Molecular and cellular characterization of

Molecular and cellular characterization of mesenchymal progenitors for skeletal biomedical devices I. Shur,1,2 M. Zilberman,2 S. Einav,2 D. Benayahu1 1 Department of Cell and Developmental Biology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv 69978, Israel 2 Department of Biomedical Engineering, Faculty of Engineering, Tel-Aviv University, Tel-Aviv 69978, Israel Received 12 September 2005; revised 12 December 2005; accepted 13 December 2005 Published online 30 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/jbm.a.30693 Abstract: Mesenchymal cells are successfully used to create cell-loaded devices in tissue engineering. Molecular properties of the cells and interaction with polymer scaffolds regulate the development of desired tissues. The present study compared the molecular markers in mesenchymal pleuripotent C3H10T1/2 and osteogenic MBA-15 cells. The cells express transcription factors (TF) of chondro-ostegenic pathway (cbfa-1 and c-fos) and MyoD - TF of muscle differentiation pathway, but not myogenin. Analyzed cells expressed receptors for glucocorticoids, growth hormone, prolactin, and PTH, which indicates their potential responsiveness to systemic signals. Analysis of mRNA encoding for receptors of TGF␤, TNF, and various interleukins revealed differential expression of IL-2r and TGF␤-1r receptors, which were expressed by MBA-15 but not by C3H10T1/2 cells. Expression of functional genes indicates differences in the stages of cell differentiation: ALK was

present in MBA-15 only, while both cell types expressed collagen-I. Furthermore, we evaluated the expression of adhesion proteins that mediate cell–polymer interactions by flow cytometry analysis. Cell adhesion molecules (CAMs) analyzed were integrin␣-M (CD11b), selectin-E (CD62E), and PECAM-1 (CD31), which have shown differential expression on cells cultured on plastic, poly(l-lactic acid) (PLLA) or poly(dl-lactide-glycolide acid) (PDLGA) polymer films. Detailed molecular characterization of mesenchymal cells will enable optimization of culture conditions for successful creation of implantable cell-loaded constructs. © 2006 Wiley Periodicals, Inc. J Biomed Mater Res 77A: 832– 838, 2006

INTRODUCTION

Various polymers were tested for their ability to support cell attachment with subsequent effect on cell proliferation and differentiation. It is a challenge to generate the sufficient numbers of a single cell type to orchestrate the assembly of multiple cell types and to maintain stable cell phenotype. The signals in the cellular microenvironment lead to cell differentiation and morphogenesis.1,2 Growth and differentiation of many cell types is regulated by insoluble and soluble extracellular matrix components, as well as cell– cell and cell–matrix interactions.3 The interactions are controlled by CAMs, which mediate signals regulating intracellular processes. Bioresorbable polymers such as poly(l-lactic acid) (PLLA) are used in a wide range of clinical applications for orthopedic and cardiovascular surgery, and drug delivering implants.4,5 It is also used for tissue engineering applications where high mechanical strength and toughness are required.6,7 Poly(dl-lacticglycolic acid) (PDLGA) are the amorphous polymers with different inherent viscosities, which degrade much faster than PLLA.7 We used these polymers to

Bioengineering systems are composed of scaffolds loaded with cells that are implanted for tissue formation. Mesenchymal cells are used in various applications with the main interest paid to developing possibilities for skeletal tissue repair and orthopedics. Interaction between cells and scaffolds is important for the creation of effective tissue-engineered device. The significant features of cells proposed to become biomedical devices include tightly controlled cell function, cytoskeleton organization, cell–matrix interactions, and cell adhesion molecules (CAM) mediated signaling. Manipulating the cells onto the polymers affect their biological characteristics and spreading, finally resulting in the development of particular phenotypes. Correspondence to: D. Benayahu; email: dafnab@post. tau.ac.il © 2006 Wiley Periodicals, Inc.

Key words: adhesion; biopolymers; mesenchymal cells; gene expression

CHARACTERIZATION OF MESENCHYMAL PROGENITORS FOR BIOMEDICAL DEVICES

study their interactions with mesenchymal cells. C3H10T1/2, embryonic pleuripotent mesenchymal cells, and osteoprogenitor stroma derived MBA–15 cells were analyzed for molecular expression profile to evaluate their potential to become model systems for in vitro analysis of skeletal differentiation. In this study, we compared the molecular properties, CAM expression and interactions of mesenchymal pleuripotent C3H10T1/2 and osteogenic bone marrow stromaderived MBA-15 cells with polymer scaffolds.

MATERIALS AND METHODS Cells C3H10T1/2 mouse embryonic cell line8 and MBA-15 osteoprogenitor cell line9,10 were cultured in growth medium Dulbecco’s modified essential medium (DMEM) (Gibco, NY) with the addition of 10% heat-inactivated fetal calf serum (FCS) (Sigma, St. Louis, MO), 1% glutamine, and 1% antibiotics and maintained in 5% CO2 at 37°C. About 5 ⫻ 104 cells/mL were plated on the various polymer films and 100-mm plastic tissue culture dishes (Corning, NY) for 48 h, then analyzed for morphology by scanning electron microscopy (SEM) and for cell surface antigen expression by fluorescence activated cell sorting (FACS).

Scanning electron microscopy (SEM) analysis The surfaces of the polymer films with or without cells were observed using a scanning electron microscope (SEM, Jeol JEM 6400) at an accelerating voltage of 5 kV. Sample preparation included fixation in 3% glutaraldehyde (pH 7.4) for 4 h, immersion in PBS containing 5.4% sucrose for overnight, dehydration with a graded ethanol series, and drying. The SEM samples were Au/Pd sputtered prior to observation.

833

compared the antigen expression for cells cultured on cultured dish (control) to those cultured on the various polymers.

Molecular analysis RNA was extracted from cells, using EZ RNA kit (Biological Industries, Beth haEmek, Israel) and reverse transcribed to cDNA, using avian myeloblastosis virus reverse transcriptase (AMV-RT) (Takara Shuzo Co., Japan) and oligo-dT. Gene expression analysis applied specific primers (Table 1). The integrity of RNA, the efficiency of the RT reaction, and the quality of cDNA subjected to the RT-PCR amplification were normalized by the level of glyceraldehyde-3-phosphate dehydrogenase (G3PDH) (Clontech, Palo Alto, CA). Semiquantitative PCR performed with SRP polymerase (Bertec, Taiwan), PCR products were separated by electrophoresis in 1% agarose gels (SeaKem GTG, FMC, Rockland, ME) in Tris Borate EDTA (TBE) buffer. The amplified DNA fragments were stained by ethidium bromide, and their optical density was measured using bio imaging system, BIS 202D and was analyzed using “TINA” software. PCR amplification was performed at least twice.

Materials and film preparation Bioresorbable films were made of poly(l-lactic acid) (PLLA), RESOMER L210 (inherent viscosity ⫽ 3.6 dL/g) (Boehringer Ingelheim, Germany) and poly(dl-lactic-co-glycolic acid) (PDLGA), (Absorbable Polymer Technologies, Pelham, AL) 0.24 dL/g, as previously described.10 Polymer films (0.12– 0.15 mm thickness) were prepared by a threestep solution processing method: (a) polymer dissolution in chloroform at room temperature (one gram of polymer was added to 50 mL of chloroform); (b) solution casting into a glass Petri dish and solvent drying under atmospheric pressure at room temperature (an average drying rate of approximately 3 mL/h was used); and (c) isothermal heat treatment at 40°C for 1 h in a vacuum oven. The films were stored in a desiccator with anhydrous CaSO4 under vacuum until use.

Fluorescence activated cell sorting (FACS) Surface antigens were analyzed on cells seeded on the polymers and conventional culture dishes. Cells were EDTA released into single cell suspensions and stained with primary antibodies to surface markers: selectin-E CD-62E (Pharmingen, Franklin Lakes, NJ), integrin␣M CD11b (Sigma, St. Louis, MO), or PECAM-1 CD31 (Serotec, Raleigh, NC). Cells were resuspended in PBS containing 1% FCS (blocking buffer) and incubated for 30 min on ice in 50 ␮L of first antibody solution (1:150). After washing, cells were stained with secondary FITC-labeled antibody (1:200) (Jackson ImmunoResearch Laboratories, West Grove, PA) and 1 ⫻ 104 cells were collected for each sample. Statistical analysis was performed using Becton Dickinson software, and the results were considered significant with p⬍0.05. We

RESULTS C3H10T1/2 mouse mesenchymal pluripotent embryonic cell line and MBA-15 osteoprogenitors serve as models to study mesenchymal differentiation. The first part of the study analyzed gene expression of transcription factors (TF), receptors for cytokines, hormones, and functional structural genes. Analyzed TF are known for their role in control of cells differentiation: c-fos, cbfa-1, and MyoD. Cbfa-1 and c-fos, the key regulators in the chondro-ostegenic pathway, are expressed in both cell types. MyoD, which play a role in myogenic comittement was expressed, while myoJournal of Biomedical Materials Research Part A DOI 10.1002/jbm.a

834

SHUR ET AL.

TABLE I Primers Used for PCR Analysis Primers

Sequence

Expected size

G3PDH-F G3PDH-R

ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA

445 bp

Transcription factors CBFA1-F CBFA1-R c-Fos-F c-Fos-R MyoD-F MyoD-R

CCGAAATGCCTCCGCTGTTATG GGATTTGTGAAGACTGTTATGGT GAGCTGACAGATACACTCCAAGCG CAGTCTGCTGCATAGAAGGAACCG CAAGGTGGAGATCCTGCG AGAGCAGTTGGAGCGCGG

120 bp

Receptors TNF␣R1-F TNF␣R2-R TNF␣R2-F TNF␣R2-R TGF␤R1-F TGF␤R1-R TGF␤R2-F TGF␤R2-R IL1r-F IL1r-R IL2r-F IL2r-R IL6r-F IL6r-R

GCCCGAAGTCTACTCCATCATTTGTAGGG CATCCACCACAGCATACAGAATCGCAAGG ATACTATGACAGGAAGGCTCAGATGTGC CCCTTGGTACTTTGTTCAATAATGGGGG TTGCCAGGACCATTGTGTTAC GGGCCATGTACCTTTTAGTGC GCCAACAACATCAACCACA AATCCTTCACTTCTCCCACAG GTGCTGACAAGGCTTCGAGTAG TGGTTTTAAAGGGCGGTATCG TTCAAGCTCCACTTCAAGCTCTACAGCGGAAG GACAGAAGGCTATCCATCTCCTCAGAAAGTCC AATGCGTCATCCATGATGCCTTGCGAGG GTGGTTTACGGTATTGTCAGACCCAGAGC

371 bp

Glucocorticoid Receptor GR-F GR-R PTHr-F PTHr-R

ACCACAGACCAAAGCACCTT AAGGGATGCTGTATTCATGTCA ACTGCACGCGCAACTACAT TCCCTGGAAGGAGTTGAAGA

Growth Hormone receptor GrHr-F GrHr-R

TCACCACAGAAAGCCTTACC TTTTGTTCAGTTGGTCTGTGC

210 bp

Prolactin receptor PRLr-F PRLr-R

AATCCTTTTATTTTTGGCCC AGGAAACATTCACCTGCT

714 bp

Functional genes Alkaline Phosphatase ALK-F ALK-R Myogenin-F Myogenin-R Collagen I-F Collagen I-R

ATGTCTCCATGGTAGATTACGCTC GGGGAGCTGGCTGTCCATTGCGGGC GCAGGCTCAAGAAAGTGAATG ATCTCAGTTGGGCATGGTTT TCTCCACTCTTCTAGTTCCCT TTGGGTCATTTCCACATGC

330 bp

430 bp 183 bp

636 bp 540 bp 715 bp 365 bp 413 bp 494 bp 467 bp

genin, a marker for differentiated muscle, was absent in both cell lines (see Fig. 1 (A) and (B)). To identify signals that affect tissue function we analyzed mRNA encoding for receptors of systemic hormones and cytokines including receptors for TGF␤, TNF␣, and interleukins. We identified mRNA for TGF-␤ isoforms (TGF␤-r1 and TGF␤-r2), TNF-␣ isoforms (TNF␣-r1 and TNF␣-r2), and interleukins 1, 2, and 6 (IL-1r, IL-2r, and IL-6r) (see Fig. 1 and Table I). All analyzed receptors were detected in MBA-15 cells, while C3H10T1/2 cells did not express IL-2r and TGF␤-1r. Both cell types expressed the receptors for glucocorticoids, growth hormone, prolactin, and PTH, Journal of Biomedical Materials Research Part A DOI 10.1002/jbm.a

709 bp

403 bp 268 bp

indicating their responsiveness to systemic signals. Analysis of functional genes such as collagen-I and ALK proposed the differences in the stages of differentiation. ALK was present in MBA-15 only suggesting that these cells are at the more advanced stage of osteogenic maturation. In addition to the molecular analysis, we quantified the expression of three adhesion molecules: integrin␣-M (CD11b), selectin-E (CD62E), and PECAM-1 (CD-31). Cells were released by EDTA buffer from cultures to maintain their cells surface antigens quantified by FACS (Fig. 2), comparing between C3H10T1/2 and MBA-15 cells. The basal level for


835

Figure 1. Molecular analysis of MBA-15 and C3H10T1/2 cells. RT-PCR was used to follow expression of functional genes in both cells lines. Analyzed genes are listed in the table (A) and the messages that were differentially expressed are presented in (B).

CD31 expression was similar for both cells (26% for C3H10T1/2 and 36% MBA-15), lower levels of CD11b were quantified for MBA-15 (7%) and C3H10T1/2

Figure 2. FACS analysis of CD31, CD11b, and CD62E cell surface antigen expression by C3H10T1/2 and MBA-15 cells. y axes present percent of positive cells of each antigen expression for C3H10T1/2 cells (gray) and MBA-15 cells (white). The bars are calculated as mean values from at least three experiments (A). FACS analysis of three antigens expressed by C3H10T1/2 (B) and MBA-15 (C) cells presented as dot plots for x axes corresponds to fluorescent intensity, axes y represents cell size.

(24%). CD62E was expressed by MBA-15 (6%) but not by C3H10T1/2 cells (Fig. 2). Interaction between cells and scaffolds was investigated for C3H10T1/2 cells grown on the various polymers and followed for mor-

Figure 3. SEM micrographs of C3H10T1/2 cultured on PLLA (A–D) and PDGLA (E–F) polymer films at various magnifications. Arrows point on the cell processes that bridge over the polymer surface pores or extensions of the cultured cells. Figure magnifications are (A) ⫻200; (B), (E) ⫻1000 and (C), (D), (F) ⫻5000. These cells analyzed by FACS for expression of CD31, CD11b, and CD62E. FACS histogram (G) presents intensity of fluorescent staining (axes x) versus cell number (axes y). CD31 and CD11b antigens expressed by the cells on PLLA films are presented on red and brown histograms, respectively and on PDGLA films – on green and blue lines. CD62E was expressed at the same level as in blank (black line).

Journal of Biomedical Materials Research Part A DOI 10.1002/jbm.a

836

SHUR ET AL.

phology by SEM (Fig. 3A). We used bioresorbable polymers and earlier characterized their morphological properties and degradation rate.10 PLLA is a semicrystalline polymer, which exhibited a relatively rough surface because of its spherolitic structure; PDLGA is a relatively smooth amorphous polymer which degrades faster forming holes. Figure 3 demonstrates cells grown on these polymers for 48 h and were analyzed for their interaction with these substrates by morphology and CAM expression. Cells cultured on both PDLGA and PLLA films appeared with spread cell body, and overlapping processes extended over spherolites of PLLA [Fig. 3(A–D)] and over the holes of the PDLGA [Fig. 3(E,F)]. The interaction between cells and scaffolds were analyzed to check whether the polymer affected the profile of the cell surface markers expression [Fig. 3(G)]. Cells were analyzed following growth on polymers, the measurement of adhesion molecules on various matrices did not reveal any effect on the antigen expression.

DISCUSSION Renewal of tissues in vivo relies on stem cells with high proliferative capacity, which can be expanded in culture and subsequently stimulated to differentiate in the desired pathway.11–14 Stem cells differentiation through distinct maturational stages into specific characterized cells involves coordination and activation of different sets of genes. Consequently, evaluation of the expression of molecular markers is necessary to follow the stages of these transient cells and their commitment to a particular phenotype. The two cell lines C3H10T1/2 and MBA-15 serve as experimental models for mesenchymal differentiation. C3H10T1/2 are pluripotent mesenchymal cells capable to undergo differentiation into bone, cartilage, muscle, and adipogenic cells.8 MBA-15 cells are osteoprogenitors capable to undergo differentiation into mature bone cells, previously reported for their bone forming capacity in vivo and ability to form 3D tissue that undergo mineralization in vitro.9,15,16 In this study, we explored expression of genes known to be important in the mesenchymal cell differentiation and function. We analyzed mRNA expression for genes encoding for transcription factors, receptors of hormones, and cytokines, as well as genes for the functional bone-related proteins in both cell lines. We compared the expression of transcription factors CBFA1, MyoD, and cFos that control discrete differentiation steps. CBFA1 and cFos serve both as the earliest transcriptional regulators of osteoblast differentiation and in bone formation by already differentiated osteoblast.17,18 We demonstrated that both cell lines express CBFA1 and c-Fos transcription facJournal of Biomedical Materials Research Part A DOI 10.1002/jbm.a

tors. In addition, the expression of MyoD, the factor important for stem cells commitment to muscle differentiation,19 was detected suggesting the multipotency of cells. Myogenin is expressed in cells committed to the myogenic differentiation19 and this explains its absence in the analyzed cells. The proliferation and differentiation of mesenchymal cells are regulated by hormones and growth factors.20 –27 The molecular analysis highlights the potential of mesenchymal cells responsiveness; both cell lines express glucocorticoid receptor (GR) that mediates glucocorticoid signaling in cells, being of prime importance in skeletal cells differentiation and in bone remodeling. We detected the expression of the receptors for the growth hormone, prolactin, and PTH in these cells. The growth hormone (GH) receptor is found on the cell surface of osteoblasts; GH has profound effects on linear bone growth in vivo and stimulates proliferation, differentiation, and extracellular matrix production in osteoblast-like cell lines in vitro.28 The role of prolactin receptor (PRL-r) was studied in PRL-r deficient mice which show a delayed ossification of the fetal calvaria and reduced bone formation in young animals.29,30 The PTH influences bone formation in various ways, and PTH/PTHrP receptor is at the center of one of many signaling systems controlling bone formation.31 Cytokines are important in the local regulation of mesenchymal cells differentiation; differential expression of mRNA for cytokines is used as parameter of cells’ function that coordinates bone remodeling by coupling bone formation to bone resorption.23,27,32,33 We analyzed genes that encode the receptors for different cytokines (IL-1, IL-2, IL-6, IL-11, TGF␤, and TNF␣) implicated with the functions controlling cell’s differentiation. Members of transforming growth factor beta (TGF␤) family, TGF␤1 and 2, play a role in osteoblast activity and osteoblast maturation.34 TGF␤1 was demonstrated at higher levels in trabecular bonederived osteoblasts than in less mature bone marrow stromal cells.35 In agreement with this data, we detected TGF␤1 receptor in osteogenic committed MBA-15 but not in pluripotent C3H10T1/2 cells. IL-1, IL-2, IL-6, IL-11, TNF␣1, and 2 are regulators of osteoclasts activity in the local microenvironment and are implicated in several pathological states, such as osteoporosis or lytic bone lesions. Receptors of these cytokines, except IL-2r, were expressed in both cell lines. Interleukin-2 (IL-2) modulates T-cell activation and cellular immune responses through binding to its corresponding cell surface receptor.34,36 Thus, the absence of IL-2 receptor on the C3H10T1/2 cells is explained by the immature state of these embryonic cells. ALK is expressed in osteoblasts during deposition of matrix and mineralization;8 it serves as a marker of differentiated osteoblasts16 in the areas of bone re-


modeling. We detected its expression in committed osteogenic MBA-15 cells, but not in uncommitted pluripotent C3H10T1/2 cells. ECM proteins have been correlated with osteogenic activity and bone mineralization, underscoring their potential utility for defining stages of osteogenic differentiation.16 We tested the expression of gene for structural protein collagen I, which has a role in the differentiation of osteoblasts34,37,38 and is expressed in both mouse mesenchymal stem cells. Analysis of interactions of functionally active cells within supportive bio-scaffolds is important for the regulation of cell expansion in developing cell-loaded biopolymer constructs for the tissue engineering. Successful engraftment of tissue-engineered bone device in vivo is affected by interaction between transplanted cells and host endothelial cells and immune system. Thus in the present study, we cultured mesenchymal cells on different biodegradable polymers to analyze how the properties of the polymers based on their degradation rate, chemical composition, and surface topography affect cell growth and expression of cell adhesion markers in vitro. We followed the expression of markers shared by the mesenchymal cells and endothelial and/or cells of immune system. Herein, we compared the expression of three CAMs: CD62E, CD11b, and CD31 on C3H10T1/2 and MBA-15 cells.10 CD31 is a CAM involved in amplification of integrinmediated cell adhesion, maintenance of the adherent junction integrity, organization of the intermediate filament cytoskeleton, regulation of transcriptional activities, and control of apoptotic events.39,40 The CD31 facilitates the interaction of osteoprogenitors with other cells, such as endothelial cells by homophilic interaction between CD31–CD31 and the heterophilic interaction between CD31–␣␤3 integrin.41 The level for CD31 was similar for both C3H10T1/2 and MBA-15 cells. Integrins cooperate with other cell surface receptors to recruit signaling molecules to the sites of cell– cell or cell–matrix adhesions.42 The initial adhesion of osteoblasts on implant surfaces requires the contribution of integrins, acting as a primary mechanism regulating cell–matrix interactions.43,44 CD11b is an integrin contribute to the intracellular of bone marrow and stromal cells in the immune cell activation.45 We detected four times higher level of CD11b by C3H10T1/2 cells than MBA-15, while selectin-E (CD62E) was absent on C3H10T1/2 cells. CD62E adhesion molecule play a role in initial dynamic cell– cell interaction.43,46 Increased bone destruction reported in the selectin E/P knockout mice points on an important role of selectins in the bone cell biology.47 CD62E is expressed by MBA-15 cells and increases significantly on the cells interacting with PDLGA films.10 The morphology of C3H10T1/2 and cells attachment on different polymers was analyzed by SEM after 48 h, the cells showed spreading with no distin-

837

guished differences in cell morphology between the analyzed polymers. The studied polymers were earlier characterized by us for their degradation and morphological characteristics PLLA is a semicrystalline polymer, which exhibits.10 a relatively rough surface because of its spherolitic structure; it has high initial molecular weight and relatively long degradation time. In contrast, PDLGA is an amorphous polymer with a smooth surface and higher degradation rates than PLLA. Herein, we cultured both cells on PDLGA and PLLA films and analyzed whether the growth on polymer scaffold affects the profile of cell surface markers expression. We did not observe any effect on the antigen expression for the C3H10T1/2 cells when compared with earlier study that demonstrated MBA-15 cells growth and cell surface expression.10 The MBA-15 cells were affected by the interaction with PDGLA, which result with increase of CD62E, which is absent on C3H10T1/2 cells. An increase was also noted for the levels of CD11b cultured on MBA-15 to the level of expression C3H10T1/2 cells noted higher and was unchanged when plated on these polymers. Thus, the study explored the interactions between cells and polymer scaffolds by analyzing signals for cell adhesion, which is influenced by the cellular state. In summary, the present study compares two mesenchymal cell lines, C3H10T1/2 and MBA-15, as potential experimental models for cell-loaded biomedical devices. The differences between the analyzed cell lines are based on the differential expression of molecular and surface markers. The cell adhesion and morphology on biodegradable polymers was analyzed by SEM. The demonstrated effect of polymer scaffolds on the antigen expression in vitro appeared to be cell-type dependent. The potential use of mesenchymal cells in the polymer– combined biomedical engineered device relies on the cell properties and the interactions with the polymer, which may affect cellular function in a different manner depending on the cell type and stage of development. This study was supported by Cell PROM from the 6th Program, EGC.

References 1.

2. 3.

4.

Behonick DJ, Werb Z. A bit of give and take: The relationship between the extracellular matrix and the developing chondrocyte. Mech Dev 2003;120:1327–1336. Lecuit T, Pilot F. Developmental control of cell morphogenesis: A focus on membrane growth. Nat Cell Biol 2003;5:103–108. Stupack DG, Cheresh DA. Get a ligand, get a life: Integrins, signaling and cell survival. J Cell Sci 2002;115 (Part 19):3729 – 3738. Agrawal CM, Haas KF, Leopold DA, Clark HG. Evaluation of poly(l-lactic acid) as a material for intravascular polymeric stents. Biomaterials 1992;13:176 –182.


838

5.

6. 7. 8.

9.

10.

11. 12.

13.

14.

15.

16.

17.

18. 19.

20.

21.

22. 23.

24.

25. 26.

SHUR ET AL.

Bergsma JE, de Bruijn WC, Rozema FR, Bos RR, Boering G. Late degradation tissue response to poly(l-lactide) bone plates and screws. Biomaterials 1995;16:25–31. Lewis DH. Biodegradable Polymers as Drug Delivery Systems. New York: Marcel Dekker; 1990. Packence JM, Kohn J. Biodegradable Polymers. San Diego: Academic Press; 2000. Ahrens M, Ankenbauer T, Schroder D, Hollnagel A, Mayer H, Gross G. Expression of human bone morphogenetic proteins-2 or -4 in murine mesenchymal progenitor C3H10T1/2 cells induces differentiation into distinct mesenchymal cell lineages. DNA Cell Biol 1993;12:871– 880. Benayahu D, Kletter Y, Zipori D, Wientroub S. Bone marrowderived stromal cell line expressing osteoblastic phenotype in vitro and osteogenic capacity in vivo. J Cell Physiol 1989;140: 1–7. Shur I, Zilberman M, Benayahu D, Einav S. Adhesion molecules expression by osteogenic cells cultured on various biodegradable scaffolds. J Biomed Mater Res A 2005;75:870 – 876. Aubin JE. Bone stem cells. J Cell Biochem Suppl 1998;30 –31: 73– 82. Benayahu D. The Hematopoietic microenvironment: The osteogenic compartment of bone marrow: Cell biology and clinical application. Hematology 2000;4:427– 435. Ringe J, Kaps C, Burmester GR, Sittinger M. Stem cells for regenerative medicine: Advances in the engineering of tissues and organs. Naturwissenschaften 2002;89:338 –351. Weissman IL. Translating stem and progenitor cell biology to the clinic: Barriers and opportunities. Science 2000;287:1442– 1446. Benayahu D, Kompier R, Shamay A, Kadouri A, Zipori D, Wientroub S. Mineralization of marrow-stromal osteoblasts MBA-15 on three-dimensional carriers. Calcif Tissue Int 1994; 55:120 –127. Marom R, Shur I, Solomon R, Benayahu D. Characterization of adhesion and differentiation markers by osteogenic marrow stromal cells. J Cell Physiol 2005;202(1):41– 48. Matsuo K, Jochum W, Owens J, Chambers T, Wagner E. Function of Fos proteins in bone cell differentiation. Bone 1999;25: 141. Karsenty G. Minireview: Transcriptional control of osteoblast differentiation. Endocrinology 2001;142:2731–2733. Black BL, Olson EN. Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Annu Rev Cell Dev Biol 1998;14:167–196. Katzburg S, Lieberherr M, Ornoy A, Klein BY, Hendel D, Somjen D. Isolation and hormonal responsiveness of primary cultures of human bone-derived cells: Gender and age differences. Bone 1999;25:667– 673. Kassem M, Kveiborg M, Eriksen EF. Production and action of transforming growth factor-␤ in human osteoblast cultures: Dependence on cell differentiation and modulation by calcitriol. Eur J Clin Invest 2000;30:429 – 437. Aubin JE. Regulation of osteoblast formation and function. Rev Endocr Metab Disord 2001;2:81–94. Mundy GR, Chen D, Zhao M, Dallas S, Xu C, Harris S. Growth regulatory factors and bone. Rev Endocr Metab Disord 2001; 2:105–115. Rodan GA. Control of bone formation and resorption: Biological and clinical perspective. 25th Anniversary issue: New directions and dimensions in cellular biochemistry. J Cell Biochem Suppl 1998;30/31:55– 61. Ducy P, Karsenty G. The family of bone morphogenetic proteins. Kidney Int 2000;57:2207–2214. Manolagas SC, Weinstein RS. New developments in the pathogenesis and treatment of steroid-induced osteoporosis. J Bone Miner Res 1999;14:1061–1066.


27.

28.

29.

30.

31.

32.

33. 34.

35.

36. 37. 38.

39. 40. 41.

42.

43.

44.

45.

46.

47.

Spelsberg TC, Subramaniam M, Riggs BL, Khosla S. The actions and interactions of sex steroids and growth factors/ cytokines on the skeleton. Mol Endocrinol 1999;13:819 – 828. Andreassen TT, Oxlund H. The effects of growth hormone on cortical and cancellous bone. J Musculoskelet Neuronal Interact 2001;2:49 –58. Freemark M. Ontogenesis of prolactin receptors in the human fetus: Roles in fetal development. Biochem Soc Trans 2001;29 (Part 2):38 – 41. Kelly PA, Binart N, Freemark M, Lucas B, Goffin V, Bouchard B. Prolactin receptor signal transduction pathways and actions determined in prolactin receptor knockout mice. Biochem Soc Trans 2001;29 (Part 2):48 –52. Takasu H, Guo J, Bringhurst FR. Dual signaling and ligand selectivity of the human PTH/PTHrP receptor. J Bone Miner Res 1999;14:11–20. Haynesworth SE, Baber MA, Caplan AI. Cytokine expression by human marrow-derived mesenchymal progenitor cells in vitro: Effects of dexamethasone and IL-1␣. J Cell Physiol 1996; 166:585–592. Manolagas SC, Kousteni S, Jilka RL. Sex steroids and bone. Recent Prog Horm Res 2002;57:385– 409. Bismar H, Kloppinger T, Schuster EM, Balbach S, Diel I, Ziegler R, Pfeilschifter J. Transforming growth factor ␤ (TGF-␤) levels in the conditioned media of human bone cells: Relationship to donor age, bone volume, and concentration of TGF-␤ in human bone matrix in vivo. Bone 1999;24:565–569. Shur I, Lokiec F, Bleiberg I, Benayahu D. Differential gene expression of cultured human osteoblasts. J Cell Biochem 2001; 83:547–553. Morris JC, Waldmann TA. Advances in interleukin 2 receptor targeted treatment. Ann Rheum Dis 2000;59 Suppl 1:i109 –i114. Karsenty G, Park RW. Regulation of type I collagen genes expression. Int Rev Immunol 1995;12:177–185. Uemura T, Dong J, Wang Y, Kojima H, Saito T, Iejima D, et al. Transplantation of cultured bone cells using combinations of scaffolds and culture techniques. Biomaterials 2003;24:2277– 2286. Ilan N, Madri JA. PECAM-1: Old friend, new partners. Curr Opin Cell Biol 2003;15:515–524. Jackson DE. The unfolding tale of PECAM-1. FEBS Lett 2003; 540:7–14. Arihiro K, Inai K. Expression of CD31, Met/hepatocyte growth factor receptor and bone morphogenetic protein in bone metastasis of osteosarcoma. Pathol Int 2001;51:100 –106. Porter JC, Hogg N. Integrins take partners: Cross-talk between integrins and other membrane receptors. Trends Cell Biol 1998; 8:390 –396. El-Amin SF, Attawia M, Lu HH, Shah AK, Chang R, Hickok NJ, et al. Integrin expression by human osteoblasts cultured on degradable polymeric materials applicable for tissue engineered bone. J Orthop Res 2002;20:20 –28. Shur I, Marom R, Lokiec F, Socher R, Benayahu D. Identification of cultured progenitor cells from human marrow stroma. J Cell Biochem 2002;87:51–57. Reyes-Botella C, Montes MJ, Vallecillo-Capilla MF, Olivares EG, Ruiz C. Antigenic phenotype of cultured human osteoblast-like cells. Cell Physiol Biochem 2002;12:359 –364. Noble KE, Panayiotidis P, Collins PW, Hoffbrand AV, Yong KL. Monocytes induce E-selectin gene expression in endothelial cells: Role of CD11/CD18 and extracellular matrix proteins. Eur J Immunol 1996;26:2944 –2951. Kawashima N, Niederman R, Hynes RO, Ullmann-Cullere M, Stashenko P. Infection-stimulated infraosseus inflammation and bone destruction is increased in P-/E-selectin knockout mice. Immunology 1999;97:117–123.