Molecular Characterization and Phylogenetic ...

Molecular Characterization and Phylogenetic Analysis of Eimeria From Turkeys and Gamebirds: Implications for Evolutionary Relationships in Galliform Birds Author(s): K. B. Miska, R. S. Schwarz, M. C. Jenkins, T. Rathinam, and H. D. Chapman Source: Journal of Parasitology, 96(5):982-986. 2010. Published By: American Society of Parasitologists DOI: 10.1645/GE-2344.1 URL: http://www.bioone.org/doi/full/10.1645/GE-2344.1

BioOne (www.bioone.org) is an electronic aggregator of bioscience research content, and the online home to over 160 journals and books published by not-for-profit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research.

J. Parasitol., 96(5), 2010, pp. 982–986 F American Society of Parasitologists 2010

MOLECULAR CHARACTERIZATION AND PHYLOGENETIC ANALYSIS OF EIMERIA FROM TURKEYS AND GAMEBIRDS: IMPLICATIONS FOR EVOLUTIONARY RELATIONSHIPS IN GALLIFORM BIRDS K. B. Miska, R. S. Schwarz, M. C. Jenkins, T. Rathinam*, and H. D. Chapman* USDA/ARS, Animal Parasitic Diseases Laboratory, 10300 Baltimore Ave., Bldg. 1042 BARC-East, Beltsville, Maryland 20705. e-mail: Kate.Miska@ ars.usda.gov ABSTRACT: In order to determine the evolutionary relationships among Eimeria species that parasitize birds of the Galliformes, the 18s rDNA gene and a portion of the cytochrome oxidase subunit 1 (cox-1) were amplified from Eimeria species isolated from turkeys, chukars, and pheasants. The phylogenetic analysis of these sequences suggests that species infecting chickens are polyphyletic and, therefore, do not all share a direct common ancestor. Both the 18s rDNA and the cox-1 sequences indicate that Eimeria tenella and Eimeria necatrix are more closely related to Eimeria of turkeys and pheasants than to other species that infect the chicken. It is, therefore, likely that the chicken Eimeria spp. represent 2 separate ancestral colonizations of the gut, one of which comprises E. tenella and E. necatrix that infect the ceca, while the other includes Eimeria acervulina, Eimeria brunetti, Eimeria maxima, and Eimeria mitis, which infect the upper regions of the intestine.

in producing species phylogenies, but these have not been implemented in the evolution of any apicomplexan parasite (Traversa et al., 2007). The gene encoding cytochrome oxidase subunit I (cox-1) has been of particular interest. The addition of sequences derived from 18s rDNA and cox-1 of Eimeria species that infect turkeys, chukars, and pheasants suggests that Eimeria that infect chickens are paraphyletic and, therefore, do not share a direct common ancestor. In the present analysis, E. tenella and Eimeria necatrix (which infect the ceca) form a clade more closely placed to Eimeria species of turkeys and pheasants than to other Eimeria species that infect higher regions of the intestine in chickens. Here we also discuss the implications these findings may have on treatment and other considerations of coccidiosis.

Seven species of Eimeria are known to infect chickens and cause the disease coccidiosis, which is a cause of considerable economic loss to the poultry industry (Allen and Fetterer, 2002). The disease is complex, with each species capable of making a separate contribution to pathology and pathogenicity in the host. In the case of Eimeria tenella, parasite development in the crypts of Lieberku¨hn in the ceca causes profound clinical effects that include substantial hemorrhage and fluid loss. Duodenal infection, however, such as with Eimeria acervulina, which develops within enterocytes of the villi, results in characteristic white petechial lesions in the intestinal lining associated with malabsorption of nutrients. Thus, each Eimeria species, as a consequence of its site of development, may cause specific pathology in the host. It is clear that species that parasitize the ceca produce a very different infection than species that infect the middle and upper regions of the gut. Eimeria spp. that infect other species of galliform birds have been described to some extent morphologically. Besides chickens, the best characterized are those that infect turkeys (Chapman, 2008). However, no molecular data have been published from any of the 7 species that infect this host. There are reports of coccidiosis in game birds such as pheasants, quail, and chukars (Norton, 1976; Ruff, 1987); however, none of the Eimeria that parasitize these species have been studied at the molecular level. In turkeys, as well as in game birds, several Eimeria species infect different regions of the gut. In turkeys, Eimeria adenoeides primarily parasitizes the ceca, whereas Eimeria meleagrimitis infects upper regions of the intestine (Chapman, 2008). In the present study, molecular data were obtained from Eimeria species of turkeys, pheasants, and chukars in order to compare with that of species from the chicken and expand our knowledge of the evolution of Eimeria species in galliform birds. Ribosomal DNA sequences encoding the small subunit of ribosomal DNA (18s rDNA) have been used successfully in determining evolutionary relationships of many taxonomic groups, including chicken Eimeria spp. (Barta et al., 1997). Genes encoded in the mitochondrial genome have also been widely used

MATERIALS AND METHODS Preparation of DNA Genomic DNA was extracted from oocysts, which were collected from pheasants (Phasianus colchicus) and chukar partridges (Alectoris graeca). Sporulated oocysts from turkeys (Meleagridis gallopavo) were used as starting material for DNA isolation. Eimeria spp. oocysts (,105 total from chukars and pheasants, ,107 from turkeys) were pelleted by centrifugation in a 1.5-ml microcentrifuge tube for 5 min at 2,000 g, then treated with 200 ml of bleach for 10 min at room temperature. Oocysts were then washed 4 times in water with 5 min of centrifugation at 2,000 g. Oocysts were re-suspended in 500 ml of buffer ATL (Qiagen, Valencia, California), and transferred to a 2-ml screw cap tube (Fisher Scientific, Pittsburgh, Pennsylvania). They were disrupted on a Mini-Bead Beater-8 Cell Disrupter (BioSpec Products, Bartlesville, Oklahoma) using 200 mg of sterile glass beads (,0.5-mm diameter) with two 2-min agitations, each followed by 1-min incubation on ice. DNA was purified using QIAampH DNA Mini Kit (Qiagen) according to the manufacturer’s protocol. DNA yield was quantified using a Beckman CoulterTM DUH 640 spectrophotometer (Beckman Instruments, Fullerton, California) and held temporarily at 4 C with storage at 220 C. Polymerase chain reaction Approximately 810 bps of the cox-1 mitochondrial gene and 1,790 bps of the 18s rRDNA nuclear gene were amplified using universal primers designed to target each gene. The sequence of the 18s rDNA primers was as follows: 59 ACCTGGTTGATCCTGCCAG 39 and 59 CTTCCGCAGGTTCACCTACGG. The sequence of the cox-1 rDNA primers was as follows: 59 GTTTGGTTCAGGTGTTGGTTG 39 and 59 ATCCAATAACCGCACCAAGAG 39. For each reaction, 100–200 ng of Eimeria spp. genomic DNA was used with go Taq polymerase (Promega, Madison, Wisconsin) in the presence of 10 mM forward and reverse primer. Amplifications were carried out as

Received 30 September 2009; revised 15 April 2010; accepted 19 April 2010. * Department of Poultry Science, University of Arkansas, Fayetteville, Arkansas 72701. DOI: 10.1645/GE-2344.1 982

MISKA ET AL.—EVOLUTION OF EIMERIA INFECTIONS IN GALLIFORM BIRDS

follows: initial heat activation of polymerase at 95 C for 7 min, denaturation, 94 C for 30 sec, annealing, 57 C for 30 sec for 18s rDNA amplifications, and 55 C for 30 sec for cox-1 amplifications, extension, 72 C for 1 min, and a final extension of 5 min at 72 C. The denaturation, annealing, and extension steps were repeated 34 times. To visualize the PCR products, electrophoresis was carried out in 1% agarose and visualized with ethidium bromide staining. A negative control lacking target DNA, but including all other ingredients, was used for each primer set. Cloning and sequencing QIAquick gel extraction kit (Qiagen) was used to purify amplicons, and these were cloned using pGEMH-T easy (Promega) or pCRH2.1 (Invitrogen, Carlsbad, California) vector system kits. Color screening identified recombinant clones, and the inserts from these were sequenced using BigDyeH Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California) with vector priming sites (M13) and internal priming sites (18S rDNA only), and sequences were obtained using an ABI 3730 genetic analyzer (Applied Biosystems). Sequence data files were verified for quality and accuracy using SequencherTM 4.8 software (Gene Codes Corporation, Ann Arbor, Michigan). Sequence identity of inserts was determined using BLASTN or BLASTX searches (Altschul et al., 1990) via the National Center for Biotechnology Information server (http://www.ncbi.nlm.nih.gov/). Sequences were screened for hybrid forms potentially generated during amplification via template jumping, and suspect sequences eliminated from further analysis. To assess the level of genetic variability within, and between, Eimeria spp., PCR fragments amplified via 18S rDNA, and cox-1, universal primer pairs were cloned and sequenced such that the nucleotide reads obtained were unambiguous. Primers were trimmed from the sequences to avoid potential bias in subsequent sequence analysis. All sequences obtained in this study have been deposited in the GenBank database.

983

belonging to groups II and III were found in both turkey-derived oocyst samples. Twenty clones encoding 18s rDNA from Eimeria spp. collected from a litter of chukars were sequenced. Nine of these were obtained from Sample 1, and 11 were obtained from Sample 2. The length of these clones was highly conserved, ranging from 1,785 to 1,787 bp. Sequence identity ranged between 98.7 and 100%; thus, they were more conserved than those obtained from turkey Eimeria spp. Twelve clones encoding 18s rDNA from Eimeria species collected from a single litter sample from pheasants were sequenced and ranged from 1,784 to 1,790 bp in length. Based on sequence identity, as well as presence of conserved motifs, the 18s rDNA from pheasant Eimeria spp. could be divided into 2 groups. Five clones with sequences belonging to Group I shared 99.7–99.9% identity, whereas the 7 sequences belonging to Group II shared 99.6–99.9% nucleotide identity. Groups I and II shared between 97.7 and 98.7% nucleotide sequence identity. It is, therefore, likely that these 2 groups represent distinct Eimeria species that infect pheasants. The level of sequence identity between Eimeria spp. of chickens, the 3 groups of sequences from turkeys, and the 2 groups from pheasants are comparable. Thus, it is likely that each group described here represents a different species. Sequences from E. necatrix and E. tenella share more identity between groups I and II of turkey Eimeria spp. than with other chicken Eimeria spp. (with the exception that E. tenella and E. necatrix 18s rDNA share 99.1% nucleotide sequence identity).

Sequence and phylogenetic analyses All nucleotide alignments were constructed using ClustalX software (Thompson et al., 1997). The alignments were checked manually to ensure the correct inference of variable positions. Sequences were trimmed at the same relative 59 and 39 ends in the alignments used for phylogenetic analysis. Phylogenetic trees were reconstructed from these nucleotide alignments using neighbor joining (NJ) (Saitou and Nei, 1987) and maximum likelihood analysis (ML) (Felstenstein, 1981). The NJ analysis was carried out using MEGA 4 software (Tamura et al., 2007). The branching order was confirmed by performing 1,000 bootstrap replicates. Gaps in alignment were treated as missing or unknown characters. For the ML analysis a model of evolution was obtained using Modeltest 3.06 software (Posada and Crandall, 1998). The ML analyses were carried out using PAUP version 4.0b10 (Swofford, 1998).

RESULTS 18s rDNA sequences from Eimeria spp. of turkeys, pheasants, and chukars Twenty-six clones containing the 18s rDNA gene were sequenced from the 2 samples of turkey Eimeria spp. oocysts. The length of sequences obtained ranged between 1,746 and 1,753 bp. Based on sequence identity, as well as presence of conserved sequence motifs, the 18s rDNA sequences could be divided into 3 groups. Group I contains sequences from 6 clones, which share 98.4–99.7% sequence identity. Group II contains sequences from 9 clones, which share 97.5%–99.6% sequence identity, and Group III contains sequences from 11 clones, which share 98.2–99.8% sequence identity. It is clear from these data that groups I and II are quite divergent, sharing only 95.7–96.8% sequence identity, whereas groups I and III are more similar to one another, sharing 97.5–98.9%. Sequences belonging to Group I were obtained only from oocyst Sample 1, whereas sequences

Cox-1 sequences from Eimeria spp. of turkeys, pheasants, and chukars Thirty-nine clones containing the cox-1 gene were sequenced from the 2 samples of turkey oocysts, and their length ranged between 804 and 810 bp. Based on sequence identity, as well as presence of conserved motifs, the 18s rDNA could be divided into 2 groups. Group I contains sequences from 15 clones, which share 99.3–100% identity, and Group II contains sequences from 24 clones, which share 99–100% identity. The identity among groups I and II ranges between 93.6 and 94.4%. Sequences belonging to Group I were found only in oocyst Sample 2, whereas sequences belonging to Group II were found in both oocyst samples. It is most likely that Group I and II sequences are derived from separate Eimeria species that are infectious to turkeys. Fifteen clones encoding a portion of the cox-1 gene from Eimeria sp. collected from chukars were sequenced. Ten of these were obtained from Sample 1, and 5 were obtained from Sample 2. Again, as seen with 18s rDNA, length of these clones was highly conserved ranging from 808 to 809 bp. The sequence identity among clones ranged between 99 and 100%. Thirteen clones encoding cox-1 from Eimeria sp. collected from pheasants were sequenced. These sequences were all 809 bp in length, and the nucleotide identity ranged between 99.3 and 100%. The cox-1 sequences are not as conserved as 18s rDNA sequences. However, once again it is surprising to note that E. tenella and E. necatrix share more sequence identity with turkey Eimeria spp. than with other Eimeria species that infect chickens. Also, the 2 groups of sequences isolated from turkeys that presumably represent separate species appear to be highly

984

THE JOURNAL OF PARASITOLOGY, VOL. 96, NO. 5, OCTOBER 2010

FIGURE 1. Phylogenetic trees reconstructed using (A) NJ and (B) ML of 18s rDNA sequences from galliform birds and 2 species of cranes. Sequences from cranes was used as an outgroup. Bootstrap values confirming branching order are shown next to each node.

divergent from each other. For example, Group I sequences from the turkey share more sequence identity with Eimeria sp. from pheasants than with Group II turkey Eimeria spp. Phylogenetic analysis The phylogenetic analysis of the 18s rDNA is shown in Figure 1. Figure 1A shows the results of the NJ analysis, and Figure 1B shows the results of ML analysis. Sequences from Eimeria species of cranes (Eimeria reichenowi and Eimeria gruis) were used as an outgroup for the galliform sequences. Eimeria species from galliform birds form a single clade; Eimeria species from chukars form a basal clade with 100% bootstrap support. The other major groupings are formed by chicken Eimeria spp. sequences, which include Eimeria maxima, Eimeria mitis, Eimeria mivati, Eimeria brunetti, E. acervulina, and Eimeria praecox. Thus, all of the Eimeria species that infect the mid- to upper intestine in the chicken form a single clade, with 93% bootstrap support in the NJ analysis; this relationship is also conserved in the ML analysis. The second clade consists of Eimeria sequences from pheasants and turkeys, as well as E. tenella and E. necatrix that infect chickens, with bootstrap support of 67%. Eimeria tenella and E. necatrix form a sister relationship with 100% bootstrap support. Again, these relationships are maintained in the ML analysis. Also, the turkey and pheasant sequences form sister clades; however, the support for that relationship is only 43%. The low bootstrap support for the turkey and pheasant pairing is reflected in the ML analysis, which does not maintain this pairing. Given

the amount of sequence diversity in the 18s rDNA gene from Eimeria spp. of turkeys, it is very likely that multiple species are represented. Based on the sequence analysis, at least 3 species, and perhaps more, were present in the 2 litter samples from turkeys analyzed in this study. The single litter sample obtained from pheasants yielded 2 distinct groups of 18s rDNA sequences that are highly supported in both phylogenetic analyses. The Eimeria sp. sequences obtained from litter of chukars appear to be derived from a single species of Eimeria. The phylogenetic analysis carried out using cox-1 sequences is shown in Figure 2. Figure 2A shows the results of the NJ analysis, and Figure 2B shows the results of ML analysis. These trees are unrooted since only cox-1 sequences have been published from Eimeria species of galliform birds, namely, chickens. Therefore, much fewer data are available for cox-1 compared to 18s rDNA. Once again, E. tenella and E. necatrix from chickens grouped with Eimeria spp. sequences from turkey and pheasants, with 100% bootstrap support. Again, this relationship is conserved in the ML analysis. In the cox-1 analysis, Eimeria species from chukars grouped with sequences from E. maxima and E. mivati with 82% bootstrap support, with E. acervulina sequences forming a neighboring branch to cox-1 sequences from chukar Eimeria sp. However, in the ML analysis of cox-1 sequences Eimeria species sequences from chukars and E. acervulina are reversed compared to the NJ analysis. Based on the branching pattern, it is likely that the cox-1 sequences from turkey Eimeria spp. turkey represent 2 separate species, whereas sequences from chukars and pheasant represent a single species of Eimeria.

MISKA ET AL.—EVOLUTION OF EIMERIA INFECTIONS IN GALLIFORM BIRDS

985

FIGURE 2. Unrooted phylogenetic tree reconstructed using (A) NJ and (B) ML of cox-1 sequences from galliform birds. Bootstrap values confirming branching order are shown next to each node.

DISCUSSION Here we provide the first comparison of 18s rDNA and the cox1 gene of Eimeria species that infect domestic turkeys, pheasants, and chukars. Unfortunately, it was impossible to determine the precise species that were present in these litter samples. We attempted to sporulate the litter samples from chukars and pheasants in the lab; however, all attempts were unsuccessful. Therefore, it was impossible to identify the species present using morphological criteria. The oocyst samples from turkeys were thought to represent Eimeria adenoiedes and Eimeria meleagridis; however, after analysis of both the 18s rDNA, as well as cox-1 sequences, it was obvious that both oocysts samples contained multiple Eimeria species. This is not completely surprising because turkey Eimeria spp. are very similar to one another in oocyst size and location of infection, as well as prepatent time (Chapman, 2008). Single oocyst infections will need to be successfully undertaken to resolve this problem. Very little is known about the Eimeria species of game birds, even though coccidiosis can be a problem for farms that maintain game bird flocks. Once again, identifying and describing single species of Eimeria from either pheasants or chukars will necessitate single oocyst infection of birds and their subsequent propagation. Even though we were unable to match gene sequences to a particular species of Eimeria, the sequences themselves have proven to be very useful in expanding our knowledge of evolution of Eimeria species in galliform birds. Before this study, molecular data from Eimeria in galliform birds were limited to species that parasitize the chicken. Adding sequences from 3 separate host species suggests that chicken Eimeria spp. do not represent a monophyletic group. The 18s rDNA sequences indicate that E. tenella and E. necatrix, the 2 species that infect the ceca, are more closely related to Eimeria species that infect turkeys and pheasants

than to those that infect chickens. The cox-1 gene analysis also indicates that a close relationship exists between E. tenella, E. necatrix, and Eimeria spp. from turkeys and pheasants. In the cox-1 analysis of chukar Eimeria sp., E. acervulina also differs from chicken intestinal species, whereas in the 18s rDNA analysis the chukar Eimeria sequences are basal to those from other galliform birds. This discrepancy could be due to a difference of the rate of mitochondrial gene mutation among these species, or simply because the cox-1 data set is not as complete as the 18s rDNA data set. Since the ML analysis of cox-1, as well as the NJ and ML analyses of 18s sequences, favor the placement of E. acervulina closer to E. mivati and E. maxima, it is most likely that this is the true placement of this species. All trees constructed are congruent with the sister relationship of E. necatrix and E. tenella to the Eimeria spp. of turkeys and pheasants. These data, therefore, imply that the Eimeria species that infect chickens are not descended from a single ancestral species, but perhaps from at least 2 separate lineages. It is possible that cecal chicken Eimeria spp. are more closely related to Eimeria species from other hosts that infect the lower regions of the intestine. However, to confirm this hypothesis, further work will be necessary utilizing pure Eimeria species from different regions of the gut of turkeys and pheasants. ACKNOWLEDGMENTS The authors wish to acknowledge the expert technical assistance of D. Hawkins-Cooper. We also thank Dr. Eva Pendleton-Smith, who provided eimerian oocysts.

LITERATURE CITED ALLEN, P. C., AND R. H. FETTERER. 2002. Recent advances in biology and immunobiology of Eimeria species and in diagnosis and control of

986

THE JOURNAL OF PARASITOLOGY, VOL. 96, NO. 5, OCTOBER 2010

infection with these coccidian parasites of poultry. Clinical and Microbiological Reviews 15: 58–65. ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, AND D. J. LIPMAN. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403–410. BARTA, J. R., D. S. MARTIN, P. A. LIBERATOR, M. DASHKEVICZ, J. W. ANDERSON, S. D. FEIGHNER, A. ELBRECHT, A. PERKINS-BARROW, M. C. JENKINS, H. D. DANFORTH, ET AL. 1997. Phylogenetic relationships among eight Eimeria species infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. Journal of Parasitology 83: 262–271. CHAPMAN, H. D. 2008. Coccidiosis in the turkey. Avian Pathology 37: 205–223. FELSENSTEIN, J. 1981. Evolutionary trees from DNA sequences: A maximum likelihood approach. Journal of Molecular Evolution 17: 368–376. NORTON, C. C. 1976. Coccidia of the pheasant. Folia Veterinaria Latina 6: 218–238. POSADA, D., AND K. A. CRANDALL. 1998. MODELTEST: Testing the model of DNA substitution. Bioinformatics 14: 817–818.

RUFF, M. D. 1987. Coccidiosis in game birds. Veteterinary and Human Toxicology 29: 71–72. SAITOU, N., AND M. NEI. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406–425. SWOFFORD, D. L. 1998. PAUP*: Phylogenetic analysis using parsimony (* and other methods), version 4.0 beta. Sofware distributed by Sinauer, Sunderland, Massachusetts. TAMURA, K., J. DUDLEY, M. NEI, AND S. KUMAR. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–1599. THOMPSON, J. D., T. J. GIBSON, F. PLEWNIAK, F. JEANMOUGIN, AND D. G. HIGGINS. 1997. The ClustalX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid Research 24: 4876–4882. TRAVERSA, D., F. COSTANZO, R. IORIO, I. AROCH, AND E. LAVY. 2007. Mitochondrial cytochrome c oxidase subunit 1 (cox-1) gene sequence of Spirocerca lupi (Nematoda, Spirurida): Avenues for potential implications. Veterinary Parasitology 146: 263–270.