifAfshar, A.R., Wang, Y., Adams, C., Wills, M.L., Bhowmick, N.A., Adams, M.C., Brock, J.W., 3rd, Hay ward, S.W., Matusik, R.J., and Pope, J.C. 4th, Temporal Spatial Protein Expression in Bladder Tissue Derived from Embryonic Stem Cells, J. Urol., 2008, vol. 180, pp. 1784– 1789. Van Der Flier, L.G., SabatesBellver, J., Oving, I., Haege barth, A., De Palo, M., Anti, M., Van Gijn, M.E., Suijker buijk, S., Van De Wetering, M., Marra, G., and Clevers, H., CELL AND TISSUE BIOLOGY
Vol. 4
No. 6
2010
MODEL TO STUDY IN VIVO TRANSDIFFERENTIATION OF SOMATIC CELLS The Intestinal Wnt/Tcf Signature, Gastroenterology, 2007, vol. 132, pp. 628–632. Varley, C., Hill, G., Pellegrin, S., Shaw, N.J., Selby, P.J., Trejdosiewicz, L.K., and Southgate, J., Autocrine Regula tion of Human Urothelial Cell Proliferation and Migration during Regenerative Responses in vitro, Exp. Cell. Res., 2005, vol. 306, pp. 216–229. Varley, C.L., Stahlschmidt, J., Lee, W.C., Holder, J., Dig gle, C., Selby, P.J., Trejdosiewicz, L.K., and Southgate, J., Role of PPARγ and EGRF Signalling in the Urothelial Ter
CELL AND TISSUE BIOLOGY
Vol. 4
No. 6
2010
519
minal Differentiation Programme, J. Cell Sci., 2004, vol. 117, pp. 2029–2036. Wu, X.R., Lin, J.H., Walz, T., Häner, M., Yu, J., Aebi, U., and Sun, T.T., Mammalian Uroplakins. A Group of Highly Conserved Urothelial DifferentiationRelated Membrane Proteins, J. Biol. Chem., 1994, vol. 269, pp. 13716–13724. Yu, Z., Mannik, J., Soto, A., Lin, K.K., and Andersen, B., The Epidermal DifferentiationAssociated Grainyhead Gene Get1/Grhl3 Also Regulates Urothelial Differentia tion, EMBO J., 2009, vol. 28, pp. 1890–1903.
