Copeia 2012, No. 2, 293–300
Molecular and Morphological Evidence of Distinct Evolutionary Lineages of Awaous guamensis in Hawai’i and Guam Daniel P. Lindstrom1,2, Michael J. Blum3, Ryan P. Walter2,3, Roderick B. Gagne3, and James F. Gilliam2 Questions remain about the taxonomy and distribution of geographically widespread species in the circumtropical gobiid genus Awaous. Previous work that placed two species in synonymy on the basis of morphological characteristics effectively redefined the range of Awaous guamensis to include distant locations from Hawai’i and Guam to the islands of South-East Melanesia. Here we evaluate the synonymy of A. guamensis and A. stamineus through phylogeographic analysis of mitochondrial DNA sequence variation and morphological comparisons of Hawai’i and Guam populations. Phylogenetic assessments show clear separation of molecular characteristics, and morphological analyses illustrate statistically significant phenotypic differences indicating that the populations represent distinct evolutionary lineages. Based upon genetic, morphological, and geographic distributional differences, we recommend that Hawaiian populations be recognized as a distinct species, and reversion to the previous nomenclature of Awaous stamineus.
A
WAOUS is a genus of 17 recognized amphidromous gobiid species that are grouped into three subgenera: Awaous, Euctenogobius, and Chonophorus (Watson, 1992). The genus exhibits a circumtropical distribution with nearly half of the species found in the Indo-West Pacific. The composition of the genus is unresolved, however, as questions remain about the taxonomic status of geographically widespread species. The amphidromous life history of these fishes, which involves an extended marine larval phase (Radtke et al., 1988), enables dispersal across long distances and colonization of remote oceanic island freshwater ecosystems. As with other amphidromous gobioid species, taxonomic affinities among members of the genus are problematic due to the difficulty of determining the extent of connectivity via oceanic dispersal versus insular isolation. These difficulties are compounded by frequent instances of sexual dimorphism and ontogenetic variation in morphology and coloration. Also, few studies examining species-level taxonomy have been attempted due to the difficulties of obtaining a complete set of representative specimens from all remote island archipelagos distributed across immense geographic areas. Resolving the taxonomic status of problematic species of Awaous would therefore advance basic understanding of amphidromy and island biogeography of freshwater fishes while also addressing growing concerns about the imperilment of amphidromous species worldwide (Fitzsimons et al., 1996). Resolving the taxonomy of Awaous (Awaous) guamensis would offer particularly valuable information on the biogeography and conservation of amphidromous fauna. The species is a prominent member of the amphidromous community native to the Hawaiian archipelago. All members of this community, which is composed of five gobioid fishes, two decapod shrimp, and two gastropods, are considered endemic to Hawai’i except for A. guamensis. Hawaiian populations of A. guamensis, however, were previously thought to represent an endemic species, named
1
A. stamineus (Eydoux and Souleyet, 1850), until Watson (1992) placed that species in synonymy with A. guamensis (Valenciennes, 1837) in a partial review of the genus. Watson (1992) only examined the status of A. ocellaris and A. guamensis, two Indo-Pacific species within the subgenus Awaous, and based the synonymy of A. stamineus and A. guamensis on morphological affinities between specimens collected from Hawai’i, Guam, New Caledonia, Vanuatu, and Fiji. Yet, no clear justification of the synonymy was presented, such as a direct comparison of morphological characteristics between specimens from the geographic regions in question. Rather, the data presented are combined from these locations, ascribed to A. guamensis, and then compared to A. ocellaris. A growing number of studies finding evidence of dispersal limitation in species with marine larval phases, including amphidromous fishes (Ikeda et al., 2003), suggests that A. guamensis may not encompass geographically widespread populations as proposed by Watson (1992). In a phylogeographic study of populations of A. guamensis from five of the main Hawaiian Islands, Blum et al. (unpubl.) have found evidence of greater population structure than would be expected from a well mixed larval immigrant pool. This indicates that dispersal or recruitment success may be limited between Hawai’i and other Indo-Pacific archipelagos, and raises the possibility that populations of A. guamensis in Hawai’i may be a distinct evolutionary lineage. In this study, we tested the hypothesis that A. guamensis occupying geographically disparate Indo-Pacific archipelagos are genetically distinct. We evaluated geographic patterns of molecular and phenotypic variation among specimens of A. guamensis sampled from Hawai’i and Guam, with comparison to representative congeners from Guam and elsewhere. By placing these comparisons within the context of Watson’s (1992) revision of the genus, we also evaluated the synonymy of A. guamensis and A. stamineus.
Department of Biology, University of Guam, Mangilao, Guam 96923; E-mail:
[email protected]. Send reprint requests to this address. 2 Department of Biology, North Carolina State University, Raleigh, North Carolina 27695-7617; E-mail: (RPW)
[email protected]; and (JFG)
[email protected]. 3 Department of Ecology and Evolutionary Biology, Tulane University, New Orleans, Louisiana 70118; E-mail: (MJB)
[email protected]; and (RBG)
[email protected]. Submitted: 1 March 2011. Accepted: 29 November 2011. Associate Editor: D. Buth. DOI: 10.1643/CI-11-027 F 2012 by the American Society of Ichthyologists and Herpetologists
294
MATERIALS AND METHODS Species delineation.—We follow the general lineage concept of species (de Queiroz, 1998, 2007), which considers species to be population-level evolutionary lineages. We recognize, however, that there is little consensus on what criteria should be used for delimiting species, especially when delimitations are based on molecular genetic analyses (Sites and Marshall, 2004; Schaffer and Thomson, 2007; Wiens, 2007). We consider populations to be separate species if they form exclusive lineages (Baum and Shaw, 1995), display evidence along multiple axes (e.g., morphological, molecular, ecological, behavioral, geographic distribution) of group cohesion (Templeton, 1989), and show independence from other such lineages (Wiley, 1978). Our criteria do not include strict reproductive incompatibility, but natural interbreeding between lineages must be inconsequential to prevent genotypic and phenotypic homogenization of groups. We acknowledge the existence of cryptic species as two or more distinct species that have been classified as a single species due to morphological stasis (Bickford et al., 2007) that upon further investigation prove to be full species according to the criteria defined above. The occurrence of cryptic species is becoming increasingly recognized in a broad range of taxa and biogeographic regions, suggesting that crypsis is an important aspect of evolutionary diversification (Pfenniger and Schwenk, 2007). Fish collection and tissue sampling.—Specimens were collected by snorkeling and use of hand nets from 21 drainages in Hawai’i (by a large team of individuals including all authors plus those named in Acknowledgments) from June 2009 to April 2010 as part of a larger study and from two drainages in Guam (by first author) in July 1999 and again in April 2010 (Fig. 1). Outgroup species were obtained from previous collection efforts in Bali, Indonesia (by first author) in August 1999 (A. ocellaris), Puerto Rico (by first author) in December 1999 (A. banana), Trinidad (by B. Lamphere) in March 2010 (A. banana), and Jamaica (by K. Piller) in June 2009 (A. banana). These additional taxa were included only to corroborate species identifications and to provide phylogenetic context for the analysis of populations of Awaous in Hawai’i and Guam. Small outgroup sample sizes preclude making firm conclusions about those species and their distributions. Tissue biopsies of fins or muscle were immediately placed in either 70% EtOH or salt-saturated DMSO preservative (Seutin et al., 1991). Specimens obtained from Hawai’i in 2009–2010 that were used for morphological analyses were frozen whole. Other voucher specimens were fixed, after tissue biopsy for genetic analysis, in 10% formalin, washed extensively and transferred into 70% EtOH for long-term storage as specimen vouchers (see Material Examined below). DNA extraction, PCR, and sequencing.—Genomic DNA (gDNA) was recovered from fin tissue or lateral muscle samples using the DNeasy (Qiagen, Valencia, CA) extraction kit designed for animal tissue. The complete mitochondrial cytochrome b (cyt b) gene was amplified using approximately 10 gg of template gDNA and two primers from Sevilla et al. (2007), GluFish (59–ACCACCGTTGTTATTCAACTACAA–39; and ThrFish2, 59–AACCTCCGACATCCGGCTTACAAGACCG–39) in a 15 ml PCR cocktail consisting of a final concentration of 1X PCR buffer (which includes 2.0 mM MgCl2), 0.5 mM MgCl2, 0.16 mM of each dNTP, 0.5 mM of
Copeia 2012, No. 2
each primer, and 0.3 U Paq or HoTaq DNA polymerase (MCLAB, Inc., San Francisco, CA). Thermal cycling conditions consisted of an initial denaturation step at 94uC for 6 min, followed by 35 cycles of 94uC for 15s, 52uC for 15s, 72uC for 15s, and a final extension at 72uC for 10 min. PCR amplicons were purified using ExoSAP-It (USB, Affymetrix, Cleveland, OH) and cycle sequencing reactions were performed using FishSeq (59–CCACCGTTGTTATTCAACTACAAG–39, Sevilla et al., 2007) and ThrFish2 primers and BigDye 3.1 chemistry (Applied Biosystems, Foster City, CA). All sequencing reactions were purified using Sephadex (GE Healthcare Biosciences, Pittsburgh, PA) plate protocols and analyzed on an ABI 3100 automated DNA sequencer (Applied Biosystems, Foster City, CA). Genetic analysis.—All raw sequence files were edited, assembled, and aligned with Sequencher 4.9 (Gene Codes Corp., Ann Arbor, MI), and all unique sequences were submitted to GenBank (accession numbers JN387625–JN387712). One sequence of rhyachicthyid gobioid Rhyacicthys aspro (specimen NSNT-P 67357, GenBank accession number AP004454) was obtained (Miya et al., 2003) to include as an outgroup taxon in phylogenetic analyses, as it is recognized as a basal taxon for all gobioids (Pezold, 1993; Keith et al., 2011). Nucleotide composition of the sequenced cyt b region was examined for variable sites with Sequencher v4.9 and GENALEX v6.3 (Peakall and Smouse, 2006). Relationships among haplotypes were recovered in TCS v1.21 (Clement et al., 2000) using 95% statistical parsimony. Phylogenetic relationships among individuals were evaluated using maximum parsimony (MP) as implemented in PAUP* v. 4.0b10 (Swofford, 2002). Heuristic searches were conducted with characters weighted equally and unordered. Starting trees were obtained by stepwise addition, with 1000 RAS replicates and TBR branch swapping (Blum et al., 2008). Support for nodes was assessed via 1000 pseudoreplicates of jackknife resampling with 37% deletion (Farris et al., 1996). Maximum likelihood (ML) and Bayesian estimations of phylogenetic relationships were also performed among congeners and outgroups of Awaous in MEGA v4 (Tamura et al., 2007) and MrBAYES v3.1.2 (Ronquist and Huelsenbeck, 2003). ML was conducted using ML Heuristic NearestNeighbor-Interchange (NNI) method, Tamura-Nei model, uniform rates among sites, and 1000 bootstraps. Settings in MrBAYES were applied in accordance to the TIM1+I model following a likelihood ratio test and Akaike Information Criteria (AIC) implemented in jMODELTEST v1.1 (Posada, 2008). Morphological sampling, measurement, and analyses.—Only those individuals measuring greater than 25 mm standard length (SL as measured in Watson, 1992) were included in morphological comparisons between geographic regions and to previous assessments (Watson, 1992). Individuals smaller than 25 mm often lack fully developed squamation. Therefore, these individuals were only used for genetic analyses. We compared morphological variation among the sampled locations to test Watson’s (1992) supposition of morphological equivalency of putative A. guamensis from Hawai’i and Guam. This enabled us to determine whether Hawaiian and Guamanian populations exhibit diagnostic traits, and also served to identify any individuals of species other than A. guamensis previously known or unknown to coexist in these regions. Characteristics selected and
Lindstrom et al.—Evolutionary lineages of Awaous
295
Fig. 1. Indo-Pacific sampling locations and species identifications of present and previous (Watson, 1992) studies. Blue markers indicate collection sites and species distinctions of present study. Red markers indicate collection sites and species distinctions of Watson (1992).
assessed for this analysis follow those of Watson (1992), who identified several traits for identifying species of Awaous in the Indo-Pacific region. Each specimen examined for morphological characteristics was first checked for compliance with traits diagnostic of A. guamensis (cephalic pore pattern ‘‘d,’’ gill attachment position, cycloid predorsal squamation, absence of first dorsal fin ocellus and presence of snout frenum). Specimens were also analyzed for meristic and morphometric traits previously shown to be of taxonomic significance, including counts of lateral, transverse, and predorsal scales, as well as pectoral-fin ray numbers. Individuals from Guam or Hawai’i not in compliance with the previously stated diagnostic character of A. guamensis were identified as likely being another species and, pending corroboration with genetic data, were excluded from morphological comparisons. Two individuals collected in Guam fell into this category (UGM 6740 and LSUMZ F-40-3928). These specimens were identified as A. ocellaris and were excluded from morphological analyses but were included in genetic analyses. Data from individuals not ruled as species other than A. guamensis were compared according to geography and to data reported by Watson (1992). Morphometric and meristic characters were analyzed for statistical differences between the Hawai’i and Guam populations using two group t-tests for individual traits and then Bonferroni corrected. A two group t-test was also run using a Principal Component (PC) factor derived from all meristic characters except for pre-dorsal scale count. This omission was due to the fact that some of the specimens used had been dissected in this area to remove otoliths as part of a previous study which rendered pre-dorsal scale counts
unreliable. A second Principal Component Analysis (PCA) run with the same meristic characters and both morphometric characters yielded two PC factors. These PC factors were used in a Discriminant Analysis (DA) and to graphically portray the range of morphological variation in Hawaiian and Guamanian populations. The single PC factor based on meristic characters captured 57% of observed variation, as did the two PC factors based on both meristic and morphometric characters. All statistical analyses were performed using SYSTAT 13 (Systat Software, Inc., Chicago, IL). RESULTS Genetic analysis.—Analysis of 1036 bp of cytochrome b from 88 specimens of Awaous yielded 216 polymorphic sites, and a total of 44 unique haplotypes. Individuals of A. ocellaris sampled from Bali exhibited two haplotypes, and A. ocellaris individuals from Guam exhibited two additional haplotypes. Four unique haplotypes were recovered from the Caribbean samples of Awaous banana: one from Jamaica, one from Trinidad, and two from Puerto Rico. Among Awaous guamensis, 17 haplotypes were recovered among samples from the Hawaiian archipelago, and 19 haplotypes were recovered from the island of Guam with none shared between Hawai’i and Guam. All methods of analysis resolved marked phylogenetic structure among species of Awaous (Fig. 2). The outgroup taxon, R. aspro, exhibited a minimum of 26.8% sequence divergence from species of Awaous. The clade of Caribbean specimens of A. banana was recovered as basal to the clade composed of Awaous sampled from the Pacific. Approximately
296
Copeia 2012, No. 2
Fig. 2. Phylogenetic relationships of select species of Awaous in the Pacific and Caribbean. Maximum likelihood analysis of mtDNA cytochrome b sequences supporting four distinct lineages corresponding to A. guamensis (green), A. stamineus (red), A. ocellaris (orange), and A. banana (blue). Nodal support is indicated by maximum likelihood (above node) and maximum parsimony bootstrap replicates (below node). Hash marks on branches indicate those that were shortened for aesthetic reasons. Double hash marks indicate a shortening of 0.03 and triple hash marks 0.12.
Lindstrom et al.—Evolutionary lineages of Awaous
14.3% sequence divergence occurs between Awaous sampled from the Pacific and those sampled from the Caribbean. All analytical approaches recovered a clade composed of A. ocellaris as sister to specimens of A. guamensis (Fig. 2). The clade that contains only A. ocellaris exhibited a minimum of 12.0% sequence divergence relative to A. guamensis collected from Guam and Hawai’i. Patterns of genetic divergence within A. banana and A. ocellaris do not strictly correspond to divergence among islands. In A. banana, two specimens collected from Puerto Rico are more divergent from one another than either is to the specimen sampled from Trinidad (Fig. 2). Even greater divergence was found among specimens of A. ocellaris sampled from Guam. Both specimens of A. ocellaris from Bali form a well-supported clade, but with 57 nucleotide substitutions of separation, the two haplotypes of A. ocellaris found on Guam did not (Fig. 2). Patterns of genetic variation within A. guamensis reflect divergence between Hawai’i and Guam. No mtDNA haplotypes were shared between specimens from the Hawaiian Islands and Guam. A minimum of 11 mutation steps were found between the Hawai’i and Guam haplotype groups. A minimum estimate of 1.7% sequence divergence occurs between A. guamensis sampled from Guam and Hawai’i, which includes six fixed nucleotide substitutions: one C-G transversion, one C-T transition, and four A-G transitions. All phylogenetic methods recovered a well-supported clade composed solely of specimens from Guam. ML analyses recovered A. guamensis from Hawai’i as a single clade with moderate bootstrap support (Fig. 2), whereas MP and Bayesian analyses recovered Hawaiian specimens across a complex series of clades basal to the Guam clade. Two haplotype groups were found among A. guamensis sampled from Guam (Fig. 2). The two groups differ by five nucleotide substitutions: four C-T transitions, and one A-G transition. Morphological analyses.—Values and ranges of morphological characters from the specimens collected for the present study are compared to those reported by Watson (1992) in Table 1. However, Watson (1992) did not include or did not contain sufficient detail to calculate equivalent scores for several traits including SL, body depth (BD), and pectoral-fin ray count. In all cases, ranges of character values calculated from all specimens greatly or completely overlap with those previously reported for A. guamensis. Although no diagnostic traits were identified and no morphometric differences were found, meristic traits including lateral line, transverse and predorsal scale counts were significantly different between Hawaiian and Guamanian specimens (Table 1). Similarly, PC factor scores based on meristic characters were also significantly different (Table 1), and little overlap was found among Hawaiian and Guamanian populations according to the two PC factor scores derived from meristic and morphometric characters (F 5 11.54, P , 0.001; Fig. 3). DISCUSSION In the most recent review of the gobiid genus Awaous from the Indo-Pacific, Watson (1992) placed species into three morphologically and geographically distinct subgenera: Awaous, Chonophorus, and Eutenogobius. Watson (1992) also described two species within the subgenus Awaous, A. ocellaris, and A. guamensis, which involved placing A. guamensis and A. stamineus in synonymy. Little justification was provided for the synonymy of these two taxa beyond
297
sharing select morphological traits and overlap of values at four meristic characters. The ambiguous nature of these comparisons, which were acknowledged by Watson (1992) to be based upon incomplete geographic sampling, and the disjunct distribution pattern of the resulting taxon motivated us to assess molecular and morphological variation in A. guamensis sampled from Hawai’i and Guam. Our results show clear separation of molecular characteristics and statistically significant differences in phenotypic characteristics, indicating that A. guamensis in Hawai’i and Guam are two separate evolutionary lineages. Accordingly, we recommend that Hawaiian populations be recognized as a distinct species, reverting to the previous nomenclature of Awaous stamineus. Genetic and phenotypic divergence.—Analysis of mtDNA sequence variation provides evidence of fixed differences between A. guamensis collected from Hawai’i and Guam. Additionally, an analysis of morphological traits that Watson (1992) used to define subgenera and species of Awaous revealed statistically significant phenotypic distinctions between the two populations. These results comply with our criteria for species delineation in that A. guamensis from Hawai’i and Guam exhibit exclusive lineages as evidenced by genetic, morphological, and geographic distributional characteristics. Furthermore, the exclusive mitochondrial DNA haplotypes within the Hawaiian and Guamanian populations can be considered as diagnosably distinct characters under the phylogenetic species concept (Cracraft, 1983) further supporting the reinstatement of A. stamineus. Because the populations appear to exhibit only molecular and not morphological diagnostic characters, the lineages could be considered cryptic species. These findings contrast with those from a similar study of the amphidromous goby Sicyopterus lagocephalus (Keith et al., 2005), that found a series of species with restricted ranges actually comprised a single wide ranging one that spans most of the South Pacific and islands of the western Indian Ocean. Although the present study did not include any specimens from several regions considered by Watson (1992)—including the Loyalty Islands of New Caledonia, Vanuatu, and Fiji—our results raise the possibility that additional diversity exists within the subgenus Awaous. Further molecular and morphological comparisons of Awaous from other archipelagos will be necessary to detail the distributions of A. guamensis and A. stamineus, and to determine whether cryptic species with close affinities to known species (e.g., A. guamensis, A. stamineus, A. melanocephalus, A. grammepomus, A. ocellaris) exist throughout the Indo-Pacific and elsewhere. Taxonomic recommendations.—Based upon genetic, morphological, and geographic distributional differences, we recommend that Hawaiian populations be recognized as a distinct species. This would involve reversion to the previous nomenclature of Awaous stamineus (Eydoux and Souleyet, 1850). Like the four other species of amphidromous gobioids found in Hawai’i (Eleotris sandwichensis, Lentipes concolor, Sicyopterus stimpsoni, and Stenogobius hawaiiensis), it is likely that A. stamineus is also endemic to the archipelago. Our data indicate that A. guamensis and A. stamineus do not co-occur in Hawai’i or Guam, although it is possible that they are found in sympatry elsewhere in the Indo-Pacific. Unlike sympatric A. guamensis and A. ocellaris in Guam that
87 80 88
97
* Values derived from specimens from Hawaii (92), Guam (15), New Caledonia (7), Fiji (6), and Vanuatu (1) were combined. Which specimens were used for each parameter was not reported.
1.00 ,0.001 ,0.001 ,0.001 0.193 ,0.001 ,0.001 ,0.001 Range 14–16 35–58 12–15 24–32 n Mode 18 17 17 53 17 15 13 25 Range 12–17 48–71 11–22 24–43 Mode 16 56 18 34 Meristics Pectoral-fin rays Lateral line scales (LL) Transverse scales (TV) Predorsal midline scales (PD)
n*
Mode Range Not reported 62 57–72 17 15–19 31 25–48
n 93 93 93 43
Uncorrected P-value 0.513 0.063 Range 16.2–23.5 54.3–66.7 Range 9.8–35.9 46.8–81.8 Mean 20.4 59.3 n*
Morphometric percent SL Body depth (BD) Preanal length (PL)
Mean Range Not reported 61.2 55–67
n 93 93
n Mean 17 19.5 17 62.6
26–96 41–181 95.3 121 Standard length (SL)
N/A
19.5–245.1
93
17
56.8
Guam vs. Hawaii Range Mean n Range Mean n Range Mean n* Variable
Guam (Present study) Hawaii (Present study) Watson (1992)
Table 1. Morphodata and T-Test Results with Comparison to Values from Watson (1992), by Location.
Bonferroni corrected P-value 1.00 0.378
Copeia 2012, No. 2
T-Test results
298
Fig. 3. Discriminant Analysis of PC factors based on morphological traits of species of Awaous from Hawai’i (filled circles) and Guam (open circles) with 95% confidence intervals.
are distinguishable according to macro-morphological traits, it would be difficult to distinguish A. guamensis and A. stamineus (in situ) in areas where the two species might co-occur. It is possible that additional work might reveal practical characteristics (physical or behavioral) that would make confident field identifications possible. Nonetheless, molecular assays (e.g., PCR-RFLP screens, microsatellite genotyping) could be developed to distinguish the two species and to evaluate mechanisms of reproductive isolation if any potential for interaction exists. Life history, biogeographic, and conservation implications.— Previous studies of amphidromous gobioids have demonstrated that the duration of marine planktonic phases can translate to dispersal potentials (known planktonic larval duration multiplied by measured current vectors) that are sufficient to maintain genetic connectivity among archipelagos as distant as the Hawaiian and Mariana islands (Radtke et al., 1988, 2001; Bell et al., 1995; Radtke and Kinzie, 1996; Shen et al., 1998; Lord et al., 2010). Large dispersal potential is often portrayed as a key factor underlying geographically expansive distributions of amphidromous fauna (Keith et al., 2011; Maeda et al., 2011). However, many species with planktonic marine larvae do not attain their dispersal potential (Victor and Wellington, 2000; Lester and Ruttenberg, 2005), indicating that limitations to dispersal (or possibly, recruitment) can restrict species distributions and sustain genetic differences among geographically distant locations even in reef-dwelling marine species (Cowen et al., 2006). The presence of distinct evolutionary lineages on Hawai’i and Guam indicates a lack of mixing between these archipelagos for species in this genus. This is in stark contrast to some closely related taxa with similar life history traits that are believed to have a much wider distributional range (Keith et al., 2005). It is logical to conclude that a
Lindstrom et al.—Evolutionary lineages of Awaous
potentially longer duration of marine larval phase translates into greater dispersal ability, but this may not be the case for all amphidromous taxa. Our findings suggest that additional genetic analyses encompassing more locations and taxa will clarify the extent of amphidromous species diversity, particularly among widely distributed taxa that possibly harbor cryptic evolutionary lineages. Strategies aiming to conserve or manage native amphidromous fishes should account for the possibility of dispersal limitation and the presence of cryptic evolutionary lineages. With Awaous stamineus, which is native and possibly endemic to Hawai’i, managers can no longer rely on a widespread population distribution and geographically extensive dispersal to act as a buffer to local population declines. This requires that greater value be placed on maintaining the viability of local populations, which provides greater motivation for the rehabilitation of declining or extirpated populations through protective intervention and restoration efforts. MATERIAL EXAMINED Material used in genetic study.—Awaous banana: UGM 6746, UGM 6747, Puerto Rico, Rio Sabana; LSUMZ F-40-3957, Trinidad, Maracas River; SLU 6381, Jamaica, Milk River. Awaous guamensis: LSUMZ F-40-3937–LSUMZ F-40-3956, Guam, Ugum River; UGM 6741-3, LSUMZ F-40-3918– LSUMZ F-40-3927, LSUMZ F-40-3929–LSUMZ F-40-3936, Guam, Sella River. Awaous ocellaris: UGM 6740, LSUMZ F-40-3928, Guam, Ugum River; UGM 6744, UGM 6745, Indonesia, Bali, Singaraja Fish Market. Awaous stamineus: LSUMZ F-39-3890–LSUMZ F-40-3901, Hawai’i, Kauai, Waimea River; LSUMZ F-40-3907–LSUMZ F-40-3917, Hawai’i, Maui, Honokohau River; LSUMZ F-393858, LSUMZ F-39-3861, LSUMZ F-39-3862, Hawai’i, Molokai, Halawa River; LSUMZ F-39-3851, LSUMZ F-39-3852, Hawai’i, Molokai, Honouli Wai River; LSUMZ F-39-3839– LSUMZ F-39-3841, Hawai’i, Molokai, Pelekunu River; LSUMZ F-39-3873, LSUMZ F-39-3877, LSUMZ F-39-3879, Hawai’i, Molokai, Wailau River; LSUMZ F-40-3904–LSUMZ F-40-3906, Hawai’i, Oahu, Kahana River; LSUMZ F-40-3902, LSUMZ F-40-3903, Hawai’i, Oahu, Waikane River. Rhyacichthys aspro: NSNT-P 67357, Japan, Okinawa, Irimote. Material used in morphological study.—Awaous guamensis: UGM 6742, UGM 6743, LSUMZ F-40-3930–LSUMZ F-403936, Guam, Sella River; LSUMZ F-40-3937–LSUMZ F-403944, Guam, Ugum River. Awaous stamineus: LSUMZ F-38-3793–LSUMZ F-38-3799, Hawai’i, Hawai’i, Honoli’i River; LSUMZ F-38-3800, LSUMZ F-38-3805–LSUMZ F-38-3807, Hawai’i, Hawai’i, Ka’ie’ie River; LSUMZ F-39-3803, LSUMZ F-39-3804, Hawai’i, Hawai’i, Niuli’li River; LSUMZ F-39-3801, LSUMZ F-39-3802, Hawai’i, Hawai’i, Wailoa River; LSUMZ F-39-3808, Hawai’i, Kauai, Hanakapiai River; LSUMZ F-39-3809, Hawai’i, Kauai, Waimea River; LSUMZ F-39-3836–LSUMZ F-39-3837, Hawai’i, Maui, Alelele River; LSUMZ F-39-3826–LSUMZ F-39-3834, Hawai’i, Maui, Honokohau River; LSUMZ F-39-3823–LSUMZ F-393825, Hawai’i, Maui, Iao River; LSUMZ F-39-3821, LSUMZ F39-3822, Hawai’i, Maui, Waihe’e River; LSUMZ F-39-3857– LSUMZ F-39-3861, LSUMZ F-39-3863–LSUMZ F-39-3867, Hawai’i, Molokai, Halawa River; LSUMZ F-39-3848–LSUMZ
299
F-39-3850, LSUMZ F-39-3853–LSUMZ F-39-3856, Hawai’i, Molokai, Honouli Wai River; LSUMZ F-39-3838, Hawai’i, Molokai, Kamalo River; LSUMZ F-39-3839, LSUMZ F-393842–LSUMZ F-39-3847, Hawai’i, Molokai, Pelekunu River; LSUMZ F-39-3868–LSUMZ F-39-3876, LSUMZ F-39-3878, Hawai’i, Molokai, Wailau River; LSUMZ F-39-3812–LSUMZ F-39-3818, Hawai’i, Oahu, Ala Wai; LSUMZ F-39-3881– LSUMZ F-39-3888, Hawai’i, Oahu, Kahaluu River; LSUMZ F39-3810, Hawai’i, Oahu, Kea’ahala River; LSUMZ F-39-3819, LSUMZ F-39-3820, Hawai’i, Oahu, Waikane River; LSUMZ F39-3889, Hawai’i, Oahu, Waimanalo River; LSUMZ F-393811, LSUMZ F-39-3880, Hawai’i, Oahu, Waimea River. ACKNOWLEDGMENTS The authors would like to thank the following individuals for assistance with field collections in: Hawai’i—N. Bickford, M. Burt, J. Fenner, C. Ferguson, D. Gilliam, E. Hain, D. Hogan, B. Lamphere, P. McIntyre, T. Maie, K. Moody, B. Policky, and J. Rossa; Guam—J. Mills, L. Raymundo, and B. Tibbatts; Trinidad—B. Lamphere. The authors would also like to acknowledge K. Piller for providing a specimen of A. banana from Jamaica. Additional assistance with logistics and the collection of molecular data was provided by D. Hogan, N. Brasier, S. Cunningham, and E. Hekkala. This study was funded by the Department of Defense, Strategic Environmental Research and Development Program (SERDP) under Project RC-1646. LITERATURE CITED Baum, D. A., and K. L. Shaw. 1995. Genealogical perspectives on the species problem, p. 289–303. In: Molecular and Experimental Approaches to Plant Biosystematics. P. C. Hoch and A. G. Stephenson (eds.). Missouri Botanical Garden, St. Louis. Bell, K. N. I., P. Pepin, and J. A. Brown. 1995. Seasonal, inverse cycling of length and age-at-recruitment in the diadromous gobies Sicydium punctatum and Sicydium antillarum in Dominica, West Indies. Canadian Journal of Fisheries and Aquatic Science 52:1535–1545. Bickford, D., D. J. Lohman, N. S. Sohdi, P. K. L. Ng, R. Meier, K. Winkler, K. K. Ingram, and I. Das. 2007. Cryptic species as a window on diversity and conservation. Trends in Ecology and Evolution 22:148–155. Blum, M. J., D. Neely, P. Harris, and R. Mayden. 2008. Molecular systematics of the cyprinid genus Campostoma (Actinopterygii: Cypriniformes): disassociation between morphological and mitochondrial differentiation. Copeia 2008:360–369. Clement, M., D. Posada, and K. A. Crandall. 2000. TCS a computer program to estimate gene genealogies. Molecular Ecology 9:1657–1659. Cowen, R. K., C. B. Paris, and A. Srinivasan. 2006. Scaling connectivity in marine populations. Science 311:522–527. Cracraft, J. 1983. Species concepts and speciation analysis. Current Ornithology 1:159–187. de Queiroz, K. 1998. The general lineage concept of species, species criteria, and the process of speciation: a conceptual unification and terminological recommendations, p. 57–75. In: Endless Forms: Species and Speciation. D. J. Howard and S. H. Berlocher (eds.). Oxford Unversity Press, Oxford, U.K. de Queiroz, K. 2007. Species concepts and species delimitation. Systematic Biology 56:879–886.
300
Farris, J. S., V. A. Albert, M. Kallersjo, D. Lipscomb, and A. G. Kluge. 1996. Parsimony jackknifing outperforms neighbor-joining. Cladistics 12:99–124. Fitzsimons, J. M., R. T. Nishimoto, and W. S. Devick. 1996. Maintaining biodiversity in freshwater ecosystems on oceanic islands of the tropical Pacific. Chinese Biodiversity 4(supplement):23–27. Ikeda, M., M. Nunokawa, and N. Taniguchi. 2003. Lack of mitochondrial gene flow between populations of the endangered amphidromous fish Plecoglossus altivelis ryukyuensis inhabiting Amami-oshima Island. Fisheries Science 69:1162–1168. Keith, P., T. Galewski, G. Catteneo-Berrebi, T. Hoareau, and P. Berrebi. 2005. Ubiquity of Sicyopterus lagocephalus (Teleostei: Gobioidei) and phylogeography of the genus Sicyopterus in the Indo-Pacific area inferred from mitochondrial cytochrome b gene. Molecular Phylogenetics and Evolution 37:721–732. Keith, P., C. Lord, J. Lorion, S. Watanabe, K. Tsukamoto, A. Couloux, and A. Dettai. 2011. Phylogeny and biogeography of Sicydiinae (Teleostei: Gobiidae) inferred from mitochondrial and nuclear genes. Marine Biology 158:311–326. Lester, S. E., and B. I. Ruttenberg. 2005. The relationship between pelagic larval duration and range size in tropical reef fishes: a synthetic analysis. Proceedings of the Royal Society 272:585–591. Lord, C., C. Brun, M. Hautecoeur, and P. Keith. 2010. Comparison of the duration of the marine larval phase estimated by otolith microstructural analysis of three amphidromous Sicyopterus species (Gobiidae: Sicydinae) from Vanuatu and New Caledonia: insights on endemism. Ecology of Freshwater Fish 19:26–38. Maeda, K., T. Mukai, and K. Tachihara. 2011. Newly collected specimens of the sleeper Eleotris acanthopoma (Teleostei: Eleotridae) from French Polynesia indicate a wide panmictic distribution in the West and South Pacific. Pacific Science 65:257–264. Miya, M., H. Takeshima, H. Endo, N. B. Ishiguro, J. G. Inoue, T. Mukai, T. P. Satoh, M. Yamaguchi, A. Kawaguchi, K. Mabuchi, S. M. Shirai, and M. Nishida. 2003. Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 26:121–138. Peakall, R., and P. E. Smouse. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6:288–295. Pezold, F. 1993. Evidence for a monophyletic gobiinae. Copeia 1993:634–643. Pfenniger, M., and K. Schwenk. 2007. Cryptic animal species are homogeneously distributed among taxa and biogeographical regions. BMC Evolutionary Biology 7:121. DOI:10.1186/1471-2148-7-121. Posada, D. 2008. jModelTest: phylogenetic model averaging. Molecular Biology Evolution 25:1253–1256.
Copeia 2012, No. 2
Radtke, R. L., and R. A. Kinzie, III. 1996. Evidence of a marine larval stage in endemic Hawaiian stream gobies from isolated high elevation location. Transactions of the American Fisheries Society 125:613–621. Radtke, R. L., R. A. Kinzie, III, and S. D. Folsom. 1988. Age at recruitment of Hawaiian freshwater gobies. Environmental Biology of Fishes 23:205–213. Radtke, R. L., R. A. Kinzie, III, and D. J. Shafer. 2001. Temporal and spatial variation in length of larval life and size at settlement of the Hawaiian amphidromous goby Lentipes concolor. Journal of Fish Biology 59:928–938. Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574. Seutin, G., B. N. White, and P. T. Boag. 1991. Preservation of avian blood and tissue samples for DNA analyses. Canadian Journal of Zoology 69:82–90. Sevilla, R. G., A. Diez, M. Nore´n, O. Mouchel, M. Je´ro ˆ me, V. Verrez-Bagniz, H. Van Pelt, L. Favre-Krey, G. Krey, The FishTrace Consortium, and J. M. Bautista. 2007. Primers and polymerase chain reaction conditions for DNA barcoding teleost fish based on the mitochondrial cytochrome b and nuclear rhodopsin genes. Molecular Ecology Notes 7:730–734. Shaffer, H. B., and R. C. Thomson. 2007. Delimiting species in recent radiations. Systematic Biology 56:896–906. Shen, K. N., Y. C. Lee, and W. N. Tzeng. 1998. Use of otolith microchemistry to investigate the life history pattern of gobies in Taiwanese streams. Zoological Studies 37:322–329. Sites, J. W., and J. C. Marshall. 2004. Operational criteria for delimiting species. Annual Review of Ecology, Evolution, and Systematics 35:199–227. Swofford, D. L. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596–1599. Templeton, A. R. 1989. The meaning of species and speciation: a genetic perspective, p. 3–27. In: Speciation and Its Consequences. D. Otte and J. A. Endler (eds.). Sinauer Associates, Sunderland, Massachusetts. Victor, B. C., and G. M. Wellington. 2000. Endemism and the pelagic larval duration of reef fishes in the eastern Pacific Ocean. Marine Ecology Progress Series 205:241– 248. Watson, R. E. 1992. A review of the gobiid fish genus Awaous from insular streams of the Pacific Plate. Ichthyological Exploration of Freshwaters 3:161–176. Wiens, J. J. 2007. Species delimitation: new approaches for discovering diversity. Systematic Biology 56:875–878. Wiley, E. O. 1978. The evolutionary species concept reconsidered. Systematic Zoology 27:17–26.
