Molecular characterization of Rif mutations in ...

Antimicrobial Original Research Paper

Molecular characterization of Rifr mutations in Enterococcus faecalis and Enterococcus faecium Xiaoxing Du1, Xiaoting Hua1, Tingting Qu2, Yan Jiang1, Zhihui Zhou1, Yunsong Yu1 1

Department of Infectious Diseases, Sir Run Run Shaw Hospital, College of Medicine, Zhejiang University, Hangzhou, China, 2State Key Laboratory for Diagnosis and Treatment of Infectious Disease, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, China Mutation rate is an important factor affecting the appearance and spread of acquired antibiotic resistance. The frequencies and types of enterococci mutations were determined in this study. The MICs of rifampicin in enterococci and their rifampicin-resistant mutants were determined by the Clinical and Laboratory Standards Institute (CLSI) agar dilution method. The Enterococcus faecalis isolates A15 and 18165 showed no significant differences in mutation frequencies or mutation rates. In Enterococcus faecium, the mutation frequency and mutation rate were both 6.4-fold lower than in E. faecalis. The spectrum of mutations characterized in E. faecium B42 differed significantly from that of E. faecalis. The types and rate of mutations indicated that E. faecalis had a higher potential to develop linezolid resistance. Rifampicin resistance was associated with mutations in the rpoB gene. Rifampicin MICs for the E. faecalis mutant were 2048 mg/l, but rifampicin MICs for E. faecium mutants ranged from 64 to 1024 mg/l. Keywords: Enterococcus, Antibiotic resistance, Rifampicin

Introduction Enterococci are important opportunistic pathogens, as they are the second most common pathogens isolated from ICU patients worldwide.1,2 Enterococcus faecalis and Enterococcus faecium are the two most commonly encountered species.3,4 E. faecium in particular has intrinsic and/or acquired resistance to many clinically important antimicrobial agents, including ampicillin and vancomycin.1,3 Mutation rate is an important factor affecting the appearance and spread of acquired antibiotic resistance. Bacteria with a high mutation rate generate more possibly resistant mutations.5 Loss of the methyldirected mismatch DNA repair system (MMR) leads to a higher mutation rate.6 A genetic system for analyzing base substitutions in Escherichia coli and other bacteria is based on the sequencing of rpoB mutations that generate the rifampicin-resistant (Rifr) phenotype.6–8 The beta subunit of RNA polymerase, which is involved in rifampicin binding, is highly conserved among prokaryotes, and Rifr mutants in many bacteria result from amino acid exchanges.6 The

Correspondence to: Yunsong Yu, Department of Infectious Diseases, Sir Run Run Shaw Hospital, College of Medicine, Zhejiang University, Hangzhou, 310016, China. Email: [email protected]

ß 2014 Edizioni Scientifiche per l’Informazione su Farmaci e Terapia DOI 10.1179/1973947813Y.0000000137

rpoB/Rifr system can be used to study the mutational processes in distinct bacterial species. Analysis of the specificity of the mutation rates and types of mutations with this genetic system can elucidate the potential development of antibiotic-resistant bacteria. Although the Rifr system has been employed to detect the mutation frequency in enterococci,9,10 only a few enterococcus Rifr mutants have been characterized at the molecular level.9 Here, we report Rifr mutations in E. faecalis and E. faecium.

Materials and Methods Bacterial strains, media, and antibiotics Restriction enzymes, T4 ligase, and Taq DNA polymerase were purchased from TaKaRa (Otsu, Shiga, Japan). All Enterococci cultures (Table 1) were grown at 37uC in brain–heart infusion (BHI) broth and agar (Oxoid, Basingstoke, UK). Rifampicin (Rif) was purchased from Sangon (Shanghai, China) and dissolved in methanol.

Amplification and sequencing of mutSL The E. faecalis mutS and mutL genes (from strains 18165 and A15) were identified via the genome sequence of E. faecalis V583. The E. faecium mutS and mutL loci were identified in the genome sequence of E. faecium strain DO.11 The primers designed for

Journal of Chemotherapy

2014

VOL.

26

NO.

4

217

Du et al.

Rif r mutations in E. faecalis and E. faecium

amplification of mutSL are shown in Supplementary Material 1 http://dx.doi.org/10.1179/1973947813Y. 0000000137.s1. All PCR were performed in 50 ml containing 5 ml of 106Ex Taq buffer, 1 ml of 100 mM dNTP mixture, 2 ml of the forward primer (10 pmol), 2 ml of the reverse primer (10 pmol), 0.25 ml of Takara Ex Taq, 37.75 ml of Milli-Q water, and 2 ml of genomic DNA. PCR conditions were as follows: 95uC for 4 min, 35 cycles of 95uC for 30 s, 55uC for 30 s, 72uC for 3 min, and a final extension at 72uC for 8 min. PCR products were purified and sequenced by Biosune biological company (Hangzhou, China).

Measurement of mutation frequency and rate For mutation frequency assays, overnight-cultured cells were harvested, washed twice with phosphatebuffered saline (PBS), and re-suspended in PBS. Serial dilutions of bacteria in PBS were plated on BHI containing 50 mg/ml Rif and incubated for 24 hours, and the total number of colony-forming units (CFU) was determined. The frequencies of mutations conferring resistance to Rif were determined as the ratio of mutant bacteria on Rif plates to the total number of viable bacteria on BHI plates. The mutation rate was calculated as described by Drake12 The mutation rate was calculated via the equation m5f/ln(Nm), where f is the median frequency and N is the population size. The differences in mutation frequencies and rates were evaluated by Student’s two-tailed t-test. The colonies in the Rifr BHI plates were used for isolating genomic DNA, PCR, and sequencing.

DNA isolation and sequencing Genomic DNA was isolated from colonies on the Rifr BHI plates with a TianGen genome isolation kit (TianGen Biotech Company Ltd, Beijing, China). DNA was amplified for sequencing with the primers listed in Table 2. PCR products were purified and sequenced by Biosune biological company (Hangzhou, China).

Determination of MICs of rifampicin in Enterococci and their Rifr mutants Rifampicin MICs were determined by the Clinical and Laboratory Standards Institute (CLSI) agar dilution method on Mueller–Hinton (MH) agar (Oxoid, Basingstoke, UK).13 Table 1 Bacterial strains used in the study Strain or plasmid Relevant characteristic(s)

Source

E. faecalis strains 18165 Vanr, clinical isolate, vanA Clinical sample A15 Vans, clinical isolate, vanA Clean urine E. faecium strains B42 Vanr, clinical isolate

218


2014

VOL .

Fresh fecal

26

NO .

4

Nucleotide sequence accession numbers The mutS and mutL genes from E. faecalis 18165 and A15 and E. faecium B42 were deposited into the Genbank database with an accession number JQ990961-6.

Results Sequencing of mutSL The mutS and mutL genes were amplified from E. faecalis (18165 and A15) and E. faecium B42 and sequenced. There were no differences between the mutSL genes in E. faecalis 18165 and A15. The MutS proteins of E. faecalis and E. faecium shared 79% identity and 72.2% similarity, whereas these values in the MutL protein were 69.4 and 72.4%, respectively. These results showed that the three isolates had robust mismatch repair systems.

Mutation frequencies and rates We measured the mutation frequencies of enterococci grown on Rifr BHI plates and calculated the mutation rates via Drake’s method.12 The mutation frequencies and rates of these enterococci isolates are shown in Fig. 1. However, E. faecium B42 generated mutation frequencies and mutation rates that were 6.4-fold lower than those of E. faecalis. The differences in mutant frequencies and rates in Enterococci suggested that the bacterial genetic background influenced the mutation rate.

Distribution of sites leading to Rifr mutation in the three isolates We sequenced the rpoB regions of E. faecalis A15 and 18165 and E. faecium B42 mutants. Table 3 shows 194 mutations that activate the Rifr phenotype, including 76 mutations occurring in A15, 86 mutations in 18165, and 104 mutations in B42.

Spontaneous mutation hotspots in rpoB E. faecalis 18165 had mutation hotspots at positions 1454 and 1465 (C:GRT:A) and position 1426 (C:GRA:T). Together, these three hotspots accounted for 71 of the 86 base substitutions (82.5%). The mutations at positions 1454 (C:GRT:A) and 1426 (C:GRA:T) also occurred in E. faecalis A15, with an incidence of 76.8% (56 of 76). The mutations in E. faecium B42 differed significantly Table 2 Primers used to amplify the rpoB gene Primer name

Sequence (59R39)

Primers from E. faecium EFM_RPOB1F GTCCGTTTCGGCTTTAATATA EFM_RPOB1R AAGAAACGAGCATTCAGCAA EFM_RPOB2F CGCAAGCGACTCAAGAACAG EFM_RPOB2R GAGCAAATGTTCCATCTTCA Primers from E. faecalis EFS_RPOB1S2 GTTCGTGCTTTAGGTTTCGGTTC EFS_RPOB1A2 GCGACTGCGACTACTTGTTTTGG EFS_RPOB2S2 GCAAAAACTATCTGAAAGTGACGAAG EFS_RPOB2A2 TGTCAATGTATTCGCCTAATGTTTCC

Du et al.


Figure 1 (A) The mutation frequencies and (B) rates of enterococcus strains.

from those in E. faecalis, indicating that the genetic background influenced the types of rpoB mutations. E. faecium B42 had another mutation hotspot at position 412 (C:GRA:T). The other base-pair changes in the rpoB gene were distributed more randomly in both organisms.

Isolate-specific mutation hotspots in rpoB The percentages of mutations at AT and GC base pairs are shown in Fig. 2A. A GC base-pair mutation bias was observed in all three isolates. The vast majority of the spontaneous base substitutions in rpoB that led to Rifr in E. faecalis A15 and 18165 and E. faecium B42 were transitions (Fig. 2B).

Enterococci rifampicin susceptibility We determined rifampicin MICs for Enterococci by the CLSI agar dilution method on MH agar (Fig. 3). Both E. faecalis 18165 and A15 showed the same resistance to rifampicin (MIC52048 mg/l). Rifampicin MICs for E. faecium B42 ranged from 64 to 1024 mg/l.

Discussion The beta subunit of RNA polymerase, which is involved in rifampicin binding, is highly conserved Table 3 Distribution of Rifr mutations in E. faecalis and E. faecium

Site (bp) 412 1426 1427 1435 1436 1454 1465 1466 1475 1481 Total

Amino acid change V138F V138I Q476K Q476R D479Y D479V G485D G485V H489D H489Y H489P H489R R492H S494L

Base-pair change CG)AT CG)TA CG)AT AT)GC CG)AT AT)TA CG)TA CG)AT CG)GC CG)TA AT)CG AT)GC CG)TA CG)TA

A15 18165

B42

4 0 22 0 0 0 34 0 0 5 4 1 1 5

1 0 13 0 0 0 42 0 1 16 5 3 1 4

10 4 12 5 1 1 15 2 5 0 11 1 8 29

76

86

104

among prokaryotes, and Rifr mutants detected in many bacteria result from amino acid exchanges.6 This system has been widely used to investigate mutational mechanisms in bacteria.6,14–24 The rpoB mutations found in E. coli Rifr mutants have also been observed in other bacterial species. In this study, we reported the types and rates of mutations in E. faecalis and E. faecium. The Rifr clusters in the rpoB gene were sequenced and analyzed for 162 E. faecalis mutants and 104 E. faecium mutants. Bacterial resistance to multiple antibiotics depends on several factors, including mutation rate.25 The mutation rate is defined as the in vitro frequency of detectable mutants in a bacterial population in the presence of a given antibiotic concentration.26 The rifampicin resistance frequency is often used as an indicator of mutation frequency.10 In our study, the mutation frequencies of E. faecalis and E. faecium were approximately 461028 and 761029, respectively. Gustafsson et al. reported that the mutation frequency generating rifampicin resistance varied between 1029 and 1027 in enterococci.10 A mutation frequency of 1026 has been observed in E. faecium.9 Many factors influence the mutation frequency in bacterial populations, including antibiotic concentrations in the selective window. Similar to Gustafsson et al., we used 50 mg/l rifampicin to select mutants, while Enne et al. used 20 mg/l rifampicin. Different experimental rifampicin concentrations might account for different observed mutation frequencies. The mutation frequency of E. faecalis was approximately 6-fold higher than that of E. faecium. Thus, E. faecalis has more potential to develop point mutations conferring resistance to antibiotics, such as linezolid.27 This result also explained why there was difficulty in selecting linezolid-resistant E. faecium but not E. faecalis.27 We defined nine distinct base substitutions at seven separate sites in rpoB of E. faecalis and 13 distinct base substitutions at 11 separate sites in rpoB of E. faecium (Table 3). It has been reported that S494L


2014

VOL .

26

NO .

4

219

Du et al.


Figure 3 strains.

Figure 2 Relative rpoB base substitution frequencies in enterococcus. Comparison of the (A) mutation occurring in AT pairs and GC pairs in rpoB and (B) transitions and transversions in rpoB.

and G485D mutants are not obtained independently of the V224I substitution,9 but we did not detect additional V224I substitutions in the S494L and G485D enterococci mutants. The different phenomenon might be caused by the difference in genetic background of isolates. Resistance to linezolid in enterococcus had been associated with point mutations in rRNA, such as G2576T and G2505A.27–30 E. faecalis showed a higher percentage of GRA and GRT mutations than E. faecium. The result suggested that E. faecalis had a higher potential than E. faecium to develop linezolid resistance. We determined the rifampicin susceptibility of E. faecalis and E. faecium. E. faecalis had higher rifampicin MICs than E. faecium, which had the same base substitutions as E. faecalis. The D516A E. coli mutant has weak Rif resistance, but the corresponding Pseudomonas aeruginosa mutant has a strong Rifr phenotype.24 Louw et al. reported that the level of rifampicin resistance varies independently of the mutation in the rpoB gene and the genetic background of Mycobacterium tuberculosis.31 The different Rifr phenotypes resulting from the same base substitutions in E. faecalis and E. faecium might be due to two reasons. Sequence differences in other regions of the RNA polymerase might affect the

220


2014

VOL .

26

NO .

4

MICs of rifampicin for the Rifr enterococcus

structure of the Rifr pocket and influence the specific residues that interact with Rif;24 additionally, other biological mechanisms may determine rifampicin resistance.31 An rpoB mutation in Bacillus subtilis alters the expression of many genes under its transcriptional control.22 Taken together, our studies revealed the differences in the rate and type of mutations in E. faecalis and E. faecium. The E. faecalis mutation rate was approximately 6-fold higher than that of E. faecium. These results indicated that E. faecalis had more potential to develop linezolid resistance. Rifampicin resistance was associated with point mutations that appeared in cluster I of the rpoB gene. E. faecalis exhibited higher Rif MIC values than E. faecium.

Conflict of Interest None.

Acknowledgments This work was supported by research grants from the National Natural Science Foundation of China (nos. NSFC30800035 and NSFC81101284), the Science Technology Department of Zhejiang Province (no. 2008C13029-1), and the Ministry of Health of the People’s Republic of China (no. 201002021).

References 1 Choudhury T, Singh KV, Sillanpaa J, Nallapareddy SR, Murray BE. Importance of two Enterococcus faecium loci encoding Gls-like proteins for In Vitro bile salts stress response and virulence. J Infect Dis. 2011;203:1147–54. 2 Theilacker C, Kaczyn´ski Z, Kropec A, Sava I, Ye L, Bychowska A, et al. Serodiversity of opsonic antibodies against Enterococcus faecalis – glycans of the cell wall revisited. PLoS One. 2011;6:e17839. 3 Chou YY, Lin TY, Lin JC, Wang NC, Peng MY, Chang FY. Vancomycin-resistant enterococcal bacteremia: comparison of clinical features and outcome between Enterococcus faecium and Enterococcus faecalis. J Microbiol Immunol Infect. 2008;41:124–9. 4 Mohamed JA, Huang DB. Biofilm formation by enterococci. J Med Microbiol. 2007;56:1581–8. 5 Bjorkholm B, Sjo¨lund M, Falk PG, Berg OG, Engstrand L, Andersson DI. Mutation frequency and biological cost of

Du et al.

6

7 8 9 10

11

12 13

14

15

16 17 18

antibiotic resistance in Helicobacter pylori. Proc Natl Acad Sci USA. 2001;98:14607–12. Garibyan L, Huang T, Kim M, Wolff E, Nguyen A, Nguyen T, et al. Use of the rpoB gene to determine the specificity of base substitution mutations on the Escherichia coli chromosome. DNA Repair (Amst). 2003;2:593–608. Zeibell K, Aguila S, Yan Shi V, Chan A, Yang H, Miller JH. Mutagenesis and repair in Bacillus anthracis: the effect of mutators. J Bacteriol. 2007;189:2331–8. Kim M, Wolff E, Huang T, Garibyan L, Earl AM, Battista JR, et al. Developing a genetic system in Deinococcus radiodurans for analyzing mutations. Genetics. 2004;166:661–8. Enne VI, Delsol AA, Roe JM, Bennett PM. Rifampicin resistance and its fitness cost in Enterococcus faecium. J Antimicrob Chemother. 2004;53:203–7. Gustafsson I, Sjo¨lund M, Torell E, Johannesson M, Engstrand L, Cars O, et al. Bacteria with increased mutation frequency and antibiotic resistance are enriched in the commensal flora of patients with high antibiotic usage. J Antimicrob Chemother. 2003;52:645–50. Willems RJ, Top J, Smith DJ, Roper DI, North SE, Woodford N. Mutations in the DNA mismatch repair proteins MutS and MutL of oxazolidinone-resistant or -susceptible Enterococcus faecium. Antimicrob Agents Chemother. 2003;47:3061–6. Drake JW. A constant rate of spontaneous mutation in DNAbased microbes. Proc Natl Acad Sci USA. 1991;88:7160–4. Clinical and Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard, CLSI document M07-A9, 9th edn, Clinical and Laboratory Standards Institute, Wayne, PA; 2012. Wolff E, Kim M, Hu K, Yang H, Miller JH. Polymerases leave fingerprints: analysis of the mutational spectrum in Escherichia coli rpoB to assess the role of polymerase IV in spontaneous mutation. J Bacteriol. 2004;186:2900–5. Miller JH, Funchain P, Clendenin W, Huang T, Nguyen A, Wolff E, et al. Escherichia coli strains (ndk) lacking nucleoside diphosphate kinase are powerful mutators for base substitutions and frameshifts in mismatch-repair-deficient strains. Genetics. 2002;162:5–13. Davidsen T, Bjoras M, Seeberg EC, Tonjum T. Antimutator role of DNA glycosylase MutY in pathogenic Neisseria species. J Bacteriol. 2005;187:2801–9. Meier P, Wackernagel W. Impact of mutS inactivation on foreign DNA acquisition by natural transformation in Pseudomonas stutzeri. J Bacteriol. 2005;187:143–54. Morlock GP, Plikaytis BB, Crawford JT. Characterization of spontaneous, In vitro-selected, rifampin-resistant mutants of Mycobacterium tuberculosis strain H37Rv. Antimicrob Agents Chemother. 2000;44:3298–301.


19 Anthony RM, Schuitema AR, Bergval IL, Brown TJ, Oskam L, Klatser PR. Acquisition of rifabutin resistance by a rifampicin resistant mutant of Mycobacterium tuberculosis involves an unusual spectrum of mutations and elevated frequency. Ann Clin Microbiol Antimicrob. 2005;4:9. 20 Wang G, Wilson TJ, Jiang Q, Taylor DE. Spontaneous mutations that confer antibiotic resistance in Helicobacter pylori. Antimicrob Agents Chemother. 2001;45:727–33. 21 Nicholson WL, Maughan, H. The spectrum of spontaneous rifampin resistance mutations in the rpoB gene of Bacillus subtilis 168 spores differs from that of vegetative cells and resembles that of Mycobacterium tuberculosis. J Bacteriol. 2002;184:4936–40. 22 Maughan H, Galeano B, Nicholson WL. Novel rpoB mutations conferring rifampin resistance on Bacillus subtilis: global effects on growth, competence, sporulation, and germination. J Bacteriol. 2004;186:2481–6. 23 O’Sullivan DM, McHugh TD, Gillespie SH. The effect of oxidative stress on the mutation rate of Mycobacterium tuberculosis with impaired catalase/peroxidase function. J Antimicrob Chemother. 2008;62:709–12. 24 Jatsenko T, Tover A, Tegova R, Kivisaar M. Molecular characterization of Rif(r) mutations in Pseudomonas aeruginosa and Pseudomonas putida. Mutat Res. 2010;683:106–14. 25 Sjolund M, Wreiber K, Andersson DI, Blaser MJ, Engstrand L. Long-term persistence of resistant Enterococcus species after antibiotics to eradicate Helicobacter pylori. Ann Intern Med. 2003;139:483–7. 26 Martinez JL, Baquero F. Mutation frequencies and antibiotic resistance. Antimicrob Agents Chemother. 2000;44:1771–7. 27 Prystowsky J, Siddiqui F, Chosay J, Shinabarger DL, Millichap J, Peterson LR, et al. Resistance to linezolid: characterization of mutations in rRNA and comparison of their occurrences in vancomycin-resistant enterococci. Antimicrob Agents Chemother. 2001;45:2154–6. 28 Afsar I, Baris I, Sener AG, Koksal V, Demirci M. [Linezolidresistant Enterococcus faecium: the first G2576T mutation in Turkey]. Mikrobiyol Bul. 2012;46:516–8. 29 Cai JC, Hu YY, Zhang R, Zhou HW, Chen GX. Linezolidresistant clinical isolates of meticillin-resistant coagulasenegative staphylococci and Enterococcus faecium from China. J Med Microbiol. 2012;61:1568–73. 30 Bourgeois-Nicolaos N, Massias L, Couson B, Butel MJ, Andremont A, Doucet-Populaire F. Dose dependence of emergence of resistance to linezolid in Enterococcus faecalis in vivo. J Infect Dis. 2007;195:1480–8. 31 Louw GE, Warren RM, Gey van Pittius NC, Leon R, Jimenez A, Hernandez-Pando R, et al. Rifampicin reduces susceptibility to ofloxacin in rifampicin-resistant Mycobacterium tuberculosis through efflux. Am J Respir Crit Care Med. 2011;184:269–76.


2014

VOL .

26

NO .

4

221