Modulation of monocyte signaling and pore formation in response to agonists of the nucleotide receptor P2X7 Mini Aga,*† Christopher J. Johnson,* Arlene P. Hart,* Arturo G. Guadarrama,† M. Suresh,‡ John Svaren,§ Paul J. Bertics,† and Benjamin J. Darien* Departments of *Medical, ‡Pathobiological, and §Comparative Bio-Sciences, School of Veterinary-Medicine, and †Department of Biomolecular Chemistry, University of Wisconsin, Madison
Abstract: Previous reports about the nucleotide receptor P2X7, which exhibits ion channel and pore-forming activity and is known to promote IL-1 processing, have centered largely on its role in macrophage function, whereas its participation in monocyte activity has been unclear. However, because extracellular ATP has been shown to affect monocytes with respect to IL-1 release, we hypothesized that the P2X7 receptor is also present and functional in a subpopulation of blood monocytes. Flow cytometric analysis revealed that about 70% of monocytes isolated from normal human donors expressed the P2X7 receptor. Activation of P2X7 receptor-associated pore formation by the agonist BzATP resulted in a 9- to 15-fold increase in the uptake of the membrane-impermeant fluorescent dye YO-PRO, and this dye uptake is markedly inhibited by the P2X7 receptor antagonists KN-62 and oATP. Evidence supporting the presence of the functional P2X7 receptor in monocytes also includes the observation that BzATP exposure results in a dose-dependent increase in the activation of mitogen-activated protein kinases and the nuclear translocation of the transcription factor NF-B in human monocytes and in THP-1 human monocytic cells. Furthermore, treatment of monocytes with BzATP induced the expression of cyclooxygenase-2 (COX-2) and tissue factor, which are two important endpoints that have not been previously shown to be regulated by nucleotide receptor action in monocytes. Together, these data indicate that a subpopulation of human monocytes express P2X7 receptors that are functional with respect to pore formation, signal transduction, and mediator production, further supporting a key role for this nucleotide receptor in host immune responses. J. Leukoc. Biol. 72: 222–232; 2002. Key Words: extracellular nucleotides 䡠 YO-PRO 䡠 COX-2 䡠 tissue factor 䡠 NF-B
INTRODUCTION Human monocytes and macrophages are critical in mediating host defense and inflammatory responses against a variety of 222
Journal of Leukocyte Biology Volume 72, July 2002
infectious agents. In addition, extracellular nucleotides play a key role in the regulation of cellular functions and biological effects such as inflammation, platelet aggregation, and smooth muscle contraction via interaction with a variety of cell surface purinergic receptors [1, 2]. These receptors have been subdivided into P1 and P2 subtypes on the basis of pharmacological and functional analysis [1, 2]. P2 receptors, which preferentially bind di- and triphospho-nucleotides, have been classified further into P2Y receptors, defined by having seven transmembrane-spanning regions and being coupled to the hetero-trimeric G proteins and P2X receptors that serve as adenosine 5⬘-triphosphate (ATP)-gated plasma membrane ion channels [3, 4]. To date, seven distinct P2X receptors (P2X1–P2X7) have been identified, functionally characterized, and shown to exhibit different pharmacological profiles [5–7]. Activation of the P2X7 receptor with the natural agonist ATP or with the pharmacological agonist 2⬘- and 3⬘-O-(4 benzoyl benzoic) ATP (BzATP) causes the cell membrane to undergo rapid depolarization. A prolonged state of activation of the receptor promotes the formation of nonselective pores that allow the bi-directional passage of molecules ⬍900 Daltons, leading to the leakage of metabolites and the generation of large ion fluxes that can cause cell death via apoptotic mechanisms [8]. BzATP is a potent agonist of the P2X7 receptor and can induce pore activity that can be measured by the cellular accumulation of a membrane-impermeant dye, YO-PRO (⬃629 Daltons). Human monocytes and macrophages constitute an important line of defense upon infection and exposure to inflammatory stimuli [9]. Circulating blood monocytes become activated, migrate to tissues, and undergo differentiation into macrophages during inflammation [10]. The molecular changes that occur in monocytes during differentiation have been studied extensively, and numerous alterations in gene expression and the activation of signaling proteins have been demonstrated [11]. Monocytes have been shown to express several P2Y receptors, whereas macrophages also express elevated levels of the P2X7 receptor. Up-regulation of P2X7 receptor mRNA in monocytes has been observed upon cell differentiation to macrophages [6, 8, 12–15].
Correspondence: Dr. Benjamin J. Darien, Department of Medical Sciences, School of Veterinary-Medicine, University of Wisconsin, Madison, WI 537061102. E-mail:
[email protected] Received April 23, 2001; revised January 25, 2002; accepted January 25, 2002.
http://www.jleukbio.org
Although the specific mechanisms of signal transduction used by the P2X7 receptor are poorly understood in monocytes/ macrophages, activation of several downstream signaling molecules has been shown upon P2X7 receptor activation in macrophages [16 –19]. One of these signaling events is the stimulation of several mitogen-activated protein kinases (MAPKs; ERK1/ERK2 and p38), which play an important role in a variety of pathophysiological responses critical for inflammation and tissue remodeling. MAPKs are differentially activated by growth factors, cytokines, and cellular stress, and are known to control gene expression and various cellular regulatory events such as differentiation and survival [20]. Stimulation of the P2X7 receptor with ATP has been shown to activate MAPKs in macrophages as well as induce the nuclear translocation of the transcription factor, nuclear factor-B (NF-B) in microglial cells [16 –18, 21–23]. The nuclear translocation of NF-B can be regulated by proteosome-mediated degradation of its inhibitory subunit, IB, which sequesters NF-B basally in the cytosol [24]. Upon degradation of IB␣, NF-B is free to enter the nucleus and promote gene transcription. The observation that ATP can promote the nuclear translocation of NF-B links P2X7 receptor action with the control of gene expression, because NF-B is responsible for inducing the transcription of numerous genes, including inflammatory cytokines, cyclooxygenase-2 (COX-2), and tissue factor [25]. Monocytes and macrophages share the ability to produce interleukin-1 (IL-1) [11], which is central for a variety of immunological activities. In addition, IL-1 release can act in an autocrine manner and leads to the activation of other proinflammatory genes that further contribute to the process of inflammation [26]. IL-1 is present in the cytosol as an inactive, 31-kDa procytokine precursor that is cleaved by the IL-1-converting enzyme (caspase-I) to generate the active 17 kDa form [27]. Activation of the P2X7 receptor is associated with an increase in IL-1 processing in lipopolysaccharide (LPS)-treated monocytes and macrophages [11, 27, 28]. Monocytes and macrophages present a hemostatic barrier during infection and are recruited to the sites of tissue damage and inflammation upon tissue injury [10]. In the event of inflammation as a result of cell lysis, very high concentrations of ATP (mM range) are present in the microenvironment of the inflamed region [9]. These high levels of ATP have been proposed to orchestrate the cascades that lead to inflammatory mediator production including eicosanoids and tissue factor. The synthesis of the prostaglandin E2 involves the action of the enzyme COX-2 [29 –34], which is in turn regulated in response to a variety of stimuli [35]. LPS and ATP have been shown to induce COX-2 synthesis via activation of P2Y receptors in peripheral blood monocytes/macrophages [36]. Furthermore, the P2X7 receptor has also been implicated in the LPS-mediated release of arachadonic acid by ATP in macrophages [37, 38]. Monocytes also express tissue factor (coagulation factor III, CD142), a cell surface protein that initiates the blood coagulation system upon stimulation with pathogens [39]. The process of inflammation has been linked recently with the expression of tissue factor in monocytes and macrophages in response to LPS [39]. Although tissue factor is absent from cells in contact with plasma, monocytes can be induced to express cell surface tissue factor by various inflammatory me-
diators [40]. Up-regulation of tissue factor has been implicated in thrombotic disorders, tumor biology, angiogenesis, metastasis, and mediating outside-in signaling [41]. However, the role of the P2X7 receptor in the generation of tissue factor is not known. Although monocytes have been shown to release IL-1 upon stimulation with LPS and adenine nucleotides (P2X7 agonists) [17, 22, 23, 42], their capacity to express functional P2X7 receptor is not clear [13, 14, 43]. Human THP-1 monocytic cells have been shown to express low levels of P2X7 receptor mRNA that can be substantially up-regulated upon the induction of cellular differentiation into macrophages with interferon-␥, tumor necrosis factor ␣ (TNF-␣), or LPS [13, 21, 43]. Higher levels of P2X7 receptor mRNA in differentiated THP-1 cells have been hypothesized to translate into increased protein expression, although a direct relationship has not been shown in primary human monocytes [14]. As monocytes have been shown to express little or inactive P2X7, but are able to respond to ATP by producing IL-1, we hypothesized that a definable subpopulation of blood monocytes express functional P2X7 receptors and therefore undertook experiments to evaluate P2X7 receptor expression and function in freshly isolated human monocytes.
MATERIALS AND METHODS Reagents for cell culture were purchased from Mediatech (Herndon, VA). 1-[N, O-bis (5-isoquinolene sulfonyl) N-methyl-L-tyrosyl]-4-phenylpiperazine (KN-62) was obtained from Biomol Research Laboratories (Plymouth Meeting, PA). UTP, ATP, oATP, BzATP, LPS Escherichia coli serotype 0111:B4, mouse immunoglobulin G (IgG)2b, and rabbit IgG2 antibodies were all obtained from Sigma Chemical Co. (St. Louis, MO). The anti-P2X7 receptor antibody, recognizing the extracellular region of the P2X7 receptor, was generously provided by Dr. Ian Chessel at Glaxo Wellcome (Middlesex, UK), and the antibody to the intracellular region of P2X7 was purchased from Chemicon International Inc. (Temecula, CA). The CD14 monoclonal antibody (mAb) was purchased from Pharmingen (San Diego, CA). YO-PRO-1 was purchased from Molecular Probes (Eugene, OR). The COX-2 mAb, which cross-reacts with the humans, was purchased from Transduction Labratories (Lexington, KY). The enzymelinked immunosorbent assay (Quantikine) kit for quantification of human IL- was obtained from R&D Systems (Minneapolis, MN). The rabbit polyclonal Anti-ACTIVE™ MAPK (ERK1/ERK2) and anti-ERK1/2 antibodies were obtained from Promega (Madison, WI).
Cell isolation and culture Heparinized blood was drawn from healthy adult volunteers at the University of Wisconsin (UW) Hospitals and Clinics (Madison) in compliance with the requirements of the UW Health Sciences, Human Subjects Committee protocol. Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats and were separated subsequently by gradient centrifugation as described previously [44]. Isolated monocytes were washed and resuspended in RPMI with 10% human AB⫹ serum. Monocytes were plated in Costar tissue-culture dishes (Corning, NY) and were allowed to adhere at 37°C in a humidified atmosphere at 5% CO2 for 2 h, and nonadherent cells were removed by replacing the medium only in experiments examining MAPKs, IB␣, NF-B, COX-2, and IL-1. Cell viability was determined by a 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyl tetrazolium bromide assay and trypan blue exclusion [45, 46] (unpublished results). More than 99% cells were typically found to be viable, and ⬎95% of the cells isolated were identified as monocytes, as evidenced by morphologic, cytological evaluation, and nonspecific esterase staining.
Aga et al. Functional P2X7 receptors in human peripheral monocytes
223
Flow cytometry Freshly isolated PBMC (obtained within 1 h of drawing donor blood) were washed twice and resuspended in phosphate-buffered saline (PBS) with 1% cosmic calf serum to examine the expression of the cell-surface proteins. To determine YO-PRO uptake by monocytes, freshly isolated cells were resuspended in the fluorescein-activated cell sorter (FACS) buffer (130 mM NaCl, 5 mM KCl, 20 mM HEPES, pH 7.4, 1 mM glucose, and 0.1% bovine serum albumin). Forward- and side-scatter were used to distinguish the monocytes, lymphocytes, and cell debris on the flow cytometer (FACScan, Becton Dickinson, San Jose, CA). Cell viability was determined to be approximately 99%, based on cellular uptake of propidium iodide. For each assay, at least 3 ⫻ 105 cells were used, and 10,000 monocyte events were acquired by gating-out cells positive for propidium iodide. The geometric mean fluorescence intensity (MFI) for each histogram was used to quantify the expression of cell surface markers and YO-PRO uptake. Monocytes were double stained with the P2X7 mAb directed against the extracellular domain of the P2X7 receptor (0.5 g/mL) or with the isotype-control antibody IgG2b (0.5 g/mL) on ice for 30 min and were also labeled with the polyclonal CD14 antibody (0.5 g/mL) or the isotype-control antibody IgG2 (0.5 g/mL). The cells were labeled using constant agitation and were then washed once with PBS. In some cases, magnetic beads coupled to anti-CD14 (Miltenyi Biotech Inc., Auburn, CA) were used to isolate monocytes (according to the manufacturer’s protocol) as a parallel approach for determining the expression levels of the P2X7 receptor on monocytes. After incubating the cells for 30 min on ice with the fluorescein isothiocyanate (FITC)-labeled goat anti-mouse and R-phycoerytherin (R-PE)-labeled goat anti-rabbit secondary antibodies (0.5 g/mL), the cell-associated fluorescence was assessed by flow cytometry. The cells were washed once and resuspended in PBS. For determining YO-PRO uptake, PBMC were treated with YO-PRO (2 ⌴) and with or without BzATP (250 ⌴) for 15 min at 37°C. Some cells were preincubated for 2 h with the P2X7 receptor antagonist oATP (250 ⌴) or for 30 min with the P2X7 receptor antagonist KN-62 (300 nM). Monocytes suspended in buffer alone served as a control, whereas cells incubated with YO-PRO (15 min) were used as a baseline for quantifying the MFI. Cells were washed once, resuspended in PBS, and subjected immediately to FACS analysis.
Immunoprecipitation and immunoblotting Freshly isolated human monocytes or cells from the human monocytic cell line, THP-1 (plated overnight), were lysed in radioimmunoprecipitation assay buffer [1% Nonidet P-40, 0.25% deoxycholate, 1 mM Na3VO4, 1 mM phenylmethysulfonyl fluoride, 1 g/ml leupeptin, 1 g/ml aprotinin, 1 mM ethylenediaminetetraacetate (EDTA), 1 mM ethyleneglycol-bis(-aminoethylether)-N,N⬘tetraacetic acid, 150 mM NaCl, 10 mM Tris, pH 8.0]. Cell lysates were precleared with protein G-conjugated agarose beads and then immunoprecipitated with the mAb against the extracellular region of the P2X7 receptor or with nonspecific mouse IgG2b antibodies followed by incubation with protein G-conjugated agarose beads. The immunoprecipitates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the proteins were transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked in 5% nonfat milk/Tris-buffered saline/Tween 20 (TBST) for 1 h at 37°C, and the expression of the P2X7 receptor was determined by immunoblotting the membrane for 16 h at 4°C with the polyclonal P2X7 receptor antibody. After being washed 3 times with TBST, the blots were incubated for 1 h at 37°C with horseradish peroxidase-conjugated anti-rabbit secondary antibodies and were then washed at room temperature. The bound antibodies were visualized using the Lumi-Glo chemiluminescent detection method (Kirkegaard and Perry Labs, Gaithersburg. MD). For immunoblotting analyses, monocytes (3–5⫻106 cells) were plated in six-well culture dishes and allowed to adhere for 2 h. The cells were washed once with PBS, and whole cell lysates were prepared by lysing monocytes in SDS-PAGE sample buffer without bromophenol blue [20 mM Tris, 2 mM EDTA, 1 mM Na3VO4, 2 mM dithiothreitol (DTT), 2% SDS, and 20% glycerol; ref. 47]. Protein content was determined using Micro-BCA protein assay (Pierce Biochemical Company, Rockford, IL). Equal amounts of protein (⬃50 g/lane) were loaded per lane and resolved by 10% SDS-PAGE [47]. Proteins were transferred to Immobilon PVDF membranes (Millipore Corp., Bedford, MA), and the membranes were blocked overnight in 5% dry, nonfat milk/TBST (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% Tween 20) at 4°C or were
224
Journal of Leukocyte Biology Volume 72, July 2002
blocked for 1 h at 37°C. Expression of the P2X7 receptor was determined via immunoblotting with a polyclonal anti-P2X7 receptor (1.5 g/mL) antibody. Anti-active ERK antibodies that recognize the dually (serine/threonine) phosphorylated and active forms of ERK1/ERK2 were used at a dilution of 1:5000. Anti-active p38 antibodies and COX-2 mAb were used at a final dilution of 1:2000. To measure the degradation of IB␣, anti-IB␣, antibodies were used at a final dilution of 1:1000. The immunoreactive bands were visualized using standard protocols as indicated above. Equal protein loading was confirmed by stripping the membranes at 70°C for 30 min in stripping buffer [62.5 mM Tris-HCl (pH 6.7), 2% SDS, and 100 mM DTT]. The immunoblots were blocked again in 5% nonfat milk and reprobed with anti-ERK1/2 antibodies that recognize active and inactive forms of both proteins. Bound antibodies were visualized using chemiluminescence detection. Each experiment was replicated at least three times using separate blood donors.
Electrophoretic mobility shift assay (EMSA) Nuclear extracts for determining the nuclear translocation of the transcription factor NF-B were prepared as described previously [19, 48]. Briefly, monocytes were plated at 1 ⫻ 107 cells/well, incubated overnight in six-well plates, and incubated in media (20 mM HEPES) alone or treated with LPS (1000 ng/mL; 120 min) or BzATP (100 M; 60 min). Some samples were pretreated with KN-62 (3 M) for 30 min. A double-stranded oligonucleotide containing two consensus NF-B binding sites (5⬘ GATCCAAGGGACTTTCCATGGATCCAAGGGGACTTTCCATG 3⬘) was end labeled with ␥-[32P]-ATP using T4 polynucleotide kinase. Labeled oligonucleotide (105 counts per min) was incubated with 10 g nuclear extract protein for 20 min. The proteins were then separated on a 6% nondenaturing polyacrylamide gel and analyzed by autoradiography.
Measurement of cytokine release To determine the levels of IL-1 production, freshly isolated human monocytes and THP-1 cells (1⫻106) were cultured in 12-well plates. Cells were treated with LPS (100 and 1000 ng/mL) and BzATP (100 M) for 6 h. Subsequently, the medium was removed and assayed for IL-1 release, according to the manufacturer’s protocol. This assay measures the processed and immature forms of IL-1.
Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis Total RNA was purified from monocyte samples, and 1 g was used to prepare cDNA as described previously [49]. Quantitative RT-PCR analysis for tissue factor was performed by monitoring in real time the increase in fluorescence of the SYBR-green dye using the TaqMan 5700 sequence detection system (Perkin Elmer, Foster City, CA) as outlined earlier [50, 51]. Relative amounts of each gene in the samples were determined using a standard curve of serial dilutions of the cDNA containing the highest amount of the gene. These values were then normalized to the relative amounts of 18S cDNA, which were obtained from a similar standard curve. The following primers were used for tissue factor: CTCCCCAGAGTTCACACCTTCC and AACATCCCGGAGGCTTAGGA. Each experiment was replicated at least three times using separate blood donors.
RESULTS Cell surface expression of the P2X7 receptor on human monocytes As an initial step to assess the potential involvement of P2X7 receptor action on the regulation of human monocytes, we examined the surface expression of the P2X7 receptor on monocytes using flow cytometry and co-staining with antibodies to the P2X7 receptor and the cell surface, LPS-binding protein CD14. The CD14 antibody was used to mark and determine the scatter profile of the predominant monocyte population in the mononuclear cell fraction. To further confirm http://www.jleukbio.org
Fig. 1. Detection of the P2X7 receptor in human monocytes by flow cytometry. Freshly isolated peripheral blood monocytes were incubated with 0.5 g/mL polyclonal CD14 or the anti-P2X7 receptor mAb or the respective rabbit or mouse isotype control antibodies. The primary antibodies were detected by staining with 0.5 g/mL PE-tagged goat anti-rabbit (GARPE) and FITC-labeled goat anti-mouse antibodies (GAMFITC) and were analyzed by flow cytometry. At least 10,000 live monocyte events were recorded. Live and dead cells were distinguished by gating out the cells that stained positive with propidium iodide (dead cells). The data are representative of results obtained from five different experiments.
the expression of the P2X7 receptor in these cells (as indicated in Fig. 1), anti-CD14-coupled magnetic beads were used to isolate monocytes (see Materials and Methods), and the majority of the CD14-positive monocytes expressed readily detectable levels of the P2X7 receptor. About 70% of the monocyte population stained positive for the fluorochrome-tagged P2X7 receptor antibody. The cells from the same donor were also stained with identical concentrations of the isotype control antibodies (IgG2b/IgG2), and we observed very low MFIs, when compared with those conjugated with the P2X7 receptor antibody. Similarly, human THP-1 monocytic cells were also observed to express the P2X7 receptor (data not shown) consistent with the studies of Humphreys and Dubyak [14].
ting analyses, the expression of the P2X7 receptor protein in freshly isolated human monocytes and human THP-1 cells was assessed by immunoprecipitation. A mAb raised against an extracellular epitope (see Materials and Methods) on the P2X7 receptor was used to immunoprecipitate the receptor from peripheral blood human monocytes and THP-1 cells (Fig. 2B). As depicted in Figure 2B, the isotype-control antibody did not immunoprecipitate detectable levels of proteins in the expected size range, whereas the P2X7 receptor antibody did precipitate proteins in the 75– 80 kDa range, when using extracts from freshly isolated human monocytes or THP-1 cells.
Immunodetecton of the P2X7 receptor
Although the aforementioned experiments indicated that a majority of freshly isolated human monocytes express the P2X7 receptor protein, it has been suggested that monocytes largely express nonfunctional P2X7 receptors [21, 43]. Thus, we first evaluated the pore-forming activity of the P2X7 receptor in monocytes by measuring the ability of these cells to take up the fluorescent dye YO-PRO following stimulation with a P2X7 receptor ligand, BzATP. Approximately 80% of the human monocytes exhibited YO-PRO uptake when the cells were stimulated with 250 M BzATP for 15 min. As shown in Figure 3, A and B, there was a 9- to 15-fold increase in the MFI in the BzATP-treated monocytes isolated from various donors (n⫽5). Furthermore, BzATP-stimulated dye uptake was substantially inhibited in the presence of the P2X7 receptor antagonists oATP (Fig. 3A) and KN-62 (Fig. 3B). YO-PRO uptake in monocytes was not completely abolished by oATP (Fig. 3B) as the cellular accumulation of the dye was observed to be slightly higher than the basal levels of YO-PRO taken up by these cells. One potential explanation for the partial agonist activity of oATP is that the preparation is likely to be contaminated with a small amount of ATP, which can allow for some P2X7 receptor activation upon pretreatment with the compound [50, 54 –57]. Because it is possible that these effects of BzATP may be mediated in part by other nucleotide receptors, such as the P2Y2 receptor, which is highly expressed in monocytes [58, 59], we evaluated whether UTP (an agonist of the P2Y2 receptor) could induce YO-PRO uptake in freshly isolated monocytes. However, treatment of monocytes with UTP (250 ⌴)
Expression of the P2X7 receptor protein was also evaluated by immunoblotting analysis of human monocytes (Fig. 2A). A whole cell lysate obtained from rat brain was used as a positive control; the antibody used for immunodetection was raised against the rat P2X7 receptor and is known to cross-react with the human and mouse P2X7 receptor [52, 53]. To further confirm our observations from flow cytometry and immunoblot-
Fig. 2. Immunodetection of the P2X7 receptor in human monocytes. (A) Whole cell lysates obtained from freshly isolated human monocytes (50 g protein/lane) and rat brain cells (Rat Pituitary WCL; 20 g protein/lane) were resolved by SDS-PAGE. The proteins were then transferred to a PVDF membrane and were immunoblotted with a polyclonal anti-P2X7 receptor antibody (Chemicon International Inc.) as detailed in Materials and Methods. (B) Human THP-1 cells and freshly isolated human monocytes were lysed, and 1 g anti-human P2X7 receptor mAb or the isotype-control antibody IgG2b was used for immunoprecipitation. The immunoprecipitates were subjected to SDS-PAGE and immunoblotted with a polyclonal anti-P2X7 receptor antibody as described in Materials and Methods. Whole cell lysates from rat brain membrane (Rat Brain WCL) were used as positive controls. Analogous results were obtained in three separate experiments.
Pore formation and YO-PRO uptake
Aga et al. Functional P2X7 receptors in human peripheral monocytes
225
Fig. 3. Effect of P2X7 receptor antagonists on BzATP-induced YO-PRO uptake in human monocytes. Freshly isolated human PBMC were preincubated with the P2X7 receptor antagonists oATP (250 M) for 2 h (A) or KN-62 (300 nM) for 30 min (B) in RPMI supplemented with 10% human serum. The PBMC were then treated with or without BzATP (250 M) and YO-PRO (2 M) for 15 min at 37°C and were followed by analysis using flow cytometry. Human monocytes exposed to buffer alone served as a control, whereas cells incubated with YO-PRO alone (15 min) were used as a baseline for quantifying agonist-induced increases in the MFI. For each treatment, at least 10,000 events were recorded. Live and dead cells were distinguished by gating out the cells positive with propidium iodide. These experiments were performed using cells obtained from multiple donors.
did not induce the uptake of YO-PRO by monocytes (data not shown), consistent with the concept that P2X7 receptors and not P2Y2 receptors play a key role in the formation of this pore.
Mechanisms of signal transduction Because these data support the hypothesis that a population of monocytes express functional P2X7 receptors in terms of pore formation, we evaluated whether additional signaling events are activated in monocytes following exposure to P2X7 receptor agonists. Human monocytes and THP-1 cells were stimulated with BzATP, and the activation of the ERK1 (p44)/ERK2 (p42) and p38 isoforms of the MAPKs was assessed by immunoblotting using phosphorylation state-specific antibodies (Fig. 4, A–C). As shown in Figure 4A, intermediate concentrations of BzATP (100 –250 M) induced the peak activation of ERK1/ ERK2 within 5 and 15 min of ligand exposure in monocytes (the time range was donor-dependent). THP-1 cells appeared more sensitive to lower levels of BzATP than freshly isolated monocytes because 50 and 100 M BzATP resulted in the peak activation of ERK1/ERK2 (Fig. 4B) and p38 (Fig. 4C) within 5 min of treatment of THP-1 cells (Fig. 4B). To further examine the role and selectivity of the P2X7 receptor in the activation of the MAPKs, freshly isolated monocytes and THP-1 cells were treated with two different classes of P2X7 receptor antagonists (oATP and KN-62). Pretreatment of 226
Journal of Leukocyte Biology Volume 72, July 2002
human monocytes with KN-62 (Fig. 5A) for 30 min followed by stimulation with 250 M BzATP for 15 min led to a KN-62-mediated dose-dependent decrease in ERK1/ERK2 (Fig. 5A), which is consistent with the concept that the P2X7 receptor can mediate the activation of the MAPKs in monocytes. A marked inhibition of ERK1/ERK2 activation in the presence KN-62 and oATP was also observed in THP-1 cells (Fig. 5, B and C). As a control, cells were also treated with the phorbol ester phorbol 12-myristate 13-acetate (PMA), which activates ERK1/ERK2 in a receptor-independent manner, to evaluate the specificity of the P2X7 antagonists; neither antagonist affected PMA-stimulated ERK activation. As a second readout of the P2X7 receptor signaling, we evaluated the ability of BzATP to induce the proteolytic cleavage of cytosolic IB␣, which is an inhibitory protein that binds to and sequesters the transcription factor NF-B in the cytoplasm. Human THP-1 cells were treated with 100 ng/mL LPS for 15 min (as a positive control) or the indicated concentrations of BzATP for 10 min. As illustrated in Figure 6, treatment of THP-1 cells with BzATP or LPS promoted the rapid degradation of IB␣, again suggesting that at least a portion of the P2X7 receptors on monocytes are functional. As another approach to assess the influence of P2X7 receptor antagonists on the NF-B-IB system, we examined the nuclear translocation of the NF-B in response to stimulation with BzATP http://www.jleukbio.org
Fig. 4. BzATP induces the activation of MAPK in a time- and dose-dependent manner in human monocytes and human THP-1 cells. (A) Human monocytes were treated for various time points with 250 M BzATP as indicated in the figure, the cells were harvested, and cell lysates were resolved by SDS-PAGE. Human monocytes were also stimulated with varying concentrations of BzATP for 15 min, the cells were then harvested and lysed, and the proteins were electrophoresed by SDS-PAGE. The proteins were transferred to PVDF membranes and subjected to immunoblotting using anti-active ERK1/ERK2 antibodies as detailed in Materials and Methods. (B) Similarly, human monocytic THP-1 cells were treated with 100 M BzATP for times indicated in the figure, and in a separate experiment, THP-1 cells were treated with varying concentrations of BzATP for 10 min. The cells were harvested, and the lysates were subjected to SDS-PAGE. Protein content of the samples was analyzed by Micro-BCA protein assay. The proteins were transferred to PVDF membrane and immunoblotted using anti-active ERK1/ERK2 antibodies (C). THP-1 cells were treated with 100 M BzATP for the indicated times, the cells were harvested, and the lysates were electrophoresed by SDS-PAGE. The proteins were transferred to PVDF membrane and subjected to immunoblotting using an anti-active p38 antibody as detailed in Materials and Methods. The proteins on the membranes were detected using enhanced chemiluminescence. Similar results were obtained in experiments using monocytes from five different donors.
using gel mobility shift assays. Monocytes were pretreated with the P2X7 receptor antagonist KN-62 followed by treatment with BzATP for 30 min, and nuclear fractions were prepared (Fig. 6B). LPS was used as a positive control. BzATP induced the nuclear translocation of NF-B, and this activity was reduced substantially in monocytes pretreated with KN-62 (Fig. 6B). The nuclear translocation of NF-B stimulated by 100 ⌴ BzATP was abrogated by oATP at all time points measured (data not shown), further supporting the notion that the P2X7 receptor can mediate the degradation of IB␣ and the nuclear translocation of the transcription factor NF-B in monocytes.
Inflammatory mediator release Because the production of cytokines and inflammatory mediators by monocytes/macrophages is critical for their function, we investigated the capacity of the P2X7 receptor to regulate the generation of several biological mediators. The release of IL-1 is regulated by the P2X7 receptor in monocytes/macrophages; hence, to determine the functionality of this receptor in monocytes, THP-1 cells and primary human monocytes were treated with various concentrations of BzATP and/or LPS for 6 h (Fig. 7, A and B). A dose-dependent increase in the
Fig. 5. Inhibition of BzATP-induced activation of ERK1/ERK2 in human monocytes and THP-1 cells by P2X7 receptor antagonists. (A) Human monocytes were pretreated with various concentrations of the P2X7 receptor antagonist KN-62 for 30 min, followed by stimulation with BzATP (250 M) for 10 min. The cells were then harvested and lysed, and equal amounts of protein (50 g/lane) were resolved by SDS-PAGE and transferred to PVDF membranes. The membranes were immunoblotted with anti-active ERK1 and ERK2 antibodies as outlined in Materials and Methods. (B) Human THP-1 cells were pretreated for 2 h with oATP (B) or with KN-62 for 30 min (C) and were subsequently stimulated with BzATP or PMA for 10 min. Cells were harvested, and the lysates were resolved using SDS-PAGE. The proteins were transferred to PVDF membranes, and immunoblotting was performed using anti-active ERK1/ ERK2 antibodies as detailed in Materials and Methods. Equal protein loading was determined by stripping and reprobing the same membranes with an antibody that recognized total ERK1/ERK2. The proteins on the membrane were detected using enhanced chemiluminescence. These experiments were repeated at least three separate times with analogous results.
Aga et al. Functional P2X7 receptors in human peripheral monocytes
227
Fig. 6. BzATP induces the degradation of IB␣ in THP-1 cells and the nuclear translocation of the NF-B in human monocytes. (A) THP-1 cells were treated with 50 M or 100 M BzATP for 10 min or with 1 g/mL LPS for 15 min, the cells were harvested, and lysates were prepared as described in Materials and Methods. The lysates (equal amounts of protein) were subjected to SDS-PAGE, and the levels of IB␣ were immunodetected using IB␣-specific antibodies. (B) Human monocytes were pretreated with KN-62 for 30 min and were followed by stimulation with the P2X7 receptor agonist BzATP (100 M) for 30 min or with 1 g/mL LPS for 60 min. The LPS-treated cells were used as a positive control for determining the nuclear translocation of NF-B. Nuclear extracts were prepared as outlined in Materials and Methods. NF-B-specific DNA protein-binding activity in nuclear extracts was determined using an EMSA and analyzed by autoradiography. Similar results were obtained in three separate experiments.
production of IL-1 was observed in both of the cell types in response to LPS. It is interesting that BzATP by itself did not induce the release or synthesis of IL-1; however, an increase in the release of total immunodetectable IL-1 was observed in
these cells upon cotreatment with LPS and BzATP. As illustrated in Figure 7A, the release of IL-1 into the medium increased with increasing concentrations of LPS. Thus, the observations from the present studies indicate that the P2X7
Fig. 7. Effect of BzATP on the modulation of IL-1 production in human monocytes. (A) Freshly isolated human monocytes and (B) THP-1 cells (1⫻106) were cultured in 12-well plates treated with vehicle (V) or various concentrations of LPS (L; 100 and 1000 ng/mL) and/or 100 M BzATP (Bz; 50 or 100 M) for 6 h. The medium was assayed for the processed and immature forms of IL-1 according to the manufacturer’s protocol. The data are expressed as the mean (pg/mL) ⫾ SD of samples that were measured in triplicate.
228
Journal of Leukocyte Biology Volume 72, July 2002
http://www.jleukbio.org
receptor is functional in monocytes and is an important participant in the generation of inflammatory mediators. As an additional measurement of P2X7-mediated regulation of monocyte function, we evaluated the influence of BzATP on the expression of COX-2 and tissue factor, which are two key mediators present at the sites of tissue injury and inflammation. Monocytes were treated with BzATP and LPS at the concentrations indicated in Figure 8, and the expression of inducible COX-2 and tissue factor was assessed. In unstimulated monocytes, the basal level of inducible COX-2 protein and tissue factor mRNA was negligible (Fig. 8); however, treatment with BzATP resulted in a four- to sixfold increase in the induction of these two inflammation-associated endpoints. In these studies, monocytes were also treated with LPS as a positive control, and a substantial increase in COX-2 protein and tissue factor mRNA levels was observed (unpublished results). Because BzATP is a potent ligand for the P2X7 receptor, this observation is of interest because it points to an important role for the P2X7 receptor in regulating inflammation by the induction of COX-2.
DISCUSSION Recent studies have revealed that P2X7 receptor activation in immune cells plays an important role during inflammation, but can also result in cell damage and injury [22, 23, 48, 60, 61]. ATP is released at the site of injury primarily because of cell lysis, and hence, the role of purinergic receptors in regulating the inflammatory response is important to the pathophysiology of inflammation and may serve as a valuable target for modulating the immune response [6, 26, 62]. In the present study, we observed that freshly isolated human monocytes express functional P2X7 receptors and that multiple signaling pathways, such as those involving ERK1/ERK2, p38, and NF-B, are activated by an agonist of this purinergic receptor. In addition, stimulation of monocytes with the P2X7 receptor agonist BzATP modulated the release of the proinflammatory cytokine IL-1 and the expression of COX-2 protein and tissue factor mRNA. Signaling via ERK1/ERK2, p38, and NF-B has been implicated in regulating the expression/action of various cyto-
kines and mediators (nitric oxide, IL-1, and TNF-␣) during inflammation, and their excessive production can ultimately lead to cell and tissue damage [17, 19, 22, 23, 28, 42]. Although the biophysical characteristics of the P2X7 receptor have been studied more extensively [7, 63], few studies evaluate the physiological effects and mechanisms of signal transduction by this receptor. The distribution of the P2X7 receptor has largely been inferred by cell-permeability studies and RT-PCR analyses of cultured monocytes/macrophages, dendritic cells, and mast cells [43, 61, 64, 65]. Therefore, the present studies were undertaken to examine the potential, functional role of the P2X7 receptor in orchestrating pore formation, signal transduction, and inflammatory mediator production in freshly isolated human monocytes. Freshly isolated monocytes were previously reported to express low levels or immature forms of the P2X7 receptor [21, 43]. However, upon exposure to PMA or LPS and 1␣,25-dihydroxycholecalciferol (vitamin D3), they have been found to express the mature form of the receptor [14]. Very recent studies conducted on human monocytes, however, have indicated that approximately 70% of blood monocytes express the P2X7 receptor on the cell surface [66– 69], which are observations consistent with our findings described here. Furthermore, upon differentiation of monocytes into macrophages, no difference in levels of P2X7 mRNA was detected, although a tenfold increase in macrophage-surface P2X7 levels was observed [66]. In the present study, we have demonstrated the expression of the P2X7 receptor protein at the cell surface in monocytes by flow cytometry. Given the recent availability of P2X7 receptor antibodies suitable for immunoblotting, we have also substantiated that a large population of freshly isolated human monocytes and human monocytic THP-1 cells express immunodetectable P2X7 receptors. Earlier studies have indicated that freshly isolated monocytes, when stimulated with various concentrations of ATP in the standard saline buffer, do not take up substantial amounts of YO-PRO [18, 28, 43, 61, 66, 70], suggesting that P2X7 receptor-associated pore activity is absent in these cells. We conducted similar experiments and confirmed that little cellular accumulation of YO-PRO occurs in response to various concentrations of ATP (2 and 5 mM). However, studies conducted by Gudipaty et al. [66] reveal that monocytes could
Fig. 8. Effect of BzATP on the expression of inducible COX-2 and tissue factor in human monocytes. To determine the induction of COX-2, human monocytes from a single donor were treated with 100 M BzATP for 4 h. Whole cell lysates were prepared, and equal amounts of protein (⬃30 g/lane) were resolved by SDS-PAGE and transferred to PVDF membranes. The membranes were immunoblotted with anti-COX-2, and the bands were visualized using chemiluminescence. Densitometry was performed on the COX-2 immunoblots to quantify the relative levels of the enzyme following treatment with BzATP. To assess the expression of tissue factor, human monocytes were treated for 2 h with 100 M BzATP, total RNA was purified from samples, and quantitative RT-PCR analysis was performed using the TaqMan 5700 sequence detection system (Perkin Elmer). The results shown are representative of experiments performed on cells obtained from three separate donors. The data are expressed as the mean (pg/ mL) ⫾ SD of the samples measured in triplicate.
Aga et al. Functional P2X7 receptors in human peripheral monocytes
229
form a pore in response to ATP when the Na⫹ and Cl⫺ ions in normal saline were replaced by K⫹ and nonhalide ions. After extending these findings, we observed that monocytes can exhibit the cellular accumulation of YO-PRO in the standard saline buffer when the cells are treated with BzATP rather than ATP. One potential explanation for this difference is that BzATP is more resistant to degradation than ATP or that it is more effective at stabilizing an active conformation of P2X7. Moreover, as a control for the specificity of BzATP, monocytes were also stimulated with the P2Y2 receptor agonist, UTP. Treatment with UTP did not result in intracellular accumulation of YO-PRO, thereby making it unlikely that P2Y2 receptors mediate dye uptake or pore formation (data not shown). Numerous studies describe the importance of MAPKs and NF-B in the modulation of inflammatory mediator production in macrophages; however, little data exist about the roles of these effector molecules in the P2X7-mediated regulation of monocytes function. Thus, we first undertook studies to investigate the ability of the P2X7 receptor to stimulate MAPK signal transduction pathways in monocytes. Our results indicate that the MAPKs ERK1/ERK2 and p38 are stimulated strongly in monocytes in response to BzATP treatment, suggesting that the P2X7 receptor is functional with respect to signaling capacity in monocytes and that these pathways may play a role in nucleotide modulation of cytokine production. Secondly, the present study reveals that stimulation of human blood monocytes with BzATP promotes NF-B DNA binding activity and that the P2X7 receptor antagonist KN-62 substantially abolishes this activity. Because NF-B is essential for the inducible expression of genes associated with inflammation and because it is regulated by the degradation of an inhibitory protein I-B, it was also important to evaluate the influence of P2X7 activation on IB degradation. In human monocytes, treatment with BzATP induces the degradation of IB␣ (Fig. 6A). This result is of interest because P2X7 receptor stimulation has not been previously shown to result in the degradation of any IB proteins, although NF-B is activated in human macrophages [17, 22, 23]. In addition to these signaling pathways, we have shown that P2X7 agonists can also promote IL-1 release into the medium when the monocytes are cotreated with LPS. These results are also supported by other studies indicating the modulation of IL-1 production by BzATP [27, 28, 42, 71]. However, we have further investigated the function of the P2X7 receptor in human monocytes by evaluating the induction of COX-2, which is an important enzyme, in eicosanoid biosynthesis, induced in monocytes upon infection [72]. The P2Y nucleotide receptors have been shown to modulate COX-2 induction in macrophages [36], but there are no studies indicating the role of the P2X7 receptor in regulating this endpoint. It is noteworthy that our studies in human monocytes are the first to indicate that stimulation of the P2X7 receptor by concentrations of BzATP in the low micromolar range (100 M) can promote an increase in the expression of the enzyme COX-2. Another factor that plays a crucial role during sepsis in terms of initiating the coagulation cascade is tissue factor [40]. The current studies suggest an important role of the P2X7 receptor in the induction of tissue factor, which is a function of the P2X7 receptor that has not been shown previously. In the presence of the 230
Journal of Leukocyte Biology Volume 72, July 2002
inflammatory stimuli such as LPS, monocytes express tissue factor on their surface and thus may contribute to the coagulopathy of sepsis. An increase in tissue factor levels by monocytes in response to LPS has been observed as being dependent on the presence of CD14 [73]. Although there is a host of information on the role of monocytes in the expression of tissue factor, comparatively little is known about the role of the P2X7 receptor in this response. In the present study, we have demonstrated that BzATP treatment induced a three- to sixfold increase in the production of tissue factor mRNA, suggesting that the P2X7 receptor can regulate the generation of this coagulation factor. In addition, a consensus site for the transcription factor NF-B, which acts as a central mediator of human immune response and regulates the transcription of numerous cytokines, is contained in the promoter region of the genes for IL-1, COX-2, and tissue factor [29, 74, 75]. As BzATP can potently cause the degradation of IB␣ and the nuclear translocation of the transcription factor NF-B, it is likely that the P2X7 receptor can play a physiological role in modulating the expression of tissue factor and COX-2 via a NF-B-dependent pathway.
CONCLUSIONS Human monocytes and the human monocytic cell line THP-1 express functional cell-surface-associated P2X7 nucleotide receptors. In this regard, our studies illustrate that activation of the P2X7 receptor in monocytes results in pore formation as well as the activation of several members of the MAPK family (ERK1/ERK2 and p38), the increased degradation of IB␣, the enhanced nuclear translocation of the transcription factor NFB, and the increased production of COX-2, tissue factor, and IL-1. Because of the important role of the P2X7 receptor in immunomodulation of mediator release, the observation that there is a large population of monocytes expressing functional P2X7 receptors implicates this cell type as a potential key point of regulation and therapeutic control.
ACKNOWLEDGMENTS We thank Dr. William W. Busse for his generosity in providing the peripheral blood monocytes used in this study. We also thank Dr. Jyoti J. Watters for her suggestions and for reading the manuscript. This work was supported by the American Heart Association, Northland Affiliate CU24 (B. J. D.), and National Institutes of Health grants HL56396 and AI34891 (P. J. B.).
REFERENCES 1. Abbracchio, M. P., Burnstock, G. (1994) Purinoceptors: are there families of P2X and P2Y purinoceptors? Pharmacol. Ther. 64, 445– 475. 2. Burnstock, G. (1996) P2 purinoceptors: historical perspective and classification. Ciba Found. Symp. 198, 1–28, discussion 29 –34. 3. Chen, W. P., Chen, A., Lin, C. Y. (1995) In vitro effects of interleukins on human mesangial cells: implications for glomerulonephritis. J. Pathol. 175, 327–337.
http://www.jleukbio.org
4. Nicholas, A. P., Hokfelt, T., Pieribone, V. A. (1996) The distribution and significance of CNS adrenoceptors examined with in situ hybridization. Trends Pharmacol. Sci. 17, 245–255. 5. Buell, G., Michel, A. D., Lewis, C., Collo, G., Humphrey, P. P., Surprenant, A. (1996) P2X1 receptor activation in HL60 cells. Blood 87, 2659 –2664. 6. Di Virgilio, F. (1995) The P2Z purinoceptor: an intriguing role in immunity, inflammation and cell death. Immunol. Today 16, 524 –528. 7. Surprenant, A., Rassendren, F., Kawashima, E., North, R. A., Buell, G. (1996) The cytolytic P2Z receptor for extracellular ATP identified as a P2X receptor (P2X7). Science 272, 735–738. 8. Dubyak, G. R., el-Moatassim, C. (1993) Signal transduction via P2purinergic receptors for extracellular ATP and other nucleotides. Am. J. Physiol. 265, C577–C606. 9. van Furth, R. (1982) Current view on the mononuclear phagocyte system. Immunobiology 161, 178 –185. 10. Andreesen, R., Bross, K. J., Osterholz, J., Emmrich, F. (1986) Human macrophage maturation and heterogeneity: analysis with a newly generated set of monoclonal antibodies to differentiation antigens. Blood 67, 1257–1264. 11. Hashimoto, S., Suzuki, T., Dong, H. Y., Nagai, S., Yamazaki, N., Matsushima, K. (1999) Serial analysis of gene expression in human monocytederived dendritic cells. Blood 94, 845– 852. 12. Dubyak, G. R., Cowen, D. S. (1990) Activation of inositol phospholipidspecific phospholipase C by P2-purinergic receptors in human phagocytic leukocytes. Role of pertussis toxin-sensitive G proteins. Ann. N. Y. Acad. Sci. 603, 227–244, discussion 244 –225. 13. Humphreys, B. D., Dubyak, G. R. (1996) Induction of the P2z/P2X7 nucleotide receptor and associated phospholipase D activity by lipopolysaccharide and IFN-gamma in the human THP-1 monocytic cell line. J. Immunol. 157, 5627–5637. 14. Humphreys, B. D., Dubyak, G. R. (1998) Modulation of P2X7 nucleotide receptor expression by pro- and anti-inflammatory stimuli in THP-1 monocytes. J. Leukoc. Biol. 64, 265–273. 15. Wiley, J. S., Dubyak, G. R. (1989) Extracellular adenosine triphosphate increases cation permeability of chronic lymphocytic leukemic lymphocytes. Blood 73, 1316 –1323. 16. Ferrari, D., Stroh, C., Schulze-Osthoff, K. (1999) P2X7/P2Z purinoreceptor-mediated activation of transcription factor NFAT in microglial cells. J. Biol. Chem. 274, 13205–13210. 17. Ferrari, D., Chiozzi, P., Falzoni, S., Dal Susino, M., Collo, G., Buell, G., Di Virgilio, F. (1997) ATP-mediated cytotoxicity in microglial cells. Neuropharmacology 36, 1295–1301. 18. Humphreys, B. D., Rice, J., Kertesy, S. B., Dubyak, G. R. (2000) Stressactivated protein kinase/JNK activation and apoptotic induction by the macrophage P2X7 nucleotide receptor. J. Biol. Chem. 275, 26792–26798. 19. Hu, Y., Fisette, P. L., Denlinger, L. C., Guadarrama, A. G., Sommer, J. A., Proctor, R. A., Bertics, P. J. (1998) Purinergic receptor modulation of lipopolysaccharide signaling and inducible nitric-oxide synthase expression in RAW 264.7 macrophages. J. Biol. Chem. 273, 27170 –27175. 20. Garrington, T. P., Johnson, G. L. (1999) Organization and regulation of mitogen-activated protein kinase signaling pathways. Curr. Opin. Cell Biol. 11, 211–218. 21. Falzoni, S., Munerati, M., Ferrari, D., Spisani, S., Moretti, S., Di Virgilio, F. (1995) The purinergic P2Z receptor of human macrophage cells. Characterization and possible physiological role. J. Clin. Investig. 95, 1207–1216. 22. Ferrari, D., Chiozzi, P., Falzoni, S., Dal Susino, M., Melchiorri, L., Baricordi, O. R., Di Virgilio, F. (1997) Extracellular ATP triggers IL-1 beta release by activating the purinergic P2Z receptor of human macrophages. J. Immunol. 159, 1451–1458. 23. Ferrari, D., Chiozzi, P., Falzoni, S., Hanau, S., Di Virgilio, F. (1997) Purinergic modulation of interleukin-1 beta release from microglial cells stimulated with bacterial endotoxin. J. Exp. Med. 185, 579 –582. 24. Whiteside, S. T., Israel, A. (1997) I kappa B proteins: structure, function and regulation. Semin. Cancer Biol. 8, 75– 82. 25. Syrovets, T., Jendrach, M., Rohwedder, A., Schule, A., Simmet, T. (2001) Plasmin-induced expression of cytokines and tissue factor in human monocytes involves AP-1 and IKKbeta-mediated NF-kappaB activation. Blood 97, 3941–3950. 26. Perregaux, D., Gabel, C. A. (1994) Interleukin-1 beta maturation and release in response to ATP and nigericin. Evidence that potassium depletion mediated by these agents is a necessary and common feature of their activity. J. Biol. Chem. 269, 15195–15203. 27. Perregaux, D. G., McNiff, P., Laliberte, R., Conklyn, M., Gabel, C. A. (2000) ATP acts as an agonist to promote stimulus-induced secretion of IL-1 beta and IL-18 in human blood. J. Immunol. 165, 4615– 4623.
28. Mehta, V. B., Hart, J., Wewers, M. D. (2001) ATP-stimulated release of interleukin (IL)-1beta and IL-18 requires priming by lipopolysaccharide and is independent of caspase-1 cleavage. J. Biol. Chem. 276, 3820 – 3826. 29. Dubois, R. N., Abramson, S. B., Crofford, L., Gupta, R. A., Simon, L. S., Van De Putte, L. B., Lipsky, P. E. (1998) Cyclooxygenase in biology and disease. FASEB J. 12, 1063–1073. 30. Neary, J. T., Rathbone, M. P., Cattabeni, F., Abbracchio, M. P., Burnstock, G. (1996) Trophic actions of extracellular nucleotides and nucleosides on glial and neuronal cells. Trends Neurosci. 19, 13–18. 31. Penglis, P. S., Cleland, L. G., Demasi, M., Caughey, G. E., James, M. J. (2000) Differential regulation of prostaglandin E2 and thromboxane A2 production in human monocytes: implications for the use of cyclooxygenase inhibitors. J. Immunol. 165, 1605–1611. 32. Penglis, P. S., James, M. J., Cleland, L. G. (2001) Cyclooxygenase inhibitors: any reservations? Intern. Med. J. 31, 37– 41. 33. Kwon, G., Xu, G., Marshall, C. A., McDaniel, M. L. (1999) Tumor necrosis factor alpha-induced pancreatic beta-cell insulin resistance is mediated by nitric oxide and prevented by 15-deoxy-delta12,14-prostaglandin J2 and aminoguanidine. A role for peroxisome proliferator-activated receptor gamma activation and inos expression. J. Biol. Chem. 274, 18702–18708. 34. Bolego, C., Ceruti, S., Brambilla, R., Puglisi, L., Cattabeni, F., Burnstock, G., Abbracchio, M. P. (1997) Characterization of the signalling pathways involved in ATP and basic fibroblast growth factor-induced astrogliosis. Br. J. Pharmacol. 121, 1692–1699. 35. Crofford, L. J. (1997) COX-1 and COX-2 tissue expression: implications and predictions. J. Rheumatol. 24 (Suppl. 49), 15–19. 36. Brambilla, R., Burnstock, G., Bonazzi, A., Ceruti, S., Cattabeni, F., Abbracchio, M. P. (1999) Cyclo-oxygenase-2 mediates P2Y receptorinduced reactive astrogliosis. Br. J. Pharmacol. 126, 563–567. 37. Balboa, M. A., Balsinde, J., Johnson, C. A., Dennis, E. A. (1999) Regulation of arachidonic acid mobilization in lipopolysaccharide-activated P388D(1) macrophages by adenosine triphosphate. J. Biol. Chem. 274, 36764 –36768. 38. Shinohara, H., Balboa, M. A., Johnson, C. A., Balsinde, J., Dennis, E. A. (1999) Regulation of delayed prostaglandin production in activated P388D1 macrophages by group IV cytosolic and group V secretory phospholipase A2s. J. Biol. Chem. 274, 12263–12268. 39. Lwaleed, B. A., Bass, P. S., Cooper, A. J. (2001) The biology and tumour-related properties of monocyte tissue factor. J. Pathol. 193, 3–12. 40. Hamik, A., Setiadi, H., Bu, G., McEver, R. P., Morrissey, J. H. (1999) Down-regulation of monocyte tissue factor mediated by tissue factor pathway inhibitor and the low density lipoprotein receptor-related protein. J. Biol. Chem. 274, 4962– 4969. 41. Guha, A., Bach, R., Konigsberg, W., Nemerson, Y. (1986) Affinity purification of human tissue factor: interaction of factor VII and tissue factor in detergent micelles. Proc. Natl. Acad. Sci. USA 83, 299 –302. 42. Grahames, C. B., Michel, A. D., Chessell, I. P., Humphrey, P. P. (1999) Pharmacological characterization of ATP- and LPS-induced IL-1beta release in human monocytes. Br. J. Pharmacol. 127, 1915–1921. 43. Hickman, S. E., el Khoury, J., Greenberg, S., Schieren, I., Silverstein, S. C. (1994) P2Z adenosine triphosphate receptor activity in cultured human monocyte-derived macrophages. Blood 84, 2452–2456. 44. Robinson, T. M., Manley, P. A., Sims, P. A., Albrecht, R., Darien, B. J. (1999) Cytokine and eicosanoid response by cultured human monocytes exposed to titanium particulate debris. Microsc. Microanal. 5, 344 –351. 45. Hansen, M. B., Nielsen, S. E., Berg, K. (1989) Re-examination and further development of a precise and rapid dye method for measuring cell growth/ cell kill. J. Immunol. Methods 119, 203–210. 46. Denizot, F., Lang, R. (1986) Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J. Immunol. Methods 89, 271–277. 47. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227, 680 – 685. 48. Denlinger, L. C., Garis, K. A., Sommer, J. A., Guadarrama, A. G., Proctor, R. A., Bertics, P. J. (1998) Nuclear translocation of NF-kappaB in lipopolysaccharide-treated macrophages fails to correspond to endotoxicity: evidence suggesting a requirement for a gamma interferon-like signal. Infect. Immun. 66, 1638 –1647. 49. Lee, S. L., Wang, Y., Milbrandt, J. (1996) Unimpaired macrophage differentiation and activation in mice lacking the zinc finger transplantation factor NGFI-A (EGR1). Mol. Cell. Biol. 16, 4566 – 4572. 50. Morrison, T. B., Weis, J. J., Wittwer, C. T. (1998) Quantification of low-copy transcripts by continuous SYBR green I monitoring during amplification. Biotechniques 24, 954 –958, 960, 962. 51. Wittwer, C. T., Herrmann, M. G., Moss, A. A., Rasmussen, R. P. (1997) Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 22, 130 –131, 134 –138.
Aga et al. Functional P2X7 receptors in human peripheral monocytes
231
52. Michel, A. D., Chessell, I. P., Humphrey, P. P. (1999) Ionic effects on human recombinant P2X7 receptor function. Naunyn-Schmiedeberg’s Arch. Pharmacol. 359, 102–109. 53. Koshimizu, T. A., Tomic, M., Wong, A. O., Zivadinovic, D., Stojilkovic, S. S. (2000) Characterization of purinergic receptors and receptor-channels expressed in anterior pituitary cells. Endocrinology 141, 4091– 4099. 54. Wiley, J. S., Gargett, C. E., Zhang, W., Snook, M. B., Jamieson, G. P. (1998) Partial agonists and antagonists reveal a second permeability state of human lymphocyte P2Z/P2X7 channel. Am. J. Physiol. 275, C1224 – C1231. 55. Murgia, M., Hanau, S., Pizzo, P., Rippa, M., Di Virgilio, F. (1993) Oxidized ATP. An irreversible inhibitor of the macrophage purinergic P2Z receptor. J. Biol. Chem. 268, 8199 – 8203. 56. Hibell, A. D., Kidd, E. J., Chessell, I. P., Humphrey, P. P., Michel, A. D. (2000) Apparent species differences in the kinetic properties of P2X(7) receptors. Br. J. Pharmacol. 130, 167–173. 57. Gargett, C. E., Wiley, J. S. (1997) The isoquinoline derivative KN-62 a potent antagonist of the P2Z-receptor of human lymphocytes. Br. J. Pharmacol. 120, 1483–1490. 58. Dubyak, G. R., Clifford, E. E., Humphreys, B. D., Kertesy, S. B., Martin, K. A. (1996) Expression of muliple ATP receptor subtypes during the differentiation and inflammatory activation of myeloid leukocytes. Drug Dev. Res. 39, 269 –278. 59. Martin, K. A., Kertesy, S. B., Dubyak, G. R. (1997) Down-regulation of P2U-purinergic nucleotide receptor messenger RNA expression during in vitro differentiation of human myeloid leukocytes by phorbol esters or inflammatory activators. Mol. Pharmacol. 51, 97–108. 60. Di Virgilio, F., Mutini, C., Chiozzi, P., Falzoni, S., Di Susino, M., Sanz, J. M., Ferrari, D. (1996) A purinergic hypothesis for immunomodulation. It. J. Biochem. 45, 195–203. 61. Di Virgilio, F., Chiozzi, P., Ferrari, D., Falzoni, S., Sanz, J. M., Morelli, A., Torboli, M., Bolognesi, G., Baricordi, O. R. (2001) Nucleotide receptors: an emerging family of regulatory molecules in blood cells. Blood 97, 587– 600. 62. Ferrari, D., Villalba, M., Chiozzi, P., Falzoni, S., Ricciardi-Castagnoli, P., Di Virgilio, F. (1996) Mouse microglial cells express a plasma membrane pore gated by extracellular ATP. J. Immunol. 156, 1531–1539. 63. Rassendren, F., Buell, G., Newbolt, A., North, R. A., Surprenant, A. (1997) Identification of amino acid residues contributing to the pore of a P2X receptor. EMBO J. 16, 3446 –3454. 64. Coutinho-Silva, R., Persechini, P. M. (1997) P2Z purinoceptor-associated pores induced by extracellular ATP in macrophages and J774 cells. Am. J. Physiol. 273, C1793–C1800.
232
Journal of Leukocyte Biology Volume 72, July 2002
65. Coutinho-Silva, R., Persechini, P. M., Bisaggio, R. D., Perfettini, J. L., Neto, A. C., Kanellopoulos, J. M., Motta-Ly, I., Dautry-Varsat, A., Ojcius, D. M. (1999) P2Z/P2X7 receptor-dependent apoptosis of dendritic cells. Am. J. Physiol. 276, C1139 –C1147. 66. Gudipaty, L., Humphreys, B. D., Buell, G., Dubyak, G. R. (2001) Regulation of P2X(7) nucleotide receptor function in human monocytes by extracellular ions and receptor density. Am. J. Physiol. Cell Physiol. 280, C943–C953. 67. Gu, B. J., Zhang, W., Worthington, R. A., Sluyter, R., Dao-Ung, P., Petrou, S., Barden, J. A., Wiley, J. S. (2001) A Glu-496 to Ala polymorphism leads to loss of function of the human P2X7 receptor. J. Biol. Chem. 276, 11135–11142. 68. Buell, G., Chessell, I. P., Michel, A. D., Collo, G., Salazzo, M., Herren, S., Gretener, D., Grahames, C., Kaur, R., Kosco-Vilbois, M. H., Humphrey, P. P. (1998) Blockade of human P2X7 receptor function with a monoclonal antibody. Blood 92, 3521–3528. 69. Buell, G. N., Talabot, F., Gos, A., Lorenz, J., Lai, E., Morris, M. A., Antonarakis, S. E. (1998) Gene structure and chromosomal localization of the human P2X7 receptor. Receptors Channels 5, 347–354. 70. Blanchard, D. K., McMillen, S., Djeu, J. Y. (1991) IFN-gamma enhances sensitivity of human macrophages to extracellular ATP-mediated lysis. J. Immunol. 147, 2579 –2585. 71. Griffiths, R. J., Stam, E. J., Downs, J. T., Otterness, I. G. (1995) ATP induces the release of IL-1 from LPS-primed cells in vivo. J. Immunol. 154, 2821–2828. 72. Mene, P., Pecci, G., Cinotti, G. A., Pugliese, G., Pricci, F., Pugliese, F. (1998) Eicosanoid synthesis in peripheral blood monocytes: a marker of disease activity in lupus nephritis. Am. J. Kidney Dis. 32, 778 –784. 73. Meszaros, K., Aberle, S., Dedrick, R., Machovich, R., Horwitz, A., Birr, C., Theofan, G., Parent, J. B. (1994) Monocyte tissue factor induction by lipopolysaccharide (LPS): dependence on LPS-binding protein and CD14, and inhibition by a recombinant fragment of bactericidal/permeabilityincreasing protein. Blood 83, 2516 –2525. 74. Barnes, P. J., Karin, M. (1997) Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N. Engl. J. Med. 336, 1066 –1071. 75. Holschermann, H., Rascher, C., Oelschlager, C., Stapfer, G., Langenstein, A., Staubitz, A., Maus, U., Tillmanns, H., Bang, H., Haberbosch, W. (2001) Opposite regulation of tissue factor expression by calcineurin in monocytes and endothelial cells. J. Immunol. 166, 7112–7120.
http://www.jleukbio.org
