Eur J Plant Pathol (2015) 141:839–845 DOI 10.1007/s10658-014-0580-9
Molecular characterization of Apple mosaic virus isolates from apple and rose Natallia Valasevich & Mirosława Cieślińska & Elena Kolbanova
Accepted: 14 December 2014 / Published online: 23 December 2014 # Koninklijke Nederlandse Planteziektenkundige Vereniging 2014
Abstract Apple mosaic virus (ApMV) is one of the important viruses of apple and rose. Although the virus occurs worldwide the information on the virus presence in Poland and Belarus is limited. Genetic diversity of ApMV isolates from apple originated from Poland and Belarus as well as rose isolates from Poland was investigated based on phylogenetic analyses of movement protein (MP) and coat protein (CP) genes. Comparison of CP gene sequences showed the high sequence identity of the studied ApMV isolates and their clustering with apple and pear strains of ApMV deposited in the GenBank database. There was no correlation between the geographical origin and CP gene sequence variability of Polish and Belarusian ApMV isolates. Keywords ApMV . ELISA . RT-PCR . Phylogenetic analysis
Introduction Apple mosaic virus (ApMV), a member of the genus Ilarvirus, subgroup III of Bromoviridae family occurs N. Valasevich (*) : E. Kolbanova Department of Biotechnology, Institute for Fruit Growing, Kovaleva 2, Samochvalovichi 223013, Belarus e-mail:
[email protected] M. Cieślińska Virology Section, Department of Plant Protection, Research Institute of Horticulture, Konstytucji 3 Maja 1/3, 96-100 Skierniewice, Poland
worldwide on woody plants of over 65 species including apple (Malus domestica), rose (Rosa spp.), hop (Humulus lupulus), silver birch (Betula pendula), hazelnut (Corylus avellana), cherry, plum, peach, apricot, almond (Prunus spp.), blackberry and raspberry (Rubus spp.) and strawberry (Fragaria x ananassa) (Aramburu and Rovira 1998; Gottlieb and Berbee 1973; Lakshmi et al. 2011; Tzanetakis and Martin 2005; Wong and Horst 1993). ApMV is transmitted through vegetative propagation of infected buds, scion or rootstocks, and by mechanical inoculations of sap extracts onto herbaceous indicator hosts but not through seeds, pollen or vector. ApMV is known to cause a mosaic disease of apple in several countries (Caglayan et al. 2006; Mahfoudhi et al. 2013; Pūpola et al. 2011; Svoboda and Polak 2010). An apple tree infected with the ApMV display symptoms of pale to bright cream spots on the leaves (Choi and Ryu 2003). The infected leaves may be depicted throughout the whole tree or only on a single tree branch. Most commercial cultivars are affected, but vary in severity of symptoms. An infected apple tree may have a crop yield reduction of up to 60 % (Menzel et al. 2002). ApMV is one of several viruses associated with rose mosaic disease (RMD). RMD is caused by infection with any of a number of different viruses but the most common causal agents are Apple mosaic virus (ApMV), Prunus necrotic ringspot virus (PNRSV) from the genus Ilarvirus and Arabis mosaic virus (ArMV) from the genus Nepovirus. The symptoms are highly variable among rose cultivars and are strongly influenced by weather and growing conditions. The most
840
Eur J Plant Pathol (2015) 141:839–845
often observed symptoms include chlorotic bands or ringspots, wavy lines, yellow vein banding, oak-leaf pattern, and general mosaic. Infected plants show decreased vigour and reduced flower production on shorter stems, have poorer transplant survival rates, and are more susceptible to frost (Thomas 1984). The ApMV genome consists of three molecules of single-stranded (ss) RNA. RNA 1 (3476 nucleotides (nt) long) and RNA 2 (about 2979 nt), encode a single large open reading frame (Shiel and Berger 2000). RNA 3 complete sequence is about 2056 nucleotides long and contains two open reading frames encoding the movement protein (MP, 287 aa) and the coat protein (CP, 224 aa) (Shiel et al. 1995). The CP is expressed from a subgenomic RNA 4 (Sanchez-Navarro and Pallas 1994). Since no information was available on genetic variability of ApMV isolates from apple and rose in Poland and Belarus, these issues were addressed in the present study. Molecular diversity of Polish and Belarusian ApMV isolates from apple and rose isolates found in Poland was investigated based on phylogenetic analysis. Isolates from different cultivars of apple and rose (Table 1) were collected for the study based on symptomatology and double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) and/or
reverse transcription – polymerase chain reaction (RTPCR) results. Asymptomatic leaves of 39 apple cultivars growing at the orchards of the Institute for Fruit Growing (Samochvalovichi, Belarus) and nine cultivars from the orchard of the Brest Regional Research Station (BRRS) in Pruzhany were collected in May – beginning of June in 2012 and 2013. The leaf samples were tested by DAS-ELISA using a commercial antiserum (Sediag). Apple isolates from Poland were obtained from symptomatic leaves of apple trees previously known as infected with ApMV and growing at the germplasm collection of the Research Institute of Horticulture (Skierniewice, Poland), excluding isolate Prud1 collected in private orchard in south-east part of Poland. Asymptomatic leaves of rose plants from the collection of the Botanical Garden of Warsaw University (Warsaw) were collected in May 2013 to test for the presence of ApMV virus by RT-PCR. Total nucleic acids extracted by adsorption on silica gel according to Boom et al. (1990) with adaptations by Malinowski (1997) were subjected to a reverse transcription-polymerase chain reaction (RT-PCR) using SuperScriptIII™ One-Step RT-PCR with Platinum® Taq (Invitrogen). Four sets of primers specific to fragments of the ApMV genome were used in
Table 1 ApMV isolates used for investigations Name of isolate
Cultivar
Plant-host of the isolate
Country
Place
Year
Minsk
Minskoje
Malus domestica
Belarus
Samochvalovichi
2012
Zaslav
Zaslavskoje
Malus domestica
Belarus
Samochvalovichi
2012
Pospeh
Pospeh
Malus domestica
Belarus
Pruzhany
2013
Cham1
Champion
Malus domestica
Belarus
Pruzhany
2013
Cham2
Champion
Malus domestica
Belarus
Pruzhany
2013
Cham3
Champion
Malus domestica
Belarus
Pruzhany
2013
Cham4
Champion
Malus domestica
Belarus
Pruzhany
2013
Prud1
–
Malus domestica
Poland
Prudnik
2012
29IV3
Celica Welbo
Malus domestica
Poland
Skierniewice
2012
26XX17
Kalvil Anisowyj
Malus domestica
Poland
Skierniewice
2012
26XIX12
Freyberg
Malus domestica
Poland
Skierniewice
2012
26I1
Winter Rambour
Malus domestica
Poland
Skierniewice
2012
26XII7
Gruss am Mailand
Malus domestica
Poland
Skierniewice
2012
Pussta
Pussta
Rosa sp.
Poland
Warsaw
2013
March
Marchenland
Rosa sp.
Poland
Warsaw
2013
Erotica
Erotica
Rosa sp.
Poland
Warsaw
2013
Canasta
Canasta
Rosa sp.
Poland
Warsaw
2013
Eur J Plant Pathol (2015) 141:839–845
this study (Table 2). Two pairs of primers (3ApMV20F/ 3ApMV1031R and 3ApMV888F/3ApMV2035R) were used for amplification of the complete RNA 3. The thermal cycling scheme for amplification of MP and CP genes was: 30 min at 47 °C, 2 min at 94 °C, 40 cycles of 1 min at 94 °C, 45 s at 50 °C, 1–1.5 min at 68 °C, followed by a final incubation of 5 min at 68 °C. Annealing temperature for amplification with primers 3ApMV20F/3ApMV1031R specific for MP gene was 48 °C, while with primer pair 3ApMV888F/ 3ApMV2035R specific for CP gene - 53 °C. ApMVinfected rose samples were also tested by silica capture RT-PCR (SC-RT-PCR) using PNRSV-F/PNRSV-R primers for the presence of PNRSV virus. RT-PCR products were resolved by electrophoresis in 1.2 % agarose gel, stained with ethidium bromide and visualised on UV transilluminator (Syngen, Cambridge, England). Amplified fragments of ApMV isolates were sequenced by Genomed S.A. company (Poland) and analysed using Lasergene 7.1 (DNASTAR) and MEGA 4.0 (Tamura et al. 2007). Genetic relationship of ApMV isolates was investigated by sequence comparison with isolates available in EMBL/GenBank database. The Clustal W algorithm was used for multiple alignments of the sequences. Phylogenetic trees were built by the neighbour-joining method with the Maximum Composite Likelihood model. Bootstrap analysis with 1000 replicates was performed to test the robustness of the internal branches. The apple trees ‘Minskoje’, ‘Zaslavskoje’, ‘Pospeh’ and ‘Champion’ cvs were positively tested for ApMV by DAS-ELISA. The virus was detected in 1.1 % (out of
841
173 tested trees two were infected) and 3.7 % (out of 133 tested trees five were infected) samples collected in the orchards of the Institute for Fruit Growing and BRRS respectively. The presence of ApMV in seven ELISA-positive apple samples from Belarus was confirmed by RT-PCR with primers’ pairs ApMVup/ ApMVd and ApMVup1061/ApMVd1845 specific to MP and CP genes of the virus, respectively. Amplified products of expected size (860 bp and 784 bp for MP and CP gene, correspondently) were also obtained for six Polish isolates of ApMV from apple. Out of 24 tested rose plants 17 plants of four cultivars (‘Marchenland’, ‘Pussta’, ‘Canasta’, ‘Erotica’) were found to be positive after amplification with primers specific to CP gene. Four rose isolates of the virus were selected for further investigation. MP gene fragment of rose isolates were not possible to amplify with primers ApMVup/ApMVd. The amplified fragments of the genome of nine apple and one rose isolates of the virus were sequenced and deposited to the EMBL database (acc. no. HG328255HG328259, HG328261-HG328267, HG328269HG328271, HG328280, HG328281). The nearly complete nucleotide sequences of RNA 3 (1933 nt) were determined for two ApMV isolates: Zaslav (Belarus) and 26XII7 (Poland). Sequences’ comparison revealed a high level of nucleotide identity among the both apple isolates (99.1 %). It was also shown that they shared 94.1–94.4 % identity with nucleotide sequence of the apple isolate from USA (acc. no. U15608.1). Nucleotide sequences of MP and CP genes were obtained for three apple isolates of the virus from
Table 2 Primers used for amplification and sequencing of the genome fragments of ApMV isolates Primer
Sequence
Genome location (nucleotide position)*
Size of RT-PCR product
References
784 bp
This study
860 bp
Lakshmi et al. 2011
1011 bp
This study
ApMVup1061
TAGTCGCGAGCGTTTTATTTTCAT
1060–1083
ApMVd1845
CTTCGAGCTTCACAGTCCT
1825–1843
ApMVup
ATGACAACACTGGGAGATAAAC
169–190 1011–1029
ApMVd
TCATCCGCTTATATTTCCAATG
3ApMV20F
TCGATCGATTCCTTTGTA
20–37
3ApMV1031R
GTTCATCCGCTTATATTTCCATTG
1008–1031
3ApMV888F
GACGATAAAGCCCAAAGAAGAACC
888–911
3ApMV2035R
CCTCCTAATCGGGGCATCAAT
2015–2035
1147 bp
*Primers location is given based on the complete RNA-3 sequence of ApMV isolate from apple (acc. no. U15608.1)
842
Eur J Plant Pathol (2015) 141:839–845
Belarus and six isolates from Poland (Fig. 1 and Fig. 2). Sequences of four rose isolates were determined for CP gene only. Nucleotide sequence of MP gene consisting of 706 nucleotides (235 amino acid (aa) residues) was started from 79 nt position of the gene coding area and ended at the position 784 of this region. Comparison of the sequence of MP gene fragments of apple isolates revealed a high level of similarity (98.8–100 %) with a maximum of eight nucleotide substitutions. It was found that the nucleotide sequences of this region of 26XIX12 and Zaslav apple isolates were identical. Apple isolates from Poland and Belarus shared 92.2–98.2 % nt identity with apple isolates from India, USA and China deposited in EMBL/GenBank database but formed distinct subgroup (bootstrap value 91 %) within the cluster of ApMV isolates from apple (Fig. 1). Comparison of amino acid sequences showed substitutions in three positions of the Polish and Belarusian isolates. The sequences of the complete CP gene determined in this study consisted of 672 nucleotides coding 224 amino acid residues. Sequences of this region of the studied apple isolates revealed a high level of identity (97.7–99.9 %) and, depending on isolate, consisted from
1 to 17 nt substitutions. ApMV isolates from rose showed 100 % identity of CP gene and shared 97.7– 99.4 % similarity with apple isolates. Comparison of CP gene sequences at amino acid level showed 89.6–100 % identity among the studied isolates and publicly available sequences of ApMV. Phylogenetic analysis of coat protein gene sequence showed that Polish and Belarusian isolates were genetically related to isolates from apple, pear and cherry (bootstrap value 93 %) and formed a separate sub-cluster (bootstrap value 82 %) with apple isolate (acc. no. GQ131805) from Brazil and pear isolates (acc. no. AY542543 and AY542542) from the Czech Republic (Fig. 2). The CP gene sequences mainly varied at the first 100 amino acids and it could be caused by insertion or deletion. The presence of a 5-aa-deletion after the 45 aa position in the CP gene coding region was noticed in isolates obtained from hop, peach, elder, apricot and hazel, while in this region of the isolates from apple and pear the deletion did not occur. This result corresponds to the data obtained by Lee et al. (2002) and Petrzik and Lenz (2002). There was no correlation between the 5-aa-deletion and the host plant of the isolate as this deletion was identified in many plant
Fig. 1 Neighbour-joining analysis showing predicted relationships between Apple mosaic virus (ApMV) isolates based on the nucleotide sequences of MP gene fragment. Sequence DQ003584.2 of the Prunus necrotic ringspot virus (PNRSV)
was used as an outgroup. Numbers represent bootstrap values out of 1000 replicates. Bootstrap values lower than 70 % are not shown. The scale shows substitutions/site
Eur J Plant Pathol (2015) 141:839–845
843
Fig. 2 Neighbour-joining analysis showing predicted relationships between Apple mosaic virus (ApMV) isolates based on the nucleotide sequences of CP gene fragment. Sequence DQ003584.2 of the Prunus necrotic ringspot virus (PNRSV)
was used as an outgroup. Numbers represent bootstrap values out of 1000 replicates. Bootstrap values lower than 70 % are not shown. The scale shows substitutions/site. Isolates from this study are marked
species infected by ApMV. The presence of the deletion didn’t influence on the phylogenetic clustering of ApMV isolates. Apple mosaic virus is one of the economically important viruses infecting a wide range of plants including apple and rose. A preliminary study
showed that the frequency of the virus in Belarus was relatively low as ApMV was detected in 1.1 % of the samples collected from apple trees growing in the central part (Samochvalovichi) and in 3.7 % of the samples from the south part (Pruzany) of the country. ApMV presence was reported in several
844
countries and its prevalence varied depending on the geographical region. Although, the virus was not found in 22 apple varieties and four apple rootstocks from germplasm collection in Lithuania (Stankiene et al. 2012), it was detected in 17 % of tested apple trees in the Czech Republic (Svoboda and Polak 2010) and 5.7 % in Morocco (Afechtal et al. 2010). In India, the frequency of the virus was 24 and 28 % depending on the region of the country (Lakshmi et al. 2011). In Turkey, the rate of ApMV infection in apples varied from 9.7 % in Malatya Province to 68 % in Central Anatolia (Akbaş and İlhan 2005; Korkmaz et al. 2013). Pūpola et al. (2010) reported that the ELISA test commonly used for large-scale screening was less reliable for ApMV detection than RT-PCR. In Latvia, ApMV was detected in 2.1 % of samples from apple trees tested by ELISA while using RT-PCR increased the number of the positively tested samples up to 22 %. Low sensitivity of the ELISA test could be caused by the low virus titre, inhibitory effects of polysaccharides or phenolic compounds, and high sensitivity of the virus to temperature fluctuation Kobylko et al. (2005). ApMV infects also rose and together with PNRSV is a causal agent of rose mosaic disease. In Poland, the first report on ApMV in rose was published by PaduchCichal (2003). Further study showed that ApMV was detected by DAS-ELISA in several rose cultivars growing in the Botanical Garden of Warsaw University (BGWU, Warsaw) (Paduch-Cichal et al. 2006). In this study we confirmed the presence of ApMV in four out of five tested rose cultivars from the BGWU (Warsaw) using SC-RT-PCR with primers specific to CP gene of the virus even though the evident symptoms of ApMV infection were not observed on the leaves of tested plants. The previous study on rose mosaic disease indicated that, although the disease is caused by a complex of several viruses, PNRSV is the main agent responsible for the appearance of characteristic symptoms (Sertkaya 2010). In our research PNRSV was not found in ApMVinfected rose samples when SC-RT-PCR technique was used. Sequencing of amplified fragments of ApMV genome of investigated apple and rose isolates confirmed the presence of the virus. Sequence analysis revealed a high level of identity in both MP and CP regions of the apple isolates Zaslav from Belarus and 26XII7 from Poland.
Eur J Plant Pathol (2015) 141:839–845
Phylogenetic analysis of MP gene sequences showed that our apple isolates were closely related with apple isolate from India and formed a well-supported group (bootstrap value 95 %). ApMV isolates from rose were closely related to the studied apple isolates and revealed 100 % identity of CP gene among each other. Results of the previous studies on CP gene sequence of ApMV suggested that the virus strains co-evolve with their host plants and that may result in CP heterogeneity (Lakshmi et al. 2011; Lee et al. 2002). Lee et al. (2002) classified ApMV isolates into three subgroups (I, II, and III) originating from apple, hop/pear and almond, respectively. However, Lakshmi et al. (2011) reported that clustering of Indian isolates from apple and other hosts according to Lee et al. (2002) was not so clear and proposed another classification of ApMV isolates. According to this system, apple and cherry strains from India belong to subgroup I, pear isolate from the Czech Republic and one of the Indian isolates from apple formed subgroup II, apple isolates from the Czech Republic were classified to subgroup III, while apple isolates from USA and Korea belonged to subgroup IV, and isolates from Prunus sp., pear, hop and almond belonged to subgroup V. Recently, Grimová et al. (2013) classified the known ApMV isolates into two main clusters and two single-standing isolates from almond and an unknown Chinese host. Cluster I included isolates from different plant species (hop, hazel, peach, apricot, prune, mahaleb cherry, elder) while cluster II included isolates from apple, pear and lichen Trebouxia sp. In our study all Polish and Belarusian isolates grouped together and formed a common cluster with strains classified by Grimová et al. (2013) to IIb subcluster and classified by Lakshmi et al. (2011) to subgroup II. There was no correlation between the geographical origin and CP gene sequence variability of the ApMV isolates from Poland and Belarus. A similar conclusion was drawn by Grimová et al. (2013) based on results of phylogenetic analysis of ApMV isolates from many different geographical regions and plant hosts. To our knowledge this is the first report on detection of ApMV in apple in Poland and Belarus, as well as in rose in Poland using molecular biology techniques. Acknowledgments This study was supported by the International Visegrad Fund Scholarship - Visegrad 4 Eastern Partnership Program.
Eur J Plant Pathol (2015) 141:839–845
References Afechtal, M., Djelouah, K., & D’Onghia, A. M. (2010). The first survey of pome fruit viruses in morocco. In: proceedings 21st international conference on virus and other graft transmissible disease of fruit crops, 5–10 July 2009, Neustadt, Germany. Julius-Kühn-Archiv, 427, 253–256. Akbaş, B., & İlhan, D. (2005). Widespread distribution of Apple mosaic virus on apple in Turkey. Plant Disease, 89, 1010. Aramburu, J., & Rovira, M. (1998). The effects of apple mosaic ilarvirus (ApMV) on hazelnut (Corylus avellana L.). Journal of Horticultural Science and Biotechnology, 73, 97–101. Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-Van Dillen, P. M. E., & Van Der Nordaa, J. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology, 28, 495–503. Caglayan, K., Ulubas Serce, C., Gazel, M., & Jelkmann, W. (2006). Detection of four apple viruses by ELISA and RTPCR assays in Turkey. Turkish Journal of Agriculture and Forestry, 30, 241–246. Choi, S. H., & Ryu, K. H. (2003). Rapid screening of Apple mosaic virus in cultivated apples by RT-PCR. The Plant Pathology Journal, 19, 159–161. Gottlieb, A. R., & Berbee, J. G. (1973). Line pattern of birch caused by Apple mosaic virus. Phytopathology, 63, 1470– 1477. Grimová, L., Winkowska, L., Ryšánek, P., Svoboda, P., & Petrzik, K. (2013). Reflects the coat protein variability of Apple mosaic virus host preference? Virus Genes, 47, 119–125. Kobylko, T., Nowak, B., & Urban, A. (2005). Incidence of Apple mosaic virus (ApMV) on hazelnut in south-east Poland. Folia Horticulturae, 17, 153–161. Korkmaz, G., Sipanioglu, H. M., & Usta, M. (2013). Survey of Apple mosaic virus in apple-growing provinces of east Anatolia (Malatya and Van) by RNA probe hybridization assay and RT-PCR. Turkish Journal of Agriculture and Forestry, 37, 711–718. Lakshmi, V., Hallan, V., Ram, R., Ahmed, N., Zaidi, A. A., & Varma, A. (2011). Diversity of Apple mosaic virus isolates in India based on coat protein and movement protein genes. Indian Journal of Virology, 22, 44–49. Lee, G. P., Ryu, K. H., Kim, H. R., Kim, C. S., Lee, D. W., Kim, J. S., Park, M. H., Noh, Y. M., Choi, S. H., Han, D. H., & Lee, C. H. (2002). Cloning and phylogenetic characterization of coat protein genes of two isolates of apple mosaic virus from ‘Fuji’ apple. The Plant Pathology Journal, 18, 259–265. Mahfoudhi, N., El Air, M., Moujaned, R., Salleh, W., & Djelouah, K. (2013). Occurrence and distribution of pome fruit viruses in Tunisia. Phytopathologia Mediterranea, 52, 136–140. Malinowski, T. (1997). Silicacapture-reverse transcription-polymerase chain reaction (SC-RT-PCR): application for the detection of several plant viruses. In: proceedings of 4th International EFPP symposium, 9–12 September 1996, Bonn, Germany. Diagnosis and identification of plant pathogens, 11, 445–448. Menzel, W., Jelkmann, W., & Maiss, E. (2002). Detection of four apple viruses by multiplex RT-PCR assays with
845 coamplification of plant mRNA as internal control. Journal of Virological Methods, 99, 81–92. Paduch-Cichal, E. (2003). First report of occurrence of viruses on some field-grown rose cultivars in Warsaw. Phytopathologia Polonica, 28, 53–62. Paduch-Cichal, E., Szyndel, M. S., & Sala-Rejczak, K. (2006). The occurrence of viruses in field-grown rose cultivars in botanical garden of polish academy of science and botanical garden of Warsaw University. Biuletyn Ogrodów Botanicznych, 15, 111–116. Petrzik, K., & Lenz, O. (2002). Remarkable variability of Apple mosaic virus capsid protein gene after nucleotide position 141. Archives of Virology, 147, 1275–1285. Pūpola, N., Kale, A., Jundzis, M., & Moročko-Bičevska, I. (2010). The occurrence of Ilarviruses in Latvian fruit orchards. In: proceedings 21st international conference on virus and other graft transmissible disease of fruit crops, 5–10 July 2009, Neustadt, Germany. JuliusKühn-Archiv, 427, 263–267. Pūpola, N., Moročko-Bičevska, I., Kale, A., & Zeltinš, A. (2011). Occurrence and diversity of pome fruit viruses in apple and pear orchards in Latvia. Phytopathology, 159, 597–605. Sanchez-Navarro, J. A., & Pallas, V. (1994). Nucleotide sequence of apple mosaic ilarvirus RNA 4. Journal of General Virology, 75, 1441–1445. Sertkaya, G. (2010). An investigation on rose mosaic disease of rose in hatay-turkey. In: proceedings 21st international conference on virus and other graft transmissible disease of fruit crops, 5–10 July 2009, Neustadt, Germany. Julius-KühnArchiv, 427, 309–313. Shiel, P. J., & Berger, P. H. (2000). The complete nucleotide sequence of Apple mosaic virus (ApMV) RNA 1 and RNA 2: ApMV is more closely related to alfalfa mosaic virus than to other ilarviruses. Journal of General Virology, 81, 273– 278. Shiel, P. J., Airefai, R. H., Domier, L. L., Korban, S. S., & Berger, P. H. (1995). The complete nucleotide sequence of Apple mosaic virus RNA 3. Archives of Virology, 140, 1247–1256. Stankiene, J., Mazeikiene, I., Gelvonauskiene, D., Siksnianiene, J. B., & Bobinas, C. (2012). Virological assessment of stock planting material of apple and raspberry cultivars. Zemdirbyste-Agriculture, 99, 93–98. Svoboda, J., & Polak, J. (2010). Relative concentration of Apple mosaic virus coat protein in different parts of apple tree. Horticultural Science (Prague), 37, 22–26. Tamura, K., Dudley, J., Nei, M., & Kumar, S. (2007). MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24, 1596–1599. Thomas, B. J. (1984). Rose mosaic disease: symptoms induced in rose by grafting inoculation with both Prunus necrotic ringspot virus and Apple mosaic virus. Plant Pathology, 33, 155–160. Tzanetakis, I. E., & Martin, R. R. (2005). First report of strawberry as a natural host of Apple mosaic virus. Plant Disease, 89, 31. Wong, S. M., & Horst, R. K. (1993). Purification and characterization of an isolate of Apple mosaic virus from rose in the USA. Journal of Phytopathology, 139, 33–47.
