Molecular Characterization of In Vivo Adjuvant ... - Journal of Virology

JOURNAL OF VIROLOGY, Sept. 2010, p. 8369–8388 0022-538X/10/$12.00 doi:10.1128/JVI.02305-09 Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Vol. 84, No. 17

Molecular Characterization of In Vivo Adjuvant Activity in Ferrets Vaccinated against Influenza Virus䌤† Yuan Fang,1,2,3 Thomas Rowe,1,2 Alberto J. Leon,1 David Banner,2 Ali Danesh,2,3 Luoling Xu,2 Longsi Ran,2 Steven E. Bosinger,6 Yi Guan,5 Honglin Chen,5 Cheryl C. Cameron,2 Mark J. Cameron,2 and David J. Kelvin1,2,3,4* Division of Immunology, International Institute of Infection and Immunity, Shantou University Medical College, 22 Xinling Road, Shantou, Guangdong 515041, People’s Republic of China1; Division of Experimental Therapeutics, Toronto General Research Institute, University Health Network, 101 College Street, Toronto, Ontario M5G 1L7, Canada2; Department of Immunology, University of Toronto, Toronto, Ontario, Canada3; University di Sassari, Dipartimento di Scienze Biomediche, Sassari, Italy4; Division of Virology, International Institute of Infection and Immunity, Shantou University Medical College, 22 Xinling Road, Shantou, Guangdong 515041, People’s Republic of China5; and Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, Pennsylvania6 Received 30 October 2009/Accepted 30 May 2010

The 2009 H1N1 influenza pandemic has prompted a significant need for the development of efficient, single-dose, adjuvanted vaccines. Here we investigated the adjuvant potential of CpG oligodeoxynucleotide (ODN) when used with a human seasonal influenza virus vaccine in ferrets. We found that the CpG ODNadjuvanted vaccine effectively increased antibody production and activated type I interferon (IFN) responses compared to vaccine alone. Based on these findings, pegylated IFN-␣2b (PEG-IFN) was also evaluated as an adjuvant in comparison to CpG ODN and complete Freund’s adjuvant (CFA). Our results showed that all three vaccines with adjuvant added prevented seasonal human A/Brisbane/59/2007 (H1N1) virus replication more effectively than did vaccine alone. Gene expression profiles indicated that, as well as upregulating IFN-stimulated genes (ISGs), CpG ODN enhanced B-cell activation and increased Toll-like receptor 4 (TLR4) and IFN regulatory factor 4 (IRF4) expression, whereas PEG-IFN augmented adaptive immunity by inducing major histocompatibility complex (MHC) transcription and Ras signaling. In contrast, the use of CFA as an adjuvant induced limited ISG expression but increased the transcription of MHC, cell adhesion molecules, and B-cell activation markers. Taken together, our results better characterize the specific molecular pathways leading to adjuvant activity in different adjuvant-mediated influenza virus vaccinations. lymphocyte (CTL) activity. CpG ODN is a ligand of Toll-like receptor 9 (TLR9), which is expressed mainly by plasmacytoid dendritic cells (DCs) (pDCs), B lymphocytes, and monocytes/ macrophages. TLR9 stimulation by CpG can effectively induce type I IFN responses and augment humoral responses (34, 57). Type I IFN signaling is thought to be critical for the initiation of innate immune responses to viral infections, and IFN-stimulated genes (ISG), which include a variety of transcription factors, cytokines, and chemokines, appear to be involved in stimulating adaptive immunity and eliminating the virus from the host (65). As an adjuvant, type I IFN has been shown to induce higher levels of CTL proliferation and antibody secretion than alum and was equal to complete Freund’s adjuvant (CFA), considered to be the “gold-standard” adjuvant for use in animal models (53). However, the connections between gene-regulated immune protection and adjuvant-mediated vaccination are still unknown. In this study, the domestic ferret (Mustela putorius furo), a well-established model to study the pathogenicity of influenza virus (42), was used to better characterize adjuvant activity following influenza virus vaccination. CpG-adjuvanted influenza virus vaccination of ferrets resulted in an increased antibody response compared to that of vaccine alone. In addition, elevated ISG mRNA levels were observed at an early stage postimmunization, presumably in part due to IFN-␣ signaling activation. Based on these results and the known activities of

Influenza virus infection is a prominent threat to human health around the world and can cause severe morbidity and mortality in susceptible individuals due to acute respiratory disease. Among the approaches to limit severe illness caused by influenza virus, vaccination is a critical component in the prevention of the spread of infection. The human seasonal influenza virus vaccine usually includes antigens from different influenza virus subtypes, H1N1, H3N2, and influenza type B, which are predicted to circulate in the following flu season. However, this vaccine provides protection to only 75% of the vaccinated population (15), and the protection efficacy in immunized elderly individuals is lower than 50% (28). For over 70 years, adjuvants have been used to enhance antigen-specific immune responses. CpG oligodeoxynucleotide (ODN) and type I interferon (IFN) have been evaluated for their efficacy in commercial influenza virus vaccines (4, 53), with the general conclusion that adjuvant-mediated vaccines induce stronger antibody responses and elevated cytotoxic T-

* Corresponding author. Mailing address: Division of Immunology, International Institute of Infection and Immunity, Shantou University Medical College, 22 Xinling Road, Shantou, Guangdong 515041, People’s Republic of China. Phone and fax: (86)-754-88573991. E-mail: [email protected]. † Supplemental material for this article may be found at http://jvi .asm.org/. 䌤 Published ahead of print on 9 June 2010. 8369

8370

FANG ET AL.

type I IFN (38, 65), it was expected that type I IFN could also be an effective adjuvant in influenza virus vaccination. Pegylated IFN-␣2b (PEG-IFN), which has been approved for use in humans since 2001, was therefore tested for its adjuvant potential for flu vaccination in ferrets along with CFA, which activates innate immune responses partly through the NODlike receptor family member NOD2 (20, 27), to compare its effects on immune outcome and gene regulation to those of CpG and PEG-IFN. MATERIALS AND METHODS Animals. Male ferrets 4 to 6 months old were purchased from Marshall Bioresources (New York, NY) and maintained at the Animal Resources Centre (University Health Network, Toronto, Canada). Ferrets were routinely screened for influenza virus infection. Immunization. The 2007-2008 seasonal human flu vaccine Fluviral (ID Biomedical Corporation, Quebec, Canada), which contains 15 ␮g hemagglutinin (HA) of each inactivated influenza virus strain, A/Solomon Islands/3/2006 (H1N1), A/Wisconsin/67/2005 (H3N2), and B/Malaysia/2506/2004, in 0.5 ml was used. Fluviral vaccine (100 ␮l) was mixed with 100 ␮l of a total of 500 ␮g of class B CpG ODN (catalog number 10104; Coleypharma) 4 h before injection. Each group of ferrets was injected with either 200 ␮l of phosphate-buffered saline (PBS), 100 ␮l PBS plus 100 ␮l Fluviral vaccine, or 200 ␮l vaccine with CpG added. At day 35 following primary immunization, all ferret groups were boosted with Fluviral vaccine alone. All the animals were vaccinated through intramuscular (i.m.) injection. The Fluviral vaccine is abbreviated V2007 and the Fluviral vaccine administered with PBS and CpG is abbreviated V2007 alone and V2007 plus CpG in the text. The 2008-2009 seasonal human influenza virus vaccine Vaxigrip (Sanofi Pasteur Limited), which contains A/Brisbane/59/2007 (H1N1), A/Brisbane/10/2007 (H3N2), and B/Florida/4/2006, was mixed with 100 ␮l PBS containing 1 ␮g PEG-IFN-␣2b and 100 ␮l CFA before injection. Ferrets were also vaccinated intramuscularly with vaccine with CpG added, vaccine alone, and PBS. The abbreviations of the vaccinations are abbreviated V2008 alone, V2008 plus CpG, V2008 plus IFN, and V2008 plus CFA in the text. The amounts of CpG and CFA were chosen based on previous studies that showed optimal adjuvanticity with various antigens (50, 68). The dose of PEG-IFN (1 ␮g/kg of body weight) was chosen according to the manufacturer’s recommendations for the use of PEGIFN in humans (Unitron PEG; Schering-Plough). ELISA for anti-influenza virus antibodies. Serum from ferrets injected with PBS, V2007 alone, and V2007 plus CpG was collected at days 0, 14, 21, 28, and 35 after primary immunization and at day 7 after the second vaccine injection. Antibody responses were assessed by an enzyme-linked immunosorbent assay (ELISA). Briefly, ELISA plates were directly coated with the 2007-2008 Fluviral vaccine at 5 ␮g/ml overnight at room temperature. Plates were washed with PBS containing 0.05% Tween 20 (T-PBS) and blocked with 1% bovine serum albumin (BSA) for 1 h at 37°C. Antigen-coated plates were washed with T-PBS and incubated with 1:1,000-diluted serum samples overnight at 4°C. After washing with T-PBS, plates were incubated with goat anti-ferret immunoglobulin (IgM and IgG) horseradish peroxidase (HRP) conjugates (Rockland Immunochemicals) in a 1:10,000 dilution for 2 h at 37°C. The reaction was developed by o-phenylenediamine for 30 min, and the optical density was read at 450 nm. HI test. Ferret serum samples were treated with receptor-destroying enzyme (RDE) at 37°C overnight. Fresh turkey red blood cells (TRBC) were washed and diluted in PBS to a concentration of 0.5% (vol/vol). The nonimmunized and immunized ferret sera were serially diluted in PBS in 96-well V-bottom cell culture plates. The serially diluted sera from the groups vaccinated with PBS, V2007 plus PBS, and V2007 plus CpG were incubated with 25 ␮l (8 HA units/50 ␮l) of A/Solomon Islands/3, A/Wisconsin/67/2005, and B/Malaysia/2507/2004 strains (CDC, Atlanta, GA) separately for 15 min. Fifty microliters of 0.5% TRBC was then added, and the plates were incubated at room temperature for 30 min. The hemagglutination inhibition (HI) titer was the reciprocal of the highest serum dilution to completely prevent agglutination. The same assay was applied to the 2008-2009 vaccine-immunized ferret serum by using 8 HA units/50 ␮l of A/Brisbane/59/2007 (H1N1) and A/Brisbane/10/2007 viruses. MN assay. The neutralizing antibodies in serum of the Fluviral- and Vaxigripimmunized ferrets were determined by using the viruses A/Solomon Islands/3/ 2006 (H1N1) and A/Brisbane/59/2007 (H1N1), respectively, for analysis by a microneutralization (MN) assay as described previously by Rowe et al. (58). Briefly, the 50% tissue culture infectious dose (TCID50) of each virus was

J. VIROL. determined by titration in MDCK cells under biosafety level 2 (BSL-2) conditions. The serially 2-fold-diluted RDE-treated serum at a starting dilution of 1:10 was tested for neutralizing 100 TCID50/50 ␮l of each virus in the MDCK cell monolayer. The cytopathic effect was read after incubation for 20 h. Infection and monitoring of ferrets. All immunized ferrets and PBS control group animals were moved at least 4 days prior to infection to the BSL-2 animal holding area, where they were housed in cages contained in bioclean portable laminar-flow clean-room enclosures (Lab Products, Seaford, DE). Prior to infection, baseline temperatures were measured twice daily for at least 3 days. Ferrets were anesthetized with ketamine (25 mg/kg), xylazine (2 mg/kg), and atropine (0.05 mg/kg) by the intramuscular route and infected intranasally (i.n.) with a total of 1 ml of 106 50% egg infective doses (EID50) of virus/ml in PBS delivered to the nostrils. Temperatures were measured every day by using a subcutaneous implantable temperature transponder (BioMedic Data Systems, Inc., Seaford, DE). Preinfection values were averaged to obtain a baseline temperature for each ferret. The change in temperature (°C) was calculated at each time point for each animal. Clinical signs of sneezing (before anesthesia), inappetence, dyspnea, and level of activity were assessed once daily. A scoring system based on that described previously by Reuman et al. (56) was used to assess the activity level as follows: 0, alert and playful; 1, alert but playful only when stimulated; 2, alert but not playful when stimulated; 3, neither alert nor playful when stimulated. A relative inactivity index was calculated as follows: ⌺(day 1 to day 5) [score ⫹ 1]n/⌺(day 1 to day 5) n, where n equals the total number of observations. A value of 1 was added to each base score so that a score of 0 could be divided by a denominator, resulting in an index value of 1.0. All the infected animals were euthanatized by intracardiac injection of euthanasia V solution (1 ml/kg of body weight) at day 5 postinfection (p.i.). Tissues from nasal turbinates and major organs, including lung and spleen, were collected either in Trizol or in formalin for later analyses. Collection of nasal wash specimens and virus titration. Nasal wash specimens were collected on days 1, 2, 3, and 5 p.i. Ferrets were anesthetized as described above, and 0.5 ml of sterile PBS containing 1% bovine serum albumin and penicillin (100 U/ml), streptomycin (100 ␮g/ml), and gentamicin (50 ␮g/ml) was injected into each nostril and collected into a petri dish when expelled by the ferret. The volume was brought up to 1 ml with cold sterile PBS plus antibiotics. Sedated ferrets were weighed on day 0 and days 1, 2, 3, 4, and 5 p.i. To determine the viral load in the nasal washes, 20 ␮l supernatant of nasal wash was added to 180 ␮l virus culture Dulbecco’s modified Eagle’s medium (vDMEM), 1% BSA, 50 ␮g/ml gentamicin, 100 U/ml penicillin, 100 ␮g/ml streptomycin, 2.5 ␮g/ml amphotericin B)-cultured MDCK cells (2 ⫻ 105 cells/ml), followed by a 10-fold dilution on a 96-well cell culture plate. After incubation for 2 h, the medium was replaced with 200 ␮l/well fresh vDMEM, and the cells were cultured for 6 days. On day 6, 50 ␮l of the cultured medium from each well was transferred onto a V-bottom 96-well plate, and 50 ␮l of 0.5% TRBC was added to run an HI test. The virus titers expressed as TCID50/ml from each nasal wash sample were calculated by Reed-Muench method. Primer design and synthesis. Each gene primer was designed based on the conserved gene sequences obtained through alignments of the coding sequences from various species of dog (Canis lupus), domestic cat (Felis catus), human (Homo sapiens), cattle (Bos taurus), and/or pig (Sus scrofa). Primers were designed specifically for detecting the ferret target genes, including the paralog genes of each family, to produce a PCR product in the range of 60 to ⬃250 bp using Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www .cgi). The primers’ sequences (Table 1) have GC contents of between 40 and 60%, and penalties were set against self and pair complements to deter primerdimer formation. The primers were synthesized desalted under high-performance liquid chromatography (HPLC) purity by Operon (Huntsville, AL) and Invitrogen (Shanghai, China). The ferret-specific gene primers available at ATCC BEI Resources (http://www.beiresources.org) are listed in Table 1. Cloning and sequencing of partial coding sequences of ferret immune genes. PCR-amplified products of target genes were derived from mitogen-activated ferret (Mustela putorius furo) peripheral blood mononuclear cells (PBMCs), splenocytes, and lung tissue. Amplified PCR products were cloned by using the TOPO-TA cloning kit (Invitrogen, Burlington, Ontario, Canada) according to the manufacturer’s instructions. Sequencing was done by the laboratory at the International Institute of Infection and Immunity (Shantou, China). Sequences were analyzed by using the BLASTN program of the National Center for Biotechnology Information portal. Whole-blood collection, RNA extraction, and cDNA synthesis. Whole blood (1.5 ml) from each ferret was collected into a Paxgene tube (Qiagen) at days 1, 3, and 5 after first vaccination and day 7 after the second immunization. RNA was extracted and purified by use of the Qiagen Paxgene blood RNA kit according to the manufacturer’s instructions. RNA quality and concentration were

VOL. 84, 2010

ADJUVANT ACTIVITY IN SEASONAL FLU VACCINATION

8371

TABLE 1. Ferret-specific gene primers Primer

Caspase 4 F Caspase 4 R C1 Inhibitor F C1 Inhibitor R Hsp40 F Hsp40 R NFAT5 F NFAT5 R SOCS5 F SOCS5 R IRF2 F IRF2 R CD3 F CD3 R CD14 F CD14 R CRLF2 F CRLF2 R HLA-DRA_like F HLA-DRA_like R STAT3 F STAT3 R TLR2 F TLR2 R NFKBIA F NFKBIA R Sprouty 4 F Sprouty 4 R IFN-alpha F IFN-alpha R IFN-gamma F IFN-gamma R IFI35 F IFI35 R P52rIPK_like F P52rIPK_like R Mx1 F Mx1 R IL-1beta F IL-1beta R IL-4 F IL-4 R IL-6 F IL-6 R IL-8 F IL-8 R IL-16 F IL-16 R NKG7 F NKG7 R CXCL10/IP10 F CXCL10/IP10 R TNF-␣ F TNF-␣ R CXCR3 F CXCR3 R Beta-actin F Beta-actin R CCL5 F CCL5 R NF-␬B F NF-␬B R TLR3 F TLR3 R MyD88 F MyD88 R TRAF6 F

ATCC designation

ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC ATCC

NR-8075 NR-8076 NR-8079 NR-8080 NR-8081 NR-8082 NR-8083 NR-8084 NR-8087 NR-8088 NR-8091 NR-8092 NR-8097 NR-8098 NR-8103 NR-8104 NR-8109 NR-8110 NR-8115 NR-8116 NR-8121 NR-8122 NR-8123 NR-8124 NR-8125 NR-8126 NR-8127 NR-8128 NR-8133 NR-8134 NR-8137 NR-8138 NR-8141 NR-8142 NR-8143 NR-8144 NR-8147 NR-8148 NR-8149 NR-8150 NR-8151 NR-8152 NR-8153 NR-8154 NR-8155 NR-8156 NR-8157 NR-8158 NR-8159 NR-8160 NR-8161 NR-8162 NR-8167 NR-8168 NR-8169 NR-8170 NR-8171 NR-8172 NR-8173 NR-8174 NR-8177 NR-8178 NR-8179 NR-8180 NR-8181 NR-8182 NR-8183

GenBank accession no.

Sequence (5⬘–3⬘)

EU836041 EU836041 EU835994 EU835994 EU836010 EU836010 EU836021 EU836021 EU835993 EU835993 EU835486 EU835486 EF492054 EF492054 X/XM_843653 X/XM_843653 EU836018 EU836018 EU835995 EU835995 EU835482 EU835482 EU836009 EU836009 EU835992 EU835992 EU836020 EU836020 EF492061 EF492061 EF492064 EF492064 EU835487 EU835487 EU835488 EU835488 EU835483 EU835483 EU835490 EU835490 EF492062 EF492062 EF492063 EF492063 EU477256 EU477256 EU835491 EU835491 EU836023 EU836023 EF492058 EF492058 EF492065 EF492065 EF492060 EF492060 EU836011 EU836011 EU835495 EU835495 EU835494 EU835494 EU835984 EU835984 EU836043 EU836043 EU836040

TCATTGCTTTCTGCTCCTCA ATCTGGGCTTTCACATCTGG GCCTCTCAGAGCCTGTATGG CTTCCACTTGGCACTCAGGT CCACCGTGTCGAGCTTTATT CATGAACGTTGGACTGGTTG ACCTCTTCCAGCCCTACCAT CCTCTTCGGTGTTGATGGAT GTTAGCTCCCGGAATGACTG CTTTCCAAGCTCCCTGTCTG AGGTGACCACCGAGAGTGAC CCCCATGTTGCTGAGGTACT GGCGGTGGCTGCAATC TCCAGTAATAGACCAGCAGAAGCA AGTGCCATCGAGGTGGAGAT GCGTACTGCTTCGGGTCTGT GGCTTGGATGCTGAGAAATGTT GGGCCATAGCTGGACTCCAT GAGAGCCCAACATCCTCATCTG TCGAAGCCACGTGACATTGA CAACCCCAAGAACGTGAACT AGCCCACGTAATCTGACACC TCTTCTGGAGCCCATTGAGAA GTGTTCATTATCTTCCGCAGCTT CCAGCACCTCTACTCCATCC CATCAGCACCCAAAGACACC CAGCGGCTCTTGGACCAC ACTTACACTTCCCACAGG TCTCCATGTGACAAACCAGAAGA CAGAAAGTCCTGAGCACAATTCC TCAAAGTGATGAATGATCTCTCACC GCCGGGAAACACACTGTGAC GGGCTCCGGCTGAGTGA CCACCCCCATTTCTGGTCTT TACGATGCCGAACTTCTG TGCTCTCCTACAATTCTCC ACATCCTCAGGCAGGAGACA CAGGTCAGGCTTTGTCAAGA GGACTGCAAATTCCAGGACATAA TTGGTTCACACTAGTTCCGTTGA TCACCGGCACTTTCATCCA TTCTCGCTGTGAGGATGTTCA AGTGGCTGAAACACGTAACAATTC ATGGCCCTCAGGCTGAACT AAGCAGGAAAACTGCCAAGAGA GCCAGAAGAAACCTGACCAAAG CCCACTCGGACCTTCT GAGAGGAGCCAAAGGTCTCAA GCGAGCGGTGGAACCA CAGGTAGAACGACCAGGAGAAGA CTTTGAACCAAAGTGCTGTTCTTATC AGCGTGTAGTTCTAGAGAGAGGTACTC CCAGATGGCCTCCAACTAATCA GGCTTGTCACTTGGAGTTCGA TTTGACCGCTACCTGAGCAT GCCGACAGGAAGATGAAGTC TGACCGGATGCAGAAGGA CCGATCCACACCGAGTACTT GCTGCTTTGCCTACATTTCC CCCATTTCTTCTGTGGGTTG AGGATCGATCAAAGCCTGAA CCCTCACCAGGTAACAGAGC GATGACCTCCCAGCAAACAT GCACAATTCTGGCTCCAGTT GCGTTTTGATGCCTTCATCT GGCAAGACATCACGATCAGA AGATTGGCAACTTTGGGATG Continued on following page

8372

FANG ET AL.

J. VIROL. TABLE 1—Continued

Primer

TRAF6 R IRAK4 F IRAK4 R OAS1 F OAS1 R TLR4 F TLR4 R IRF7 F IRF7 R ISG20 F ISG20 R TLR9 F TLR9 R CASP8 F CASP8 R ICAM1 F ICAM1 R IL8RB F IL8RB R IRF1 F IRF1 R IRF4 F IRF4 R ISG15 F ISG15 R PKR F PKR R RIG-I F RIG-I R SOCS3 F SOCS3 R STAT2 F STAT2 R STAT1 F STAT1 R FCN1 F FCN1 R DLA-64_like F DLA-64_like R

ATCC designation

GenBank accession no.

ATCC NR-8184 ATCC NR-8185 ATCC NR-8186 ATCC NR-8187 ATCC NR-8188 ATCC NR-8191 ATCC NR-8192 ATCC NR-8195 ATCC NR-8196 ATCC NR-8197 ATCC NR-8198 ATCC NR-8201 ATCC NR-8202 ATCC NR-9500 ATCC NR-9501 ATCC NR-9508 ATCC NR-9509 ATCC NR-9512 ATCC NR-9513 ATCC NR-9514 ATCC NR-9515 ATCC NR-9516 ATCC NR-9517 ATCC NR-9518 ATCC NR-9519 ATCC NR-9522 ATCC NR-9523 ATCC NR-9524 ATCC NR-9525 ATCC NR-9528 ATCC NR-9529 ATCC NR-9530 ATCC NR-9531 Not available Not available ATCC NR-8117 ATCC NR-8118 Not available Not available

EU836040 EU836022 EU836022 EU835484 EU835484 EU835996 EU835996 EU835985 EU835985 X/XM_545847 X/XM_545847 X/NM_001009285 X/NM_001009285 EU836044 EU836044 EU836045 EU836045 EU836026 EU836026 EU835485 EU835485 EU836039 EU836039 EU835986 EU835986 EU835989 EU835989 EU836024 EU836024 EU835987 EU835987 EU835988 EU835988 EU835493 EU835493 X/XM_845214 X/XM_845214 X/U55027 X/U55027

determined by a spectrophotometer (Eppendorf). Five hundred nanograms of total RNA was reverse transcribed by using SuperScript II reverse transcriptase (Invitrogen, Burlington, Ontario, Canada) in a 20-␮l reaction mixture under the following conditions: 6.25 ␮M random hexamer primers (Applied Biosystems); 50 mM Tris-HCl (pH 8.3); 3 mM MgCl2; 75 mM KCl; 0.5 mM dATP, dGTP, dTTP, and dCTP; 10 mM dithiothreitol (DTT), 40 U RNase inhibitor (Applied Biosystems); and 200 U SuperScript II RNase H⫺ reverse transcriptase at 42°C for 1 h. Real-time PCR. Quantitative real-time PCR (QRT-PCR) was performed by using an ABI-Prism 7900HT sequence detection system and SYBR green PCR master mix (Applied Biosystems, Foster City, CA). Each primer pair was tested with serially diluted concentrations of a control cDNA to generate a standard curve. Samples and standards were analyzed in triplicate. Each QRT-PCR was performed with a 10-␮l reaction volume with 0.25 ␮l of cDNA, 1 ␮l primers (500 nM each primer), and 5 ␮l of SYBR green PCR master mix in ABI-Prism optical 384-well plates. ␤-Actin was used as the housekeeping gene for sample normalization. Microarray analysis. Peripheral blood RNA isolated from each animal at day 1 postvaccination was analyzed by microarrays in the 2008-2009 vaccine study (n ⫽ 3 per group). Briefly, cRNA was prepared from 500 ng total whole-blood RNA by two-cycle cRNA synthesis according to the manufacturer’s protocol (Affymetrix, Santa Clara, CA). cRNA samples (20 ␮g) were labeled and hybridized to Affymetrix Canine 2.0 oligonucleotide arrays to monitor the gene expression of over 18,000 Canis familiaris mRNA/expressed sequence tag (EST)-based transcripts and over 20,000 nonredundant predicted genes. To minimize batch effects, RNA extraction and cRNA preparation of all samples were performed at

Sequence (5⬘–3⬘)

ACAGTTTGTAGCCGGGTTTG CCCCTGCAAGTCTTTTGCTA GATGTCCTGTCTTTGCCACA TGAAGAGCCTCCTACGGCTA CCATCTCCCAGGCGTAGATA AGTGGGTCAAAGACCACAGG GACAGGGTGGCATTCCTAAA ACACTCTACCCCCGTGTCTG GTCAAGTCCAGAGCCTCCAA GGTGGCCATTGACTGTGAG GCCGGATGAACTTGTCGTAG ACTCCGACTTTGTCCACCTG GGTCATGTGACAGGGGAAGT ATTGCCAATGTCGGACTCTC TACTCAACGCATCTGCATCC TGGACTACGGTGACTGTGGA CGGACAATCCCTCTGGTCTA CGCTCCTGAAGGAAGTCAAC AGCAGACTGGGCTGGAGTAG CGATACAAAGCAGGGGAAAA GGCCTTGCACTTAGCATCTC AATCCTCGTGAAGGAGCTGA AGATCCTGCTCTGGCACAGT AGCAGCAGATAGCCCTGAAA CAGTTCTTCACCACCAGCAG ACGAATACGGCATGAAGACC TGGAAGGGTCAGGCATTAAG AGAGCACTTGTGGACGCTTT TGCAATGTCAATGCCTTCAT GCTGGTGCATCACTACATGC GACCGTCTTCCGACAGAGAT AGCTGCTGAAGGAGCTGAAG TGCCTTCCTGGAGTCTCACT AGCCTTGCATGCCAACTCA ACAGTCCAGCTTCACCGTGAA CACCAAGGACCAGGACAATGA CACCAGGCCCCCTGGTA CAGGACACAGAGGTTGTGGA TGGCACGTGTATCTCTGCTC

the same time. Also, cRNA samples were hybridized on the same batch of microarray chips. As we have established in previous studies (2, 59), canine arrays were used due to the high levels of homology between canine and ferret nucleotide sequences (see Table S1 in the supplemental material for the homology analysis for the current study). The arrays were scanned during the same session by using an Affymetrix GCS3000 7G system according to standard Affymetrix protocols. Probe-level analysis was performed by using the probe logarithmic error intensity estimate (PLIER). The raw intensity values for each individual target on the Affymetrix chips were preprocessed with variance stabilization and log2 transformation and were normalized against the PBS control group data sets with ArrayAssist V 5.5.1 (Stratagene). A t test was performed with Benjamini-Hochberg false-discoveryrate (FDR) correction. Genes with a significant difference (P ⱕ 0.05; fold of change ⱖ1.5 or ⱕ⫺1.5) were selected for agglomerative hierarchical clustering with Pearson distance metrics and average linkage distance measurements between clusters using MultiExperimental Viewer 4.1 (60). Ingenuity Pathway Analysis (IPA) 5.0 software (Ingenuity Systems Inc., Redwood City, CA) was used to annotate and organize the gene expression data into networks and pathways. Statistics. One-way analysis of variance (ANOVA) was used for statistical analysis of the results presented in Fig. 4A and 6. Other analyses used the Student t test for comparing two independent populations. Quantitative PCR (Q-PCR) results from 50 ferret immune-related genes are represented as heat map charts generated by the software MultiExperimental Viewer 4.1. Bar graphs were generated by SigmaPlot 8.0.

FIG. 1. CpG ODN-assisted vaccination increased influenza virus-specific antibody levels in serum from immunized ferrets. Influenza virus-specific antibody levels in serum from immunized ferrets were assessed by ELISA (A), HA inhibition assays (B), and microneutralization assays (C). (A) Serum IgM (left) and IgG (right) antibody levels against the commercial vaccine Fluviral were measured at days 0, 14, 21, 28, and 35 and day 7 postboost. The average relative absorbance densities read at 450 nm from three individual samples were plotted graphically. (B) HI titers against inactivated 2007-2008 seasonal A/Solomon Islands/3 (H1N1), A/Wisconsin/67/2005 (H3N2), and B/Malaysia/2507/2004 viruses were measured in ferret sera. (C) Neutralizing antibody titers for blocking live A/Solomon Islands/3 (H1N1) virus were measured by microneutralization assays. Three independent experiments were performed. Error bars indicate standard deviations. Statistical analyses between animals in groups treated with vaccine with adjuvant added and animals in groups treated with vaccine alone were performed. *, P ⱕ 0.05; **, P ⱕ 0.01; ***, P ⱕ 0.001. 8373

8374

FANG ET AL.

J. VIROL.

FIG. 2. CpG ODN-adjuvanted vaccine activated ISG expression early postimmunization. mRNA expression profiles from immunized ferrets with and without CpG ODN were determined by Q-PCR. (A) Heat map representing the mRNA expression profile of 50 ferret immune-related genes in animals from the groups treated with V2007 plus CpG (V ⫹ CpG) and V2007 alone (V-Alone) (n ⫽ 3 per group) at day 1 postvaccination. The heat map was generated by MultiExperimental Viewer software, version 4.1, from the ␤-actin-normalized real-time PCR data relative to the

VOL. 84, 2010

ADJUVANT ACTIVITY IN SEASONAL FLU VACCINATION

Nucleotide sequence accession numbers. Sequences were deposited in the GenBank database under the accession numbers listed in Table 1.

RESULTS Humoral responses of CpG ODN-mediated immunization. We first investigated the effects of CpG ODN as an adjuvant for the 2007-2008 seasonal human influenza virus vaccine Fluviral (V2007) in ferrets. Fluviral contains 15 ␮g of the HA protein from the following influenza virus strains: A/Solomon Islands/3/2006 (H1N1), A/Wisconsin/67/2005 (H3N2), and B/Malaysia/2506/2004. Ferret serum samples were collected at time points following the primary immunization and vaccinealone boost. Immune activation was determined by anti-vaccine IgM and IgG antibody serum levels based on ELISAs. Serum samples from animals treated with V2007 plus CpG had significantly higher IgM levels at day 14 after primary immunization (Fig. 1A, left) than the V2007-alone group. Interestingly, there were also statistically higher levels of antigenspecific IgG in sera from ferrets treated with V2007 and CpG than in sera from animals treated with V2007 alone at all the time points after primary vaccination and also at day 7 postboost (Fig. 1A, right). These results suggest that CpG ODNmediated influenza virus vaccination increases humoral immunity by inducing antibody production and promoting faster antibody class switching. To confirm the results of ELISAs, the antibody titers were also assessed by hemagglutination inhibition (HI) and microneutralization (MN) assays. HI assays indicated that the sera from animals treated with V2007 plus CpG contained significantly higher levels of antibody titers than did sera from animals treated with V2007 alone (Fig. 1B) after primary vaccination to day 7 postboost. The MN assay also showed that the serum antibodies from animals treated with V2007 plus CpG had significantly higher titers against the A/Solomon Islands/ 3/2006 (H1N1) virus than the antibodies from the animals treated with vaccine alone at all time points (Fig. 1C). These data further indicate that CpG as an adjuvant is able to augment the humoral immune response to influenza virus vaccinations. Regulation of ISGs by CpG-adjuvanted vaccination. Having shown that the addition of CpG ODN to V2007 upregulated humoral responses after vaccination, we assessed gene expression activity associated with increased immunogenicity at the mRNA level. Quantitative PCR (Q-PCR) was used to generate a 50-gene expression profile from the whole-blood RNA samples collected at days 1, 3, and 5 after primary immunization and day 7 postboost in the groups vaccinated with V2007 plus CpG, V2007 alone, and PBS plus V2007 boost. The PBS-treated group was used as a control for normalization at days 1, 3, and 5 after primary vaccination and at day 7 postboost. An identical

8375

gene expression pattern was observed for the CpG-adjuvanted and nonadjuvanted vaccination groups following normalization to the PBS group at day 0 (data not shown). Since most of the immune-related genes were significantly regulated at day 1 in the group vaccinated with V2007 plus CpG compared to the control group, the day 1 Q-PCR data for 50 genes were illustrated by a heat map (Fig. 2A). The expression levels of the 12 immunologically relevant genes, from day 1 after primary vaccination to day 7 postboost, were statistically analyzed and are represented by bar graphs (Fig. 2B and 3). Levels of ISG molecules, such as the antiviral genes OAS1, RIG-I, Mx-1, ISG15, and ISG20; the transcription factors IFN regulatory factor 1 (IRF1), IRF7, STAT1, and STAT2; and the Th1 cell chemokine CXCL10 (54), which are induced by type I IFN during virus infection, were significantly elevated at day 1 after primary vaccination (Fig. 2A). However, at later time points the expression levels of most ISGs decreased to basal levels or became downregulated, such as OAS1, IRF7, and RIG-I. Only CXCL10 and STAT1 showed sustained increased expression levels at day 7 after boost (Fig. 2B). Although the ISGs were modulated similarly in the group without adjuvant, at day 3 and day 5 after primary vaccination, the induced levels of genes such as OAS1, RIG-I, ISG15, and STAT2 were markedly lower than with CpG (Fig. 2B). This observation suggested that CpG stimulated a faster and stronger type I IFN response than that for the animals treated with vaccine alone. Given that CpG-mediated vaccination strongly induced ISGs, we then determined whether IFN regulated ISG expression in vaccinated animals. We examined the mRNA levels of IFN-␣ and IFN-␥ by Q-PCR. The level of IFN-␣ was elevated in the group treated with V2007 plus CpG at day 1 after primary vaccination and day 7 postboost, whereas IFN-␥ levels were not highly increased by vaccination plus CpG (Fig. 3A). Even though immunization with V2007 alone increased the IFN-␣ level at day 3 and day 5, it was not statistically significant compared to the group vaccinated with V2007 plus CpG (Fig. 3A). Several studies reported previously that IFN-stimulated response repressors, such as IRF-2, ICSBP, and IRF4/PIP, likely terminate ISG transcription following IFN induction (18, 48, 69). In this study, IRF4 was highly upregulated in the group vaccinated with V2007 plus CpG at day 5 after primary vaccination and day 7 postboost (Fig. 3B). Since the ISG expression level was low during these time points, these results implied a negative role for IRF4 in the regulation of IFN-stimulated genes during adjuvant-mediated vaccination. Since IRF4 is also involved in B-cell class switch recombination and plasma cell differentiation (32, 40, 41), the elevated IRF4 expression levels in animals immunized with V2007 plus CpG may indicate a role in humoral immunogenicity regulation.

PBS control group. Genes are listed by descending mRNA level (red, upregulation; green, downregulation). V represents V2007. (B) The transcription of nine ISGs (OAS1, RIG-I, Mx-1, CXCL10/IP10, ISG15, IRF1, IRF7, STAT1, and STAT2) in ferret whole blood was quantified by Q-PCR and is displayed graphically. The animals in the group given PBS and the V2007 boost were treated with PBS at day 0 and boosted with commercial vaccine at day 35 after injection. The RNA samples used for expression analysis were extracted from the peripheral blood of three ferrets (n ⫽ 3) in each group at every time point. mRNA levels were normalized to ␤-actin and then to PBS control groups. The data from three independent experiments were averaged, and the error bars represent standard deviations. Horizontal bars indicate the statistical analysis performed between the selected two groups. *, P ⱕ 0.05; **, P ⱕ 0.01.

8376

FANG ET AL.

J. VIROL.

FIG. 3. Levels of ISG regulatory genes in CpG ODN adjuvant-mediated immunization. The average transcription levels of IFN-␣ and IFN-␥ (A) and IRF4 (B) in CpG ODN-mediated immunization were determined by Q-PCR and are plotted graphically for various time points following immunization. Increases in mRNA levels were relative to ␤-actin and then normalized to PBS control groups. Average data were obtained from three independent experiments, and the error bars indicate standard deviations. Horizontal bars show the statistical analysis performed between the selected two groups. *, P ⱕ 0.05.

IFN-␣- and CFA-mediated vaccination. We next evaluated IFN-␣ as an adjuvant to human influenza virus vaccination to determine if the CpG-induced IFN response was responsible for the induced humoral response. Pegylated IFN-␣ (PEG-IFN) was tested as an adjuvant for the 2008-2009 human flu vaccine (V2008) Vaxigrip in ferrets. The activity of pegylated IFN-␣ was evaluated by antibody titer quantification and compared to the response of groups treated with CpG ODN (V2008 plus CpG), CFA (V2008 plus CFA), vaccine alone (V2008 alone), and PBS as a control. To determine antibody titers, HI and microneutralization assays were run by using serum samples collected on days 14, 21, 28, and 35 post-V2008 immunizations. Quantification of HI titers for the live influenza A viruses Brisbane/59/2007 H1N1 and Brisbane/10/2007 H3N2 showed that CpG-, PEGIFN-, and CFA-mediated vaccinations induced significantly

higher titers than did treatment with vaccine alone (Fig. 4A). Furthermore, the microneutralization assay showed that sera from ferrets immunized with V2008 plus CpG, V2008 plus IFN, and V2008 plus CFA had higher titers of Brisbane/ 59/2007 H1N1-neutralizing antibody than did ferrets immunized with V2008 alone at day 14 after vaccination (Fig. 4B). At later time points, only CpG- and CFA-mediated vaccinations stimulated statistically stronger antibody responses. In a further comparison of antibody induction among the adjuvanted immunizations, both CpG- and CFA-adjuvanted vaccines stimulated significantly higher antibody titers than did the PEG-IFNadjuvanted vaccine. However, significant differences were not observed between the CpG and CFA groups. These results indicate that the addition of an adjuvant increases humoral responses and that V2008 plus CFA produces the strongest responses of the three adjuvant-mediated vaccinations.

VOL. 84, 2010

ADJUVANT ACTIVITY IN SEASONAL FLU VACCINATION

8377

FIG. 4. IFN-␣- and CFA-mediated vaccination induced influenza virus-specific antibody production. (A) Antibody titers in vaccinated ferret serum against 2008-2009 seasonal live A/Brisbane/59/2007 (H1N1) virus and A/Brisbane/10/2007 (H3N2) virus were measured by HI assays. (B) Neutralizing antibody titers for blocking the live A/Brisbane/59/2007 (H1N1) virus were measured in serum from immunized ferrets by microneutralization assays. Data represent triplicate measurements from sera collected from three animals. Error bars indicate standard deviations. Statistical analysis between animals in groups treated with vaccine with adjuvant added and those treated with vaccine alone were performed by either one-way ANOVA (A) or the Student t test (B). *, P ⱕ 0.05; **, P ⱕ 0.01; ***, P ⱕ 0.001.

Virus infectivity in adjuvant-treated animals. We next determined whether an increase in humoral immunity led to increased protection from viral infection. Ferrets were immunized with the following combinations: PBS, V2008 alone, V2008 plus CpG, V2008 plus IFN, and V2008 plus CFA. At day 42 following immunization, the ferrets were infected with 106 EID50 of Brisbane/59/2007 H1N1 virus to evaluate the protection efficacy of adjuvant-mediated vaccinations. The Brisbane/ 59/2007 H1N1 virus was found to replicate only in the nasal cavity of ferrets (47, 59). From day 2 p.i., 50 to 75% of the

animals in each group exhibited clinical signs of respiratory disease, including nasal discharge and sneezing. The symptoms lasted for 2 to 3 days and decreased at day 5 p.i. All animals exhibited increased temperature at day 2 p.i., which diminished by day 3, except for the groups treated with V2008 alone, V2008 plus IFN, and PBS, which showed a second increase in temperature on day 4 p.i. In addition, the animals displayed a decrease in activity by day 3 p.i., except for the animals immunized with V2008 plus CFA. The relative inactivity indexes (Table 2) were 1.1 for V2008 plus CFA, 1.3 for both V2008 plus

8378

FANG ET AL.

J. VIROL.

TABLE 2. Inactivity of infected ferrets Group

PBS Vc ⫹ CFA V ⫹ CpG V ⫹ IFN V ⫹ PBS

Relative inactivity indexa

1.6 1.1 1.3 1.3 2.0

Mean inactivity score postinfection on dayb: 1

2

3

4

5

0.0 0.0 0.0 0.0 0.5

1.5 0.0 0.6 0.5 1.4

0.6 0.5 0.5 0.3 1.4

0.5 0.0 0.3 0.4 0.9

0.5 0.0 0.3 0.4 0.6

a The relative inactivity index was calculated from daily activity scores as described in Materials and Methods. b Average daily activity scores were obtained from three animals in each group. c 2008-2009 human influenza virus vaccine.

CpG and V2008 plus IFN, 2.0 for V2008 alone, and 1.6 for the PBS control group. These results suggest that adjuvant-mediated vaccination in ferrets dramatically reduces influenza severity compared to treatment with vaccine alone. To evaluate infectivity, nasal wash specimens were collected from animals on each day postinfection, and viral loads (TCID50/ml) were calculated. Although viral loads in each group were elevated at day 1 and day 2 p.i., the level of virus replication in the nasal turbinates of the group immunized with V2008 plus CFA was significantly lower than that for the PBS control group. Furthermore, the virus titers measured on day 3 p.i. in nasal wash specimens of adjuvant groups were markedly diminished compared to those of the PBS control group (Fig. 5), whereas no significant decrease was observed for the ferrets that received vaccine alone. By day 5 p.i., the virus titer was not detectable in the majority of animals. Interestingly, the assessment of antibody titers in serum at day 5 p.i. showed that adjuvant-immunized animals had significantly higher antibody levels than animals treated with vaccine alone, as determined by HI and neutralization assays (Fig. 6). Additionally, in nasal wash specimens collected at day 5 p.i., the anti-Brisbane/59/ 2007 H1N1 IgG levels in the CpG- and CFA-adjuvanted vaccination groups were significantly higher than those in the nasal wash specimens from the group treated with the vaccine alone (data not shown). Given the clinical results and the decreased viral loads and increased antibody production observed for animals vaccinated with adjuvant compared to animals receiving the vaccine alone, we suggest that adjuvant induces a faster and stronger memory antibody response upon infection. Microarray analysis of CpG adjuvant immunization. As described above, we showed that the expression of our selected immune-related genes changed most significantly at day 1 after vaccination with CpG compared to the control (Fig. 2A). We next investigated the large-scale gene expression profile of day 1 adjuvant vaccinations by microarray analysis. The heat map (Fig. 7) represents the expression of immune-related genes significantly altered at day 1 postvaccination from adjuvantmediated V2008 vaccinations (one ferret per column). A similar expression pattern was observed by Q-PCR for three genes selected from the antigen presentation, adaptive immunity, and complement clusters shown in Fig. 7 (see Fig. S1 in the supplemental material). The fold gene expression changes for each adjuvant-treated group compared to PBS controls are listed in Table 3. Also, we used vaccine alone as a comparator

and observed an expression pattern similar to that of the PBStreated group (data not shown). Consistent with our Q-PCR results for vaccination with V2007 plus CpG, which showed an upregulation of 10 ISGs, the microarray data showed that the levels of 15 ISGs were increased by at least 1.5-fold in immunizations with V2008 plus CpG (Fig. 8A and Table 3). Data from IPA, combining Q-PCR and microarray data, suggest that CpG-adjuvanted vaccination stimulates type I IFN signaling and activates ISGs through STAT1 and STAT2 (Fig. 8B, top). Also, Toll-like receptor 4 (TLR4), which specifically recognizes bacterial lipopolysaccharide (LPS) and mediates innate immunity (31), was induced following CpG-adjuvanted vaccination (Table 3). Transcription analyses showed that levels of costimulatory molecules and major histocompatibility complex (MHC) genes were not elevated by vaccination with CpG, except for the upregulation of the cathepsin family antigen-processing genes CTSB and CTSS. Similarly, neither microarray nor Q-PCR showed increased IFN-␥ levels after CpG-mediated vaccination compared to levels with the vaccine alone. Interestingly, the immune regulator SOCS1 (Table 3), which negatively regulates IFN-␥ signaling (10), was found to be upregulated in animals immunized with V2008 plus CpG by microarray analysis. Microarray analysis of IFN-␣ adjuvant immunization. Given that CpG-mediated vaccination significantly increased levels of ISGs, we tested IFN-␣ for its direct adjuvant potential during immunization against influenza virus. We have found that treatment with PEG-IFN alone resulted in significantly increased mRNA levels of ISGs in ferrets at early time points (our unpublished data). Here microarray analysis revealed that 345 genes were highly upregulated following vaccination with V2008 plus IFN. Similar to the gene profile of CpG-mediated

FIG. 5. Adjuvant-mediated vaccination decreased viral load following influenza virus infection. The viral load in nasal wash specimens at day 3 post-H1N1 influenza virus challenge was determined. Nasal wash specimens from each group of animals (n ⫽ 3) were collected postinfection, cultured, and titrated. The virus titer was calculated by the Reed-Muench method and is expressed as TCID50/ml. Error bars demonstrate standard errors of the means. Statistical analysis was performed between each group receiving vaccine with adjuvant added and the PBS control group by the Student t test. V represents V2008. *, P ⱕ 0.05; **, P ⱕ 0.01.

VOL. 84, 2010

ADJUVANT ACTIVITY IN SEASONAL FLU VACCINATION

8379

FIG. 6. The memory antibody response at day 5 post-H1N1 infection was increased in animals receiving adjuvant-mediated vaccination. (A) Antibody titers from ferret sera against live seasonal A/Brisbane/59/2007 (H1N1) virus were determined by HI assays at day 5 postinfection for adjuvant- and non-adjuvant-assisted vaccinations. (B) Neutralizing antibody titers for blocking the A/Brisbane/59/2007 (H1N1) virus were assessed by microneutralization assays. The statistical analysis determined between day 35 after vaccination and day 5 postinfection is shown by the horizontal bar. The differences between adjuvant groups and the vaccine-alone group at day 5 p.i. were analyzed by one-way ANOVA. Data represent the averages of triplicate measurements of sera collected from three animals. Error bars indicate standard deviations. V represents V2008. *, P ⱕ 0.05; **, P ⱕ 0.01; ***, P ⱕ 0.001.

immunization, V2008 plus IFN stimulated the expression of ISGs, including STAT1, IRF2, OAS1/2, ISG15, USP18, IFIT2, RSAD2, IFI44, and IFI44L (Fig. 8A), although to a lesser extent than that found for the group immunized with V2008 plus CpG, as shown by IPA (Fig. 8B, bottom). Immunization with V2008 plus IFN also upregulated antigenprocessing and antigen presentation genes, such as cathepsin D (CTSD) and MHC class Ib, as well as the T-cell adhesion molecule CD84 (66) (Table 3). We also found that the level of the MHC enhanceosome member RFX5, which regulates the MHC during antigen presentation (55), was significantly increased following PEG-IFN-mediated vaccination. Interestingly, PEG-IFN-mediated vaccination also induced the gene expression of the intracellular signaling molecule Ras and the MEK family member MAP2K2 (Fig. 8C), which are known mediators of B-cell proliferation and B-cell memory after CD40 stimulation (7, 8). JUNB, which is downstream of Ras following B-cell receptor (BCR) stimulation (70), was also upregulated in vaccinations with V2008 plus IFN. Additionally, the level of expression of the guanine nucleotide-activating protein (GAP) RGS1, involved in B-cell activation (26), which was elevated in the group vaccinated with V2008 plus CpG, was also increased in ferrets immunized with V2008 plus IFN (Table 3). Microarray analysis of CFA adjuvant immunization. The precise molecular mechanism of CFA-mediated influenza virus immunization is not completely understood. We therefore investigated the gene profile of CFA-adjuvanted influenza virus vaccination in ferrets. Microarray analysis revealed that a total of 1,255 genes were regulated at day 1 postimmunization with V2008 plus CFA. Since CFA is thought to contain the NOD2 agonist muramyldipeptide (MDP), which induces NF-␬B and mitogen-activated protein (MAP) kinases (MAPKs) to initiate

proinflammatory cytokine expression in innate immune cells (36), we examined the expressions of NOD2 signaling genes. The expression of the MAP kinase family member extracellular signal-regulated kinase (ERK) was induced at day 1 after CFA-mediated vaccination (Table 3), but proinflammatory cytokines were not induced. CFA may also contain a TLR ligand, which could synergistically activate dendritic cells with MDP (19, 27). Similar to CpG- and IFN-mediated vaccination, the levels of expression of antigen-processing genes, namely, CTSD, MHC class I DLA-64, MHC class II HLA-DMA/CLIP (CD74), and MHC transcription enhanceosome RFX5 (Fig. 7 and Table 3), were significantly increased in CFA-mediated immunization. However, the MHC class II transactivator (CIITA), which regulates MHC class II gene transcription, was significantly downregulated (Table 3). We also found that CFA activated the expressions of several adhesion molecules, including integrin-␤, VCAM1, BCAM, CD36, CD84, and CD44 (Fig. 9A), and genes such as zyxin, talin 1, CRKL, RAP2A, and Rho family members involved in integrin signaling and mediating cell adhesion and motility (Fig. 9B). Moreover, the level of expression of CXCL14, a chemokine involved in B-cell migration and activation (63), was also found to be elevated (Table 3). B-cell intracellular signaling molecules, such as Lyn, Syk, and phosphatidylinositol 3-kinase (PI3K), were significantly upregulated by CFA at day 1 (Fig. 9A and C). In addition, increased mRNA levels of the B-cell proliferation regulator Bam32 (22, 43) were observed for CFA-mediated vaccination. In contrast to the PEG-IFN-induced transcription of MEK family member MAP2K2, involved in Ras-mediated BCR signaling, CFA activated the expression of the Ras downstream effector c-Raf and the MAP kinase ERK (Fig.

8380

FANG ET AL.

J. VIROL.

FIG. 7. Adjuvant-mediated vaccination activated differing arms of innate and adaptive immunity. The heat maps represent RNA expression determined by microarray analysis day 1 postvaccination. The heat map generated from the gene expression profile of the four different vaccination groups (n ⫽ 3/group) shows the innate, adaptive, antigen-processing/presentation, and complement immune-related genes, which were significantly regulated by at least a 1.5-fold change (P ⱕ 0.05) in one of the groups with adjuvant added. The fold change of gene expression is shown in Table 3 (red, upregulation; blue, downregulation). V represents V2008.

9C). Following BCR engagement, Ras activation is one result of Ca2⫹ signaling (9), which leads to gene induction through the calcineurin-NFAT pathway to stimulate B-cell proliferation (23). Indeed, the calcineurin family member PPP3R1, NFAT molecule NFATC3, the calcineurin-NFAT activation regulator G protein complex (GNA15, GNB3, GNG2, and GNG11), and CK1 (CSNK1D and CSNK1G2) were all highly induced following CFA-adjuvanted vaccination (Fig. 9D). Moreover, we found that the small G protein Rac, another factor which activates NF-␬B and JNK signaling (6, 25, 45), was induced after vaccination with CFA (Fig. 9C), and the level of AICDA (AID), essential for initiating immunoglobulin gene somatic hypermutation (SHM) and class switch recombination (CSR) in B cells (3), was increased by 2.6-fold in CFA-mediated vaccination (Table 3). Although AID was induced, the level of only one of its

activator molecules, Oct2 (51), was significantly increased, whereas the other, HoxC4, was downregulated (Fig. 9C). Lastly, the SOCS family member SOCS3 was induced by treatment with V2008 plus CFA (Table 3). High levels of SOCS3 expression may favor Th2 cell differentiation and inhibit interleukin-12 (IL-12)-mediated Th1 development (62), which is consistent with our finding that IL12A (Table 3) was significantly downregulated in CFA-adjuvanted vaccination. Also, more complement components, such as C1QL2, C1R, C5AR1, and CFI (Fig. 7 and Table 3), were activated in immunizations with V2008 plus CFA than with the other adjuvanted immunizations, which upregulated only FCN1 and a C3 precursor. However, V2008 plus CFA stimulated few ISGs, such as the transcription regulators IRF1 and IRF2 and the antiviral gene RSAD2 (Table 3), compared to CpG- and PEG-IFN-adjuvanted vaccinations.

VOL. 84, 2010

ADJUVANT ACTIVITY IN SEASONAL FLU VACCINATION

8381

TABLE 3. In vivo differential microarray gene expression analysis of whole blood of ferrets immunized with adjuvanted 2008-2009 vaccines (n ⫽ 3) versus PBS controls (n ⫽ 3) on day 1 postvaccination Mean fold changeb Genea

Mean fold changeb

VC ⫹ CpG

V⫹ IFN

V⫹ CFA

V⫹ PBS

IFN-responding genes STAT1 IRF1 IRF2 OAS1 OAS2 OASL ISG15 USP18 IFI44 IFI44L IFIT2 RSAD2 EIF2AK2 (PKR) CXCL10 SOCS1

2.7 2.3 1.5 3.2 2.4 1.9 7.6 4.8 3.4 3.4 1.7 5.6 1.7 1.6 2.7

2.3 1.2 2.5 2.3 1.8 1.1 6.9 3.2 3.3 3.3 1.5 3.5 1.3 1.1 1.2

1.1 1.5 2.3 ⫺1.1 ⫺1.1 1.0 1.4 1.1 1.7 1.7 1.4 2.2 1.1 1.0 1.0

1.0 1.1 ⫺1.1 ⫺1.0 ⫺1.0 1.1 ⫺1.0 ⫺1.0 ⫺1.1 ⫺1.0 1.1 1.2 ⫺1.1 1.3 1.3

TLR4

1.5

1.1

1.1

1.0

Antigen-processing and antigen presentation genes CTSB CTSS CTSD MHC class Ib MHC class I DLA-64 HLA-DMA CD74 RFX5 CIITA

1.6 1.7 1.1 1.1 1.1 1.1 1.0 1.3 1.1

1.4 1.4 1.9 1.5 1.4 1.4 2.1 1.5 1.1

1.1 1.2 1.7 1.3 1.9 2.0 1.9 1.6 ⴚ1.8

⫺1.0 ⫺1.0 ⫺1.0 1.0 1.1 ⫺1.1 1.0 1.0 ⫺1.0

Adaptive immunity regulators LYN SYK PIK3CD RAC1 BAM32 (DAPP1) HRAS RAF1 MAP2K2 MAPK1 NFATC3

1.2 1.0 1.2 1.2 1.3 1.3 ⫺1.1 1.0 1.0 1.1

1.2 1.4 1.6 1.2 1.1 2.0 1.5 1.6 1.0 1.2

1.5 1.6 1.8 2.3 1.5 2.5 1.8 1.5 1.6 2.0

1.0 ⫺1.1 ⫺1.1 1.1 ⫺1.1 1.0 1.0 1.1 1.0 ⫺1.2

Genea

AKT3 POU2F2 HoxC4 AICDA (AID) JUNB RGS1 GNA15 GNG2 GNG11 GNB3 Calcineurin (PPP3R1) RCAN1 CSNK1D CSNK1G2 MEF2C LAT IL12A SOCS3 CXCL14 Complement C3 precursor FCN1 C1QL2 C1R C5AR1 CFI Cell adhesion molecules and regulators VCAM1 BCAM CD36 CD44 CD84 Integrin-beta6 ZYXIN TALIN 1 RHOG RHOT1 CRKL RAP2A

VC ⫹ CpG

V⫹ IFN

V⫹ CFA

V⫹ PBS

⫺1.1 1.1 1.1 1.0 1.3 2.3 1.3 1.1 1.0 1.1 1.0 1.1 1.0 1.1 ⫺1.1 ⫺1.1 ⫺1.1 1.2 1.3

⫺1.1 1.3 ⫺1.1 1.1 2.3 1.6 2.0 1.4 1.2 1.4 1.2 ⫺1.1 1.1 1.1 ⫺1.2 1.1 ⫺1.4 1.2 1.4

ⴚ1.7 1.6 ⴚ1.7 2.6 2.8 1.0 2.1 1.6 1.6 1.8 1.7 ⴚ2.3 1.9 1.5 1.9 ⴚ1.5 ⴚ1.8 1.6 1.6

⫺1.4 ⫺1.2 ⫺1.1 1.0 1.2 1.2 1.2 1.1 1.1 ⫺1.1 ⫺1.0 1.0 1.1 ⫺1.1 ⫺1.2 ⫺1.0 ⫺1.1 ⫺1.0 1.1

2.4 2.6 1.2 1.1 1.3 1.0

2.4 1.9 1.1 1.5 1.3 1.0

1.1 1.1 1.5 3.9 1.6 1.7

⫺1.0 ⫺1.0 ⫺1.0 1.1 ⫺1.0 ⫺1.0

⫺1.1 1.1 1.1 1.1 1.4 1.1 1.2 1.1 1.2 1.0 1.0 1.0

1.3 1.3 1.2 1.1 1.6 1.1 1.7 1.0 1.4 ⫺1.1 1.0 1.2

1.9 2.0 1.6 1.5 1.7 1.6 2.6 1.5 1.9 1.8 1.5 1.9

⫺1.1 ⫺1.0 1.0 1.0 1.2 1.0 1.2 ⫺1.1 ⫺1.1 ⫺1.1 ⫺1.1 1.1

a

The gene designation is compatible to the human ortholog. The mean fold change is normalized to the value for the corresponding PBS control group. Boldface type indicates that gene expression is significantly induced by at least a 1.5-fold change (P ⱕ 0.05) versus controls. b

DISCUSSION Here we investigated the adjuvant potential of CpG ODN when added to the seasonal human influenza virus vaccine and subsequently characterized the molecular gene signatures of the induced immune responses. Since CpG ODN initiated robust IFN responses following vaccination, we evaluated type I IFN as an adjuvant by using PEG-IFN in combination with the human influenza virus vaccine Vaxigrip. We also compared the effect of PEG-IFN to that of the standard adjuvant, CFA. To demonstrate the activity of each adjuvant during immunization, gene expression profiling was performed by microarray. The gene expression profile generated by Affymetrix canine arrays was used to expand on the gene signatures identified by Q-PCR analysis (Fig. 2). At this time, it is not known whether

microvariation in the canine probes affects the detection of ferret orthologs. Our group has established the utility of the canine platform to assess ferret gene expression using a homology analysis of the limited publicly available ferret and canine cDNA sequences and a ferret-specific Q-PCR validation strategy (2, 59). Cross-species microarray analyses are supported by data from previous studies (11, 30, 49); however, a lack of publicly available canine whole-blood microarray data sets has not allowed us to make the same comparisons. Nonetheless, high homology was identified between numerous ferret and canine genes derived from the current study (see Table S1 in the supplemental material), and extensive ferret-specific Q-PCR validation on surrogate genes was performed. The CpG experiment showed that our genes of interest

8382

VOL. 84, 2010

ADJUVANT ACTIVITY IN SEASONAL FLU VACCINATION

8383

FIG. 8. CpG ODN- and PEG-IFN-adjuvanted vaccine-regulated IFN signaling pathways. (A) IFN-responsive gene expression was determined by microarray analysis from the RNA of vaccinated ferrets at day 1 postvaccination (red, upregulation; blue, downregulation) and plotted by heat map. (B) Schematic created from the gene expression profiling data obtained at day 1 postimmunization by IPA. (Top) IPA canonical pathway of IFN signaling using Q-PCR data from the 2007 vaccine study and microarray data from the 2008 vaccine study from ferrets with CpG-mediated immunization. (Bottom) IFN signaling pathway activated by PEG-IFN-adjuvanted vaccination by using the microarray data of the 2008 vaccine study (red, upregulation). (C) Gene expression heat map of molecules involved in Ras signaling at day 1 postvaccination (top) (red, upregulation) and IPA modeling of JAK/STAT pathway-mediated Ras signaling using the microarray data from the whole-blood RNA of ferrets given PEG-IFN-mediated immunization at day 1 postvaccination (bottom) (red, upregulation).

changed most significantly at day 1 following vaccination (Fig. 2); therefore, this time point was chosen for more extensive microarray analyses. We demonstrated that although CpG ODN led to the activation of ISGs and the subsequent stimulation of humoral responses, when PEG-IFN was used, it was unable to reproduce humoral activation to the same extent as that of CpG ODN. Furthermore, CpG ODN as well as IFN and CFA adjuvant-mediated immunizations stimulated stronger antibody responses than did the vaccine alone and gave better protection for animals following seasonal H1N1 infection. The microarray analysis for each adjuvant showed differing molecular signatures, indicating that distinct molecular pathways were activated depending on the adjuvant used. Based on microarray profiling and Q-PCR analysis, the CpG-adjuvanted immunization activated canonical type I IFN signaling responses. The upregulation of ISGs included the virus-sensing RIG-I and PKR; the virus replication inhibitors OAS1, OAS2, and OASL; the transcription factors STAT1 and STAT2; the IFN-regulating molecules IRF1 and IRF7; and the Th1 cell chemoattractant CXCL10. In plasmacytoid DCs (pDCs), CpG binds to the intracellular receptor TLR9 to ac-

tivate IFN-␣ expression, which initiates ISG stimulation (21). In our study, ISG induction was transient after vaccination, and the relatively increased IFN-␣ expression level was observed only at 24 h postvaccination. Typically, pDCs are thought to be the primary producers of type I IFN, and the production of IFN following CpG stimulation leads to the maturation of conventional DCs (cDCs), which in turn augments the B-cell response toward a Th1-like phenotype by inducing IFN-␥ and IL-12 (33). Our gene profiling did not support this mechanism for the CpG-induced pDC- and cDCmediated enhancement of the humoral response through Th1 regulation, since molecular signatures associated with DC maturation and/or Th1 signaling were not observed. Moreover, we found that SOCS1, the suppressor of IFN-␥ signaling (10), was significantly upregulated. Therefore, CpG may function as a non-Th1-biasing adjuvant during immunization, a possibility which we are studying further. Several recent studies indicated that CpG can activate B cells directly through TLR9 and MyD88 to promote class switching toward a Th1 phenotype (29, 39). In addition, TLR9 signaling has been implicated in plasma cell proliferation and

8384

FANG ET AL.

J. VIROL.

FIG. 9. Cell adhesion and B-cell signaling pathways were activated in ferrets immunized with CFA-mediated vaccines. (A) Heat map of cell adhesion molecule gene expression and genes involved in B-cell activation/calcineurin-NFAT signaling at day 1 postvaccination (red, upregulation; blue, downregulation). (B to D) IPA canonical pathways of integrin signaling, B-cell activation, and calcineurin-NFAT created by using the microarray data for CFA-immunized ferret peripheral blood RNA at day 1 postvaccination, (red, upregulation; green, downregulation). V represents V2008. ECM, extracellular matrix.

VOL. 84, 2010

ADJUVANT ACTIVITY IN SEASONAL FLU VACCINATION

FIG. 9—Continued.

8385

8386

FANG ET AL.

differentiation after immunization with antigen and nonsoluble CpG, which leads to IL-6 and IgM secretion (14). Here we found that IRF4, which is involved in antibody class switching and plasma cell differentiation (17, 32, 41), was upregulated in CpG-mediated vaccination. Since both the ligation of TLR9 and the intracellular activation of IRF4 regulate antibody class switching, we postulated that IRF4 could be induced downstream of TLR9 engagement in B cells. In this scenario, it is possible that the downstream activation of IRF4 may occur via MyD88-mediated NF-␬B and/or AP-1 activation, which was a proposed route for B-cell activation, proliferation, and Ig production after TLR9 anchoring (52). High levels of IRF4 occurring after the antigen boost also suggest that IRF4 could play a role in memory plasma cell differentiation, which is consistent with findings reported previously by Klein et al. (32). Taken together, our data suggest that CpG-adjuvanted vaccination activates B cells via the TLR9-mediated expression of genes such as IRF4, involved in plasma cell differentiation and antibody class switching. Interestingly, the microarray profiling of CpG-mediated vaccination indicated that TLR9 activation correlated with TLR4 upregulation. TLR4 cooperates in BCR signaling to enhance the antibody response through LPS ligation (13, 46). Although LPS is the classical antigen for TLR4, an updated list asserts that other pathogens, such as viral proteins and parasitic heat shock proteins, also bind to this innate receptor (1). Thus, TLR4 may also be involved in immune activation by recognizing the vaccine antigen in conjunction with TLR9-mediated vaccine responses. As discussed above, type I IFN induces adaptive immunity by stimulating DC surface costimulatory molecules and MHC antigens, which enable DCs to activate B cells (37). Since type I IFN is an inducer of adaptive immunity, we used pegylated IFN-␣2b as an adjuvant to compare with CpG-adjuvanted immunization. PEG-IFN induced ISG expression levels similar to those induced by CpG-adjuvanted vaccination as determined by microarray analysis (Fig. 8B). The MHC class I gene was also induced possibly as a result of increased levels of the MHC transcription enhanceosome RFX5. An increase in the level of the MHC class I molecule on the surface of antigen-presenting cells (APCs) can then activate T cells to express the adhesion molecule CD84. Since RFX5 was also upregulated in CFAadjuvanted vaccination, it is possible that RFX5 was activated by the same signaling pathway and may represent a common mediator of adjuvant activity in both PEG-IFN- and CFAmediated vaccination. In the future, it will be important to elucidate the mechanism of RFX5 induction since MHC upregulation in our adjuvant-mediated studies is an important component of adaptive immunity. Interestingly, PEG-IFN stimulated Ras and MEK genes involved in Ras-MEK-ERK signaling. Ras-MEK-ERK signaling in B cells plays an important role in generating the high-affinity antibody (61). It is therefore likely that type I IFNs can activate B cells directly through the type I IFN receptor to initiate the Ras-MEK-ERK pathway, as type I IFNs can stimulate B cells directly to produce antibody and express IFIT2/3 early after influenza virus infection (5, 61). Our microarray data suggest that IFN-␣2b activates MHC class I expression, which may play a role in activating CD8⫹ T cells postvaccination. Furthermore, the data imply that IFN-␣

J. VIROL.

activates antibody generation by B cells through Ras signaling. However, our HI and microneutralization assays showed that antibody levels induced by PEG-IFN were lower than those stimulated by CpG (Fig. 2). This decreased antibody production may be dose dependent, since previous reports have shown that the level of the Ig subclass was greatly increased with a high-dose IFN-␣ adjuvant administration (67), or possibly, the IFN-␣2b subtype could not fully activate the DCs or B cells, since IFN-␣1 is the main subtype produced by pDCs after virus infection. CFA has been used for decades in animal models to generate high levels of antibody against antigens. It is known that MDP, the NOD2 ligand, is the minimal essential component in CFA (16). Unlike previous findings (36), the results of our microarray profiling in ferrets showed that CFA-mediated vaccination did not stimulate a proinflammatory milieu but instead showed an elevation of the level of the MAPK pathway gene ERK only. Weak proinflammatory cytokine responses, e.g., an absence of IFN-␥ gene expression, may be the result of the low-dose CFA treatment (100 ␮l; one injection) given to the ferrets. Even though a robust inflammatory response was not observed, the transcription enhanceosome RFX5 was upregulated upon CFA-adjuvanted vaccination along with MHC gene induction, which is associated with DC maturation (44). Previous reports have shown strong synergism between TLR ligands and MDP when administered together (64). Therefore, it is possible that there may be another ligand in CFA that contributes to the adjuvant activity. In particular, the TLR4 ligand can increase the maturation potential of MDP on human DCs by inducing costimulatory molecules and the MHC class II gene (19). Furthermore, NOD2/TLR-mediated MHC upregulation may be regulated by the induced SOCS3, which is involved in the negative regulation of STAT3 and associated with Th2-type signaling in DCs (35). This is supported by our finding that the Th1-directing cytokine IL12A (Table 3) was significantly downregulated in CFA-adjuvanted vaccination. Mature DCs efficiently present antigens on the cell surface and directly promote the expression of high-affinity B-cell receptors. This results in strong BCR signaling and subsequent interaction with T helper cells to initiate antibody secretion cells and memory B cells (12). In this study, we found that several important genes involved in B-cell activation were induced in CFA-mediated vaccination, in particular, the molecules involved in the Lyn-Syk-PI3K signaling pathway, the calcineurin-NFAT pathway, and the Ras-MEK-ERK pathway. Furthermore, our pathway analysis suggested that B-cell activation may have induced calcineurin-NFAT, Ras-MEK-ERK, and NF-␬B signaling (24). These pathways in turn initiate the transcription of genes involved in B-cell expansion, plasma cell differentiation, and antibody production, such as Bam32 (22) and Oct2 (POU2F2), which binds to the AICDA promoter and activates AID transcription (51) for determining antibody SHM and CSR (3). In addition, the molecules engaged in cell adhesion and motility, complement components, and chemoattractant were highly stimulated in CFA-adjuvanted vaccination. In contrast to type I IFN activation by CpG ODN or PEGIFN, CFA stimulated a relatively low level of ISG expression, which is unlike previously reported findings that robust type I IFN activation is a hallmark of CFA activity in mouse models

VOL. 84, 2010

ADJUVANT ACTIVITY IN SEASONAL FLU VACCINATION

(37). Given that CFA was administered with vaccine intramuscularly, the slow release of this emulsion from the injection site to the peripheral circulation, or the more localized activity of this adjuvant, may result in the limited ISG stimulation in peripheral blood at 24 h postvaccination. It will be important to evaluate gene regulation in the peripheral blood at later time points following CFA-adjuvanted vaccination to demonstrate the role of IFN responses in the adjuvanticity of CFA. Altogether, our data suggest that a low dose of CFA activates the expression of MHC molecules, which are associated with DC activation through NOD2 and/or TLR signaling rather than type I IFN receptor ligation. We contend that activated DCs may strongly activate BCR signaling to initiate B-cell proliferation and plasma cell differentiation through high-Ca2⫹-induced NFAT-, ERK-, and NF-␬B-regulated transcription. Given the paucity of ferret-specific reagents, we could not isolate DCs in this study to investigate this potential mechanism further. Also, we were limited to one time point of gene expression profiling and cannot rule out that some of the expression differences may be affected by different gene expression kinetics or different doses of adjuvants. In conclusion, we have identified both common and disparate signaling pathways activated downstream of in vivo adjuvant activity during vaccination. Of note, RFX5 was a common transcript induced by both IFN-␣- and CFA-adjuvanted vaccinations, representing a focal point of adjuvant activity. Additionally, the identified signature molecules in our study could be specifically targeted in future vaccines, thereby facilitating the efficacy of vaccination and the development of host immunogenicity. ACKNOWLEDGMENTS We thank Alexander Klimov (CDC, Atlanta, GA) for the kind gift of the 2007-2008 human seasonal influenza viruses and Lixia Guo and Zujiang Li at Shantou University Medical College (Shantou, China) for assisting with ferret gene cloning. We also thank Jean Flanagan and Roman Skybin, from the Animal Resources Centre at Toronto General Hospital (Toronto, Canada), for the collection of ferret samples. We give special thanks to Alyson Kelvin for reviewing the manuscript. This work is supported by grants from the Li Ka Shing Foundation, the Canadian Institute of Health Research, Sardegna Ricerche, and the National Institutes of Health. REFERENCES 1. Aosai, F., M. Chen, H. K. Kang, H. S. Mun, K. Norose, L. X. Piao, M. Kobayashi, O. Takeuchi, S. Akira, and A. Yano. 2002. Toxoplasma gondiiderived heat shock protein HSP70 functions as a B cell mitogen. Cell Stress Chaperones 7:357–364. 2. Cameron, C. M., M. J. Cameron, J. F. Bermejo-Martin, L. Ran, L. Xu, P. V. Turner, R. Ran, A. Danesh, Y. Fang, P. K. Chan, N. Mytle, T. J. Sullivan, T. L. Collins, M. G. Johnson, J. C. Medina, T. Rowe, and D. J. Kelvin. 2008. Gene expression analysis of host innate immune responses during lethal H5N1 infection in ferrets. J. Virol. 82:11308–11317. 3. Chaudhuri, J., M. Tian, C. Khuong, K. Chua, E. Pinaud, and F. W. Alt. 2003. Transcription-targeted DNA deamination by the AID antibody diversification enzyme. Nature 422:726–730. 4. Cooper, C. L., H. L. Davis, M. L. Morris, S. M. Efler, A. M. Krieg, Y. Li, C. Laframboise, M. J. Al Adhami, Y. Khaliq, I. Seguin, and D. W. Cameron. 2004. Safety and immunogenicity of CPG 7909 injection as an adjuvant to Fluarix influenza vaccine. Vaccine 22:3136–3143. 5. Coro, E. S., W. L. Chang, and N. Baumgarth. 2006. Type I IFN receptor signals directly stimulate local B cells early following influenza virus infection. J. Immunol. 176:4343–4351. 6. Coso, O. A., M. Chiariello, J. C. Yu, H. Teramoto, P. Crespo, N. Xu, T. Miki, and J. S. Gutkind. 1995. The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signaling pathway. Cell 81:1137–1146. 7. Coughlin, J. J., S. L. Stang, N. A. Dower, and J. C. Stone. 2005. RasGRP1 and RasGRP3 regulate B cell proliferation by facilitating B cell receptor-Ras signaling. J. Immunol. 175:7179–7184.

8387

8. Coughlin, J. J., S. L. Stang, N. A. Dower, and J. C. Stone. 2006. The role of RasGRPs in regulation of lymphocyte proliferation. Immunol. Lett. 105:77–82. 9. Cullen, P. J., and P. J. Lockyer. 2002. Integration of calcium and Ras signalling. Nat. Rev. Mol. Cell Biol. 3:339–348. 10. Dalpke, A. H., S. Opper, S. Zimmermann, and K. Heeg. 2001. Suppressors of cytokine signaling (SOCS)-1 and SOCS-3 are induced by CpG-DNA and modulate cytokine responses in APCs. J. Immunol. 166:7082–7089. 11. Dillman, J. F., III, and C. S. Phillips. 2005. Comparison of non-human primate and human whole blood tissue gene expression profiles. Toxicol. Sci. 87:306–314. 12. Dustin, M. L., and L. B. Dustin. 2001. The immunological relay race: B cells take antigen by synapse. Nat. Immunol. 2:480–482. 13. Dye, J. R., A. Palvanov, B. Guo, and T. L. Rothstein. 2007. B cell receptor cross-talk: exposure to lipopolysaccharide induces an alternate pathway for B cell receptor-induced ERK phosphorylation and NF-kappa B activation. J. Immunol. 179:229–235. 14. Eckl-Dorna, J., and F. D. Batista. 2009. BCR-mediated uptake of antigen linked to TLR9 ligand stimulates B-cell proliferation and antigen-specific plasma cell formation. Blood 113:3969–3977. 15. Edwards, K. M., W. D. Dupont, M. K. Westrich, W. D. Plummer, Jr., P. S. Palmer, and P. F. Wright. 1994. A randomized controlled trial of coldadapted and inactivated vaccines for the prevention of influenza A disease. J. Infect. Dis. 169:68–76. 16. Ellouz, F., A. Adam, R. Ciorbaru, and E. Lederer. 1974. Minimal structural requirements for adjuvant activity of bacterial peptidoglycan derivatives. Biochem. Biophys. Res. Commun. 59:1317–1325. 17. Fillatreau, S., and A. Radbruch. 2006. IRF4—a factor for class switching and antibody secretion. Nat. Immunol. 7:704–706. 18. Friedman, R. L., S. P. Manly, M. McMahon, I. M. Kerr, and G. R. Stark. 1984. Transcriptional and posttranscriptional regulation of interferon-induced gene expression in human cells. Cell 38:745–755. 19. Fritz, J. H., S. E. Girardin, C. Fitting, C. Werts, D. Mengin-Lecreulx, M. Caroff, J. M. Cavaillon, D. J. Philpott, and M. Adib-Conquy. 2005. Synergistic stimulation of human monocytes and dendritic cells by Toll-like receptor 4 and. Eur. J. Immunol. 35:2459–2470. 20. Girardin, S. E., I. G. Boneca, J. Viala, M. Chamaillard, A. Labigne, G. Thomas, D. J. Philpott, and P. J. Sansonetti. 2003. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278:8869–8872. 21. Haller, O., G. Kochs, and F. Weber. 2006. The interferon response circuit: induction and suppression by pathogenic viruses. Virology 344:119–130. 22. Han, A., K. Saijo, I. Mecklenbrauker, A. Tarakhovsky, and M. C. Nussenzweig. 2003. Bam32 links the B cell receptor to ERK and JNK and mediates B cell proliferation but not survival. Immunity 19:621–632. 23. Healy, J. I., R. E. Dolmetsch, L. A. Timmerman, J. G. Cyster, M. L. Thomas, G. R. Crabtree, R. S. Lewis, and C. C. Goodnow. 1997. Different nuclear signals are activated by the B cell receptor during positive versus negative signaling. Immunity 6:419–428. 24. Healy, J. I., and C. C. Goodnow. 1998. Positive versus negative signaling by lymphocyte antigen receptors. Annu. Rev. Immunol. 16:645–670. 25. Hill, C. S., J. Wynne, and R. Treisman. 1995. The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81:1159–1170. 26. Hong, J. X., G. L. Wilson, C. H. Fox, and J. H. Kehrl. 1993. Isolation and characterization of a novel B cell activation gene. J. Immunol. 150:3895– 3904. 27. Ishii, K. J., and S. Akira. 2007. Toll or Toll-free adjuvant path toward the optimal vaccine development. J. Clin. Immunol. 27:363–371. 28. Jefferson, T., D. Rivetti, A. Rivetti, M. Rudin, C. Di Pietrantonj, and V. Demicheli. 2005. Efficacy and effectiveness of influenza vaccines in elderly people: a systematic review. Lancet 366:1165–1174. 29. Jegerlehner, A., P. Maurer, J. Bessa, H. J. Hinton, M. Kopf, and M. F. Bachmann. 2007. TLR9 signaling in B cells determines class switch recombination to IgG2a. J. Immunol. 178:2415–2420. 30. Ji, W., W. Zhou, K. Gregg, N. Yu, S. Davis, and S. Davis. 2004. A method for cross-species gene expression analysis with high-density oligonucleotide arrays. Nucleic Acids Res. 32:e93. 31. Jin, M. S., and J. O. Lee. 2008. Structures of the Toll-like receptor family and its ligand complexes. Immunity 29:182–191. 32. Klein, U., S. Casola, G. Cattoretti, Q. Shen, M. Lia, T. Mo, T. Ludwig, K. Rajewsky, and R. Dalla-Favera. 2006. Transcription factor IRF4 controls plasma cell differentiation and class-switch recombination. Nat. Immunol. 7:773–782. 33. Krieg, A. M. 2002. CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 20:709–760. 34. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, and D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546–549. 35. Kubo, M., T. Hanada, and A. Yoshimura. 2003. Suppressors of cytokine signaling and immunity. Nat. Immunol. 4:1169–1176.

8388

FANG ET AL.

36. Kufer, T. A. 2008. Signal transduction pathways used by NLR-type innate immune receptors. Mol. Biosyst. 4:380–386. 37. Le Bon, A., G. Schiavoni, G. D’Agostino, I. Gresser, F. Belardelli, and D. F. Tough. 2001. Type I interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity 14:461–470. 38. Le Bon, A., and D. F. Tough. 2002. Links between innate and adaptive immunity via type I interferon. Curr. Opin. Immunol. 14:432–436. 39. Lin, L., A. J. Gerth, and S. L. Peng. 2004. CpG DNA redirects class-switching towards “Th1-like” Ig isotype production via TLR9 and MyD88. Eur. J. Immunol. 34:1483–1487. 40. Lohoff, M., H. W. Mittrucker, S. Prechtl, S. Bischof, F. Sommer, S. Kock, D. A. Ferrick, G. S. Duncan, A. Gessner, and T. W. Mak. 2002. Dysregulated T helper cell differentiation in the absence of interferon regulatory factor 4. Proc. Natl. Acad. Sci. U. S. A. 99:11808–11812. 41. Lu, R. 2008. Interferon regulatory factor 4 and 8 in B-cell development. Trends Immunol. 29:487–492. 42. Maher, J. A., and J. DeStefano. 2004. The ferret: an animal model to study influenza virus. Lab. Anim. 33:50–53. 43. Marshall, A. J., H. Niiro, C. G. Lerner, T. J. Yun, S. Thomas, C. M. Disteche, and E. A. Clark. 2000. A novel B lymphocyte-associated adaptor protein, Bam32, regulates antigen receptor signaling downstream of phosphatidylinositol 3-kinase. J. Exp. Med. 191:1319–1332. 44. Mellman, I., and R. M. Steinman. 2001. Dendritic cells: specialized and regulated antigen processing machines. Cell 106:255–258. 45. Minden, A., A. Lin, F. X. Claret, A. Abo, and M. Karin. 1995. Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs. Cell 81:1147–1157. 46. Minguet, S., E. P. Dopfer, C. Pollmer, M. A. Freudenberg, C. Galanos, M. Reth, M. Huber, and W. W. Schamel. 2008. Enhanced B-cell activation mediated by TLR4 and BCR crosstalk. Eur. J. Immunol. 38:2475–2487. 47. Munster, V. J., E. de Wit, J. M. van den Brand, S. Herfst, E. J. Schrauwen, T. M. Bestebroer, D. van de Vijver, C. A. Boucher, M. Koopmans, G. F. Rimmelzwaan, T. Kuiken, A. D. Osterhaus, and R. A. Fouchier. 2009. Pathogenesis and transmission of swine-origin 2009 A(H1N1) influenza virus in ferrets. Science 325:481–483. 48. Nelson, N., M. S. Marks, P. H. Driggers, and K. Ozato. 1993. Interferon consensus sequence-binding protein, a member of the interferon regulatory factor family, suppresses interferon-induced gene transcription. Mol. Cell. Biol. 13:588–599. 49. Nieto-Diaz, M., W. Pita-Thomas, and M. Nieto-Sampedro. 2007. Crossspecies analysis of gene expression in non-model mammals: reproducibility of hybridization on high density oligonucleotide microarrays. BMC Genomics 8:89. 50. O’Hagan, D. T., M. Singh, J. Kazzaz, M. Ugozzoli, M. Briones, J. Donnelly, and G. Ott. 2002. Synergistic adjuvant activity of immunostimulatory DNA and oil/water emulsions for immunization with HIV p55 gag antigen. Vaccine 20:3389–3398. 51. Park, S. R., H. Zan, Z. Pal, J. Zhang, A. Al Qahtani, E. J. Pone, Z. Xu, T. Mai, and P. Casali. 2009. HoxC4 binds to the promoter of the cytidine deaminase AID gene to induce AID expression, class-switch DNA recombination and somatic hypermutation. Nat. Immunol. 10:540–550. 52. Peng, S. L. 2005. Signaling in B cells via Toll-like receptors. Curr. Opin. Immunol. 17:230–236. 53. Proietti, E., L. Bracci, S. Puzelli, T. Di Pucchio, P. Sestili, E. De Vincenzi, M. Venditti, I. Capone, I. Seif, E. De Maeyer, D. Tough, I. Donatelli, and F. Belardelli. 2002. Type I IFN as a natural adjuvant for a protective immune response: lessons from the influenza vaccine model. J. Immunol. 169:375– 383. 54. Qian, C., H. An, Y. Yu, S. Liu, and X. Cao. 2007. TLR agonists induce regulatory dendritic cells to recruit Th1 cells via preferential IP-10 secretion and inhibit Th1 proliferation. Blood 109:3308–3315.

J. VIROL. 55. Reith, W., S. LeibundGut-Landmann, and J. M. Waldburger. 2005. Regulation of MHC class II gene expression by the class II transactivator. Nat. Rev. Immunol. 5:793–806. 56. Reuman, P. D., S. Keely, and G. M. Schiff. 1989. Assessment of signs of influenza illness in the ferret model. J. Virol. Methods 24:27–34. 57. Roman, M., E. Martin-Orozco, J. S. Goodman, M. D. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, and E. Raz. 1997. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat. Med. 3:849–854. 58. Rowe, T., R. A. Abernathy, J. Hu-Primmer, W. W. Thompson, X. Lu, W. Lim, K. Fukuda, N. J. Cox, and J. M. Katz. 1999. Detection of antibody to avian influenza A (H5N1) virus in human serum by using a combination of serologic assays. J. Clin. Microbiol. 37:937–943. 59. Rowe, T., A. J. Leon, C. J. Crevar, D. M. Carter, L. Xu, L. Ran, Y. Fang, C. M. Cameron, M. J. Cameron, D. Banner, D. C. Ng, R. Ran, H. K. Weirback, C. A. Wiley, D. J. Kelvin, and T. M. Ross. 2010. Modeling host responses in ferrets during A/California/07/2009 influenza infection. Virology 401:257–265. 60. Saeed, A. I., V. Sharov, J. White, J. Li, W. Liang, N. Bhagabati, J. Braisted, M. Klapa, T. Currier, M. Thiagarajan, A. Sturn, M. Snuffin, A. Rezantsev, D. Popov, A. Ryltsov, E. Kostukovich, I. Borisovsky, Z. Liu, A. Vinsavich, V. Trush, and J. Quackenbush. 2003. TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34:374–378. 61. Sanjo, H., M. Hikida, Y. Aiba, Y. Mori, N. Hatano, M. Ogata, and T. Kurosaki. 2007. Extracellular signal-regulated protein kinase 2 is required for efficient generation of B cells bearing antigen-specific immunoglobulin G. Mol. Cell. Biol. 27:1236–1246. 62. Seki, Y., H. Inoue, N. Nagata, K. Hayashi, S. Fukuyama, K. Matsumoto, O. Komine, S. Hamano, K. Himeno, K. Inagaki-Ohara, N. Cacalano, A. O’Garra, T. Oshida, H. Saito, J. A. Johnston, A. Yoshimura, and M. Kubo. 2003. SOCS-3 regulates onset and maintenance of T(H)2-mediated allergic responses. Nat. Med. 9:1047–1054. 63. Sleeman, M. A., J. K. Fraser, J. G. Murison, S. L. Kelly, R. L. Prestidge, D. J. Palmer, J. D. Watson, and K. D. Kumble. 2000. B cell- and monocyteactivating chemokine (BMAC), a novel non-ELR alpha-chemokine. Int. Immunol. 12:677–689. 64. Tada, H., S. Aiba, K. Shibata, T. Ohteki, and H. Takada. 2005. Synergistic effect of Nod1 and Nod2 agonists with Toll-like receptor agonists on human dendritic cells to generate interleukin-12 and T helper type 1 cells. Infect. Immun. 73:7967–7976. 65. Takaoka, A., and H. Yanai. 2006. Interferon signalling network in innate defence. Cell. Microbiol. 8:907–922. 66. Tangye, S. G., K. E. Nichols, N. J. Hare, and B. C. van de Weerdt. 2003. Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J. Immunol. 171:2485–2495. 67. Tovey, M. G., C. Lallemand, J. F. Meritet, and C. Maury. 2006. Adjuvant activity of interferon alpha: mechanism(s) of action. Vaccine 24(Suppl. 2): S2-46-7. 68. Wang, X., T. Uto, T. Akagi, M. Akashi, and M. Baba. 2008. Poly(gammaglutamic acid) nanoparticles as an efficient antigen delivery and adjuvant system: potential for an AIDS vaccine. J. Med. Virol. 80:11–19. 69. Yamagata, T., J. Nishida, S. Tanaka, R. Sakai, K. Mitani, M. Yoshida, T. Taniguchi, Y. Yazaki, and H. Hirai. 1996. A novel interferon regulatory factor family transcription factor, ICSAT/Pip/LSIRF, that negatively regulates the activity of interferon-regulated genes. Mol. Cell. Biol. 16:1283– 1294. 70. Yin, Q., X. Wang, J. McBride, C. Fewell, and E. Flemington. 2008. B-cell receptor activation induces BIC/miR-155 expression through a conserved AP-1 element. J. Biol. Chem. 283:2654–2662.