Molecular Characterization of Sarcocystis species in

Mansoura University Faculty of Veterinary Medicine Department of parasitology

"Molecular Characterization of Sarcocystis species in sheep" Thesis presented by

Bassem Mohammed Mohammed Elmishmishy (B.V.Sc., 2006, Mansoura University) (M. V. Sc., 2011, Parasitology, Mansoura University)

Under supervision of Prof. Dr. Salah Ahmed Othman Abu-Elwafa Professor and Head of Parasitology Department Faculty of Vet. Med. Mansoura University

Dr. Moustafa Abd El-Salam Ahmed Al-Araby Associate Professor of Parasitology Faculty of Vet. Med. Mansoura University Presented to Faculty of Veterinary Medicine Mansoura University

For The degree of Philosophy Doctor of Veterinary Medical Science (Ph. D) (Parasitology)

2017

‫جامعة المنصورة‬ ‫كلية الطب البيطرى‬ ‫قسم الطفيليات‬

Mansoura University Faculty of Vet. Medicine. Parasitology Department

Approval sheet This is to approve that the Ph. D. thesis presented by Bassem Mohammed Mohammed Elmishmishy ; entitled “Molecular Characterization of Sarcocystis species in sheep” to the Faculty of Veterinary Medicine, Mansoura University for the degree of Ph. D. in Veterinary Medical Sciences (Parasitology), has been approved by the examining committee.

Prof. Dr. Mahmoud Abdel-Naby Omar El-Seify Professor of Parasitology, Faculty of Veterinary Medicine, Kafrelsheikh University.

Prof. Dr. Yehia Zakaria Khair-Allah Otify Professor of Parasitology, Faculty of Veterinary Medicine, Alexandria University.

Prof. Dr. Salah Ahmed Othman Abu- Elwafa Professor and Head of Parasitology Department Faculty of veterinary medicine, Mansoura University (Supervisor)

Date: 9 / 5 / 2017.

Mansoura University Faculty of Veterinary Medicine Parasitology Department

Supervisors A Thesis Title: Molecular Characterization of Sarcocystis species in sheep. Researcher Name: Bassem Mohammed Mohammed Elmishmishy. Under supervision of No

Supervisor

1

Prof. Dr. Salah Ahmed Othman AbuElwafa

2

Dr. Moustafa Abd ElSalam Ahmed AlAraby

Job Professor and Head of Parasitology Department Faculty of Veterinary Medicine, Mansoura University. Associate Professor of Parasitology , Faculty of Veterinary Medicine, Mansoura University

Signature

Head of the Department

Vice dean for Postgraduate studies, research and cultural affairs.

Dean of the Faculty

Prof. Dr. Salah Ahmed Othman Abu-Elwafa

Prof. Dr. Gehad Ramadan Mohamed EL-Sayed

Prof. Dr. Nabil Abu-Heakal Sayed Ahmed

Mansoura University Faculty of Veterinary Medicine Parasitology Deptartment

Examining Committee Supervisors A Thesis Title: Molecular Characterization of Sarcocystis species in sheep. Researcher Name: Bassem Mohammed Mohammed Elmishmishy. Under supervision of No

Supervisor

1


2

Job

Dr. Moustafa Abd ElSalam Ahmed AlAraby

Professor and Head of Parasitology Department Faculty of Veterinary Medicine, Mansoura University. Associate Professor of Parasitology Faculty of Veterinary Medicine Mansoura University

Approval Committee No

Name

Job

1

Prof. Dr. Mahmoud Abdel- Naby Omar El- Seify

2

Prof. Dr. Yehia Zakaria KhairAllah Otify.

3

Prof. Dr. Salah Ahmed Othman Abu-Elwafa.

Head of the Department


Professor of Parasitology, Faculty of Veterinary Medicine, Kafrelsheikh University. Professor of Parasitology, Faculty of Veterinary Medicine, Alexandria University. Professor and Head of Parasitology Department, Faculty of Veterinary Medicine, Mansoura University. " Supervisor "

Vice dean for Postgraduate studies, research and cultural affairs.

Prof. Dr. Gehad Ramadan Mohamed ELSayed

Dean of the Faculty

Prof. Dr. Nabil Abu-Heakal Sayed Ahmed

Acknowledgement First and Foremost, I praise to ALLAH for helping me in all times, and for every thing ALLAH gives me especially his gift EL-ISLAM hoping that this work will help my community.

With my all feeling of respect and gratitude, I gladly thank Prof. Dr. Salah Ahmed Othman Abu-Elwafa; Prof. and head of Parasitology department, Faculty of Veterinary Medicine, Mansoura University, for valuable supervision, guidance and continuous help throughout this work inspite of his overloaded responsibilities.

My most sincere gratitude, gladly thanks and respect are also to Dr. Moustafa Abd El-Salam Ahmed Al-Araby; Associate Professor of Parasitology, Faculty of Veterinary Medicine, Mansoura University, for supervision, continued advice, persistent stimulation and support throughout this work.

I'm extremely gradeful to Dr. Ibrahim Elsayed Abdelkader Abass; Associate Professor of Parasitology, Faculty of Veterinary Medicine, Mansoura University, for his kind supports in the practical part and analysis of molecular data throughout this work.

I

Contents No 1 2

3

Title Introduction Review of literature 1. Historical view. 2. Incidence of Sarcocystis species in sheep. 2.1. Incidence of Sarcocystis species in sheep in Egypt. 2.1. Incidence of Sarcocystis species in sheep all over the world. 3. General morphological findings of the Sarcocystis species in sheep. 4. Molecular characterization of Sarcocystis species. 4.1. Molecular characterization of Sarcocystis species in sheep in Egypt. 4.1. Molecular characterization of Sarcocystis species all over the world. Material and methods. 1. Study area and animals. 2. Collection of specimens. 3. Examination of the collected samples. 3.1. Detection of macroscopic cysts. 3.2. Detection of microscopic cysts. 3.2.1. Muscle squash technique. 3.2.2. Isolation, purification and preservation of bradyzoites. 3.3. Histopathological examination. 4. DNA extraction and PCR amplification 4. 1. Equipment of DNA extraction and PCR amplification 4.1.1. QIAamp DNA Mini Kit 4.1.2. Equipment and instruments used for extraction of nucleic acids. 4.1.3. PCR Master Mix used for PCR. 4.1.4. Oligonucleotide primers used in PCR. 4.1.5. DNA ladder (Molecular weight marker). 4.1.6. Material used for agarose gel electrophoresis.

II

Page 1 5 5 7 7 10 17 23 24 24 29 29 29 31 31 31 31 32 34 35 35 35 35 35 36 36 36

4

4.1.7. Equipment and instruments used in PCR and electrophoresis. 4.2. Methods of DNA extraction and PCR amplification. 4.2.1. Extraction of Sarcocystis species DNA. 4.2.2. Preparation of PCR Master Mix. 4.2.3. Cycling conditions of PCR. 4.2.4. DNA Molecular weight marker 4.2.5. Agarose gel electrophoreses with modification 4.3. Materials used for PCR product purification and Sequencing. 4.3.1. QIAquick PCR Product extraction kit. 4.3.2. Bigdye Terminator V3.1 cycle sequencing kit. 4.3.3. Kit used for purification of the sequence reaction 4.3.4. Applied Biosystems 3130 automated DNA Sequencer. 4.4. Methods for purification of the PCR Products. 4.5. Sequencing reaction. 4.5.1. Purification of the sequence reaction. 4.5.2. Loading the sequencer machine. 4.5.3. Phylogenetic analysis. Results I. Prevalence and seasonal dynamics of Sarcocystis species among slaughtered sheep. 1. Incidence and tissue distribution of sarcocystosis. 2. Prevalence of the revealed Sarcocystis species among different age groups of examined sheep carcasses. 3. Several tissues infected with Sarcocystis species in the same sheep. 4. Seasonal dynamics of the revealed Sarcocystis species. 5. Prevalence of Sarcocystis species in relation to sex of examined sheep. II. Morphological features of the revealed Sarcocystis species. 1. Morphological features of the revealed macroscopic cysts. 2. Morphological features of the revealed microscopic cysts. III- Molecular characterization of macroscopic and microscopic cysts.

III

37 38 38 39 39 40 40 41 41 41 41 41 41 42 43 44 44 45 45 45 46 46 46 48 54 54 55 60

5 6 7 8

1. PCR reaction. 2. Sequencing reaction and Species identification. 2.1. Alignment of the revealed sequences of Sarcocystis species. 2.1.1. S. gigantea isolate. 2.1.2. S. tenella isolate. 3. Cluster analysis and diversity indices of the revealed Sarcocystis species. 3.1. S. gigantea isolates. 3.2. S. tenella isolates. 4. Neutrality indices of the revealed Sarcocystis species. 5. Genetic differentiation among different species of Sarcocystis. 6. Phylogenetic tree of the revealed Sarcocystis species. 7. Amino acids translation and alignment of the revealed Sarcocystis species sequences. 7.1. Sarcocystis gigantea isolate 7.2. S. tenella isolates. Discussion. Summary. References. Arabic Summary.

IV

60 62 62 62 66 73 73 73 76 76 78 81 81 82 84 98 101 1

List of figures No 1 2 3 4 5

6 7 8 9 10 11 12

13

14

Title Page Figure (1): Showing macroscopic cysts in fresh muscles of 56 esophagus of sheep by necked eyes. Figure (2): Showing macroscopic cyst with a ruler. 56 Figure (3): Showing thin wall of macroscopic cysts (arrow) in 57 sheep muscle, C.S. stained with H & E (X10). Figure (4): Showing bradyzoites (arrow) stained with Giemsa 57 from macroscopic cyst (X100). Figure (5): Showing Giemsa stained (A) and non-stained (B) 58 microscopic cysts (arrow) in compressed sections of sheep esophagus (X10). Figure (6): Showing smooth thick wall of microscopic cysts 58 (arrow) in sheep muscle, C.S. stained with H & E (X100). Figure (7): Showing striated thick wall of microscopic cysts 59 (arrow) in sheep muscle, C.S. stained with H & E (X100). Figure (8): Showing unstained bradyzoites (arrow) from 59 microscopic cyst (X40). Figure (9): Showing PCR results of the first 10 sample PCR 60 products (Agarose gel). Figure (10): Showing PCR results of the second 10 sample PCR 61 products (Agarose gel). Figure (11): Showing PCR results of the last 20 sample PCR 61 products (Agarose gel). Figure (12): Alignment the revealed partial 18S rRNA of S. 63 gigantea isolate with other sequences on Genbank. This figure showing the complete identity between S. gigantea isolate of the present study and S. gigantea (KC209733) Norway as well as S. moulei (KF489432) from Iran. Figure (13): Alignment of the present study S tenella isolates. 67 Intraspecific nucleotide variation was noted at positions (13, 23 and 44) forming 3 haplotypes. Figure (14): Alignment the revealed partial 18S rRNA of S. tenella isolate with other sequences on Genbank. This figure 68 showing the identity between the revealed three haplotypes of S. tenella isolate of the present study with other sequences on 69 Genbank.

V

15

16

17

18

19

20

Figure (15): Frequencies of sequence sections of 18S rRNA haplotypes of S. gigantea isolates of sheep from Egypt (S1) and variable geographical regions. Six haplotypes were noted. The scale bar refers to evolutionary distances in substitutions per site. Figure (16): Frequencies of sequence sections of 18S rRNA haplotypes of S. tenella isolates of sheep from Egypt (S2-S10) and variable geographical regions. Eleven haplotypes out of 32 isolates were noted. The Egyptian isolates were arranged in three haplotypes. The scale bar refers to evolutionary distances in substitutions per site. Figure (17): Maximum Pairsmony phylogentic tree for different Sarcocystis spp. including isolates of the present study based on partial 18S rRNA gene sections. Tree was constructed using Maximum Pairsmony with SPR algorithm. The bootstrap analysis was conducted using 1000 replicates. Scale bar indicates the proportion of sites changing along each branch. Figure (18): Protein sequence alignment of partial 18S rRNA of different S. gigantea isolates including that of the present study. Complete identity was noted with S. gigantea isolate from Norway (KC209733). Figure (19): Protein sequence alignment of partial 18S rRNA of the nine isolates of S. tenella of the present study. Three mutational sites were noted at positions 16, 20 and 27 resulting in three haplotypes formation. Figure (20): Protein sequence alignment of partial 18S rRNA of the three S. tenella haplotypes of the present study with those published on Genbank. Variable amino acids substitutions at different positions were noted.

VI

74

75

80

81

82

83

List of Tables No 1 2 3 4 5 6 7 8 9 11 11 12 13 14 15 16 17 18

Title Table (1): Seasonal examination of muscle samples concerning tissues and age of examined sheep. Table (2): Oligonucleotide primers sequences used in PCR. Table (3): Composition of PCR Mixure. Table (4): Cycling conditions of PCR. Table (5): Preparation of master mix using Bigdye Terminator V3.1 cycle sequencing kit. Table (6): Incidence of Sarcocystis species among different tissue samples. Table (7): Incidence of macroscopic cysts in esophagus. Table (8): Prevalence of microscopic cysts in different muscle samples according to age. Table (9): The incidence of Infection in several tissues of the same slaughtered sheep. Table (10): Seasonal prevalence of microscopic cysts in different tissues. Table (11): Seasonal prevalence of macroscopic cysts in esophagus muscles according to age. Table (12): Seasonal prevalence of microscopic cysts in esophagus muscle samples according to age. Table (13): Seasonal prevalence of microscopic cysts in diaphragm muscle samples according to age. Table (14): Seasonal prevalence of microscopic cysts in abdominal muscles muscle samples according to age. Table (15): Seasonal prevalence of mixed infection of microscopic and macroscopic cysts according to age. Table (16): Seasonal prevalence of infection in several tissue samples of the same slaughtered sheep according to age. Table (17): Prevalence of infection in relation to sex of slaughtered sheep. Table (18): Morphometric data of microscopic and macroscopic cysts.

VII

Page 30 36 39 40 42 49 49 49 50 50 51 51 51 52 52 53

53 56

19

21

21

22

23 24

25 26

Table (19): Partial 18S r RNA Sarcocystis gigantea sequences retrieved from Genbank. This table showing the percent of identity and the nucleotide polymorphism between those sequences and the present study isolate. Table (20): Partial 18S rRNA Sarcocystis tenella sequences retrieved from Genbank. This table showing the percent of identity and the nucleotide polymorphism between those sequences and first haplotype (H1) of S. tenella isolate in the present study (samples 2, 5, 9 & 10). Table (21): Partial 18S r RNA Sarcocystis tenella sequences retrieved from Genbank. This table showing the percent of identity and the nucleotide polymorphism between those sequences and second haplotype (H2) of S. tenella isolate in the present study (samples 3, 4, 6 & 7). Table (22): Partial 18S r RNA Sarcocystis tenella sequences retrieved from Genbank. This table showing the percent of identity and the nucleotide polymorphism between those sequences and third haplotype (H3) of S. tenella isolate in the present study (sample 8). Table (23): Different diversity and neutrality indices of the revealed Sarcocystis species. Table (24): Genetic distances among different species of Sarcocystis. E. granulosus was used as an out group. These values were estimated using the software MEGA version (6). Table (25): Complementary table for the sequences used for phylogenetic analysis. Table (26): The abbreviation of the amino acids

VIII

64

70

71

72

76 77

79 83

Introduction

Introduction Sarcocystis species is considered one of the most prevalent protozoal infections among domestic animals. Sarcocystis is an obligatory heteroxenous tissue cyst forming coccidial parasites which belongs to family Sarcocystidae, Phylum Apicomplexa. The name is Greek word, derived from sarkos, meaning muscle or flesh, and kystis, meaning bladder and describes the stage of the parasite found encysted in the tissue of its host (Dubey et al., 1989 a and Dubey & Odening, 2001). A unique characteristic of sarcocystosis that it has a diheteroxenous life cycle shared between two different types of hosts (Odening, 1998). Domestic animals including dogs, cats and man serve as predator or definitive hosts while all herbivorous animals ( cattle, buffalo, sheep, goat, camel, pig, rat…..etc.) act as prey or intermediate hosts (Dubey et al., 1989 a & Lindsay et al. 1995). Both intermediate and final host may harbor one or more Sarcocystis species (Mehlhorn and Heydorn, 1978), where this genus has more than 200 species (Frenkel and Smith, 2003). These different hosts accommodate different life stages of the parasite; sexual reproduction occurs in the definitive host, and asexual reproduction in the intermediate host (Dubey et al., 1989 a & Dubey and Odening, 2001). Definitive hosts are carnivorous, typically infected by preying or scavenging on infected tissues of intermediate hosts.

1

Introduction

Sarcocystis spp in sheep according to (Dubey et al., 2015) belong to Phylum: Class: Subclass: Order: Suborder: Family: Subfamily: Genus: Species :

Apicomplexa Sporozoasida Coccidiasina. Eucoccidiorina. Eimeriorina. Sarcocystidae. Sarcocystinae. Sarcocystis. Sarcocystis tenella. Sarcocystis arieticanis. Sarcocystis gigantea. Sarcocystis medusiformis

Economic losses caused by Sarcocystis species infection may be due to clinical or subclinical form.

In intermediate host, the severity of clinical

symptoms caused by Sarcocystis species depends on the dose of ingested sporocysts and immune status of the host (Uggla and Buxton, 1990; O’Donoghue and Rommel, 1992 and Heckeroth and Tener, 1998). Sarcocystis tenella can lead to acute sarcocystosis in sheep (Heckeroth and Tener, 1998) decreasing meat quality with subsequent downgrading or even condemnation of carcasses due to presence of macroscopic sarcocysts (Mostafa and Yasein, 2010). Such infections with Sarcocystis species have been incriminated for losses of several million dollars yearly due to down grading of beef and sheep carcasses (Tenter, 1995). Also, it may cause abortion, poor growth and acute fatal illness (Dubey, 1976 and Dubey et al., 1989 a). However, not all species of Sarcocystis species are pathogenic for intermediate hosts. Sarcocystis species was very rarely to cause illness in the definitive hosts.

2

Introduction Four species of Sarcocystis species (Sarcocystis tenella, Sarcocystis arieticanis, Sarcocystis gigantea, and Sarcocystis medusiformis) are known to parasitize sheep. The two macrocystic species; S. gigantea and S. medusiformis, are non-pathogenic (Dubey, et al., 1989 a), whereas the two microcystic species; S. tenella and S. arieticanis are pathogenic and can cause disease in non-immune animals (Dubey, et al., 1989 a) and (Tenter, 1995). Generally, species transmissible via canines seem to be more pathogenic than those transmissible via other final hosts as felines (Dubey et al., 1989 a). Sarcocystis tenella (synonymous = Sarcocystis ovicanis) is a dog–sheep protozoan parasite, causing a wide spread enzootic muscle parasitosis and neurological disease mainly in lambs (Pescador et al., 2007). Also causes significant losses in the lifestock industry due to death of the animal or abortion of pregnant ewes during acute sarcocystosis and reduced weight gain, milk and wool production during chronic sarcocystiosis (Dubey et al., 1982; Dubey et al., 1989 a; Dubey et al., 1989 b; Tenter, 1995; Henderson et al., 1997; Yazicioğlu and Beyazit, 2005; Titilincu, et al., 2008 and Da Silva et al., 2009). Species identification of Sarcocystis species is usually performed by morphological characterization of the cyst especially cyst wall structure, character of sporocysts under light microscopy and the type final hosts (Huong, 1999 and Dubey et al., 1989 a). Moreover, the use of transmission electron microscopy (TEM) is the ultimate tool for perfect and sharp characterization of the sarcocysts (Mehlhorn et al., 1976) but, it is a highly costive method for diagnosis. Since the appearance of sarcocysts may change depending on the location and stage of development of sarcocysts and other conditions of parasitized cell, molecular studies have been suggested to confirm species identification (Levine,

3

Introduction 1986 and Dahlgren et al. 2007). Gene sequence data analysis is also very useful tool to clarify whether morphologically similar sarcocysts in intermediate hosts are the same or have different species (Yang et al., 2001). In recent years, the evident of new molecular biological techniques has provided new diagnostic means for parasitic infections. PCR reaction has been developed recently as a method for the genetical differentiation of sarcocystis organisms (Welsh, and McClelland, 1990; Williams, et al., 1990; Clark, and Lanigan 1993; Williams, et al., 1993 and Hamidinejat et al., 2014). Sequencing is performed to DNA product obtained from PCR reaction for extra species differentiation of sarcocysts because it is the more sensitive technique has been performed.

This study is aimed to investigate the following objectives: 1-

Updating the data about the prevalence and distribution patterns of different Sarcocystis species infecting sheep.

2- Detection of sheep Sarcocystis species found in Egypt and determination of species variation through their morphological characteristics using light microscopy. 3- Amplification of genomic DNA from sheep Sarcocystis species by PCR reaction and performing sequencing to differentiate the different types of Sarcocystis species in Egypt as well as performing phylogenic tree. 4- Comparison between data obtained from morphological findings and genetic expression.

4

Review of literature Review of literature. 1. Historical view: Sarcocystis species were firstly reported by Friedrich Miescher in 1843 as” Milky white threads” in the skeletal muscle of deer mouse (M. musculus) caught in his house in Switzerland (Miescher, 1843). The parasite was known as Miescher`s tubules (Levine and Tadros, 1980). Sarcocystis species are worldwide in distribution found in a large variety of hosts (wild animals, domestic animals, and man). One unique characteristic of Sarcocystis is diheteroxenous life cycle; two different types of hosts, a definitive host and an intermediate host, succeed one another in the life cycle (Odening, 1998). These different hosts accommodate different life stages of the parasite; sexual reproduction occurs in the definitive host, and asexual reproduction in the intermediate host (Dubey et al., 1989 a & Dubey and Odening, 2001). The carnivores as final host are typically infected by preying or scavenging on infected intermediate prey hosts. For a long time, Sarcocystis species taxonomy was unknown. Butschli considered it as a sporozoan in 1882 (Levine, 1986). Heydron et al. (1975) suggested nomenclature of Sarcocystis species by combination of the Latin names of the intermediate and definitive hosts, e. g. Sarcocystis ovicanis (Sarcocystis tenella), in which dog plays as a final host while sheep is intermediate one. Also Sarcocystis ovifelis (Sarcocystis gigantea) in which cat plays as a final host while sheep is intermediate one. Sarcocystis species life cycle was introduced by Fayer (1972) and Rommel et al. (1972) by the demonstration of the in vitro gametogony and oocyst formation of Sarcocystis falctula in poultry by the electron microscope.

5

Review of literature Many experiments were performed in sheep to demonstrate the heteroxenous life cycle of Sarcocystis. The coccidian part of the cycle occurs in the intestine of a predator (the definitive host), following ingestion of muscle or nervous tissue containing sarcocysts. The cyst wall is digested to release bradyzoites (cystozoites) which penetrate intestinal goblet cells. Within a day, these become differentiated into male and female gametes which migrate beneath the lamina propria to form a zygote (Herbert and Smith, 1987 and Dubey et al., 1989 a). The zygote develops into oocyst containing two sporocysts each one contains four sporozoites. Sporocysts are passed in

faeces and become immediately

infective to the intermediate host (Mehlhorn and Heydron, 1978). Once oocysts or sporocysts are ingested by a suitable intermediate host the sporocysts excyst in the small intestine and sometimes may excyst in the abomasum of ruminants (Cawthorn et al., 1986). After penetrating the small intestine they are found in the endothelial lining of arteries within a variety of tissues, especially lymphoid tissue, the gastrointestinal tract and skeletal muscle. After about 10 days they undergo extensive nuclear division (endopolygeny) so that within a further 10 days differentiated meronts are seen sticked into the lumen of the blood vessel (O'Donoghue and Ford, 1984). These first generation merozoites are released into the blood stream and enter the endothelial cells of capillaries in a wide variety of body tissues where they multiply by endopolygeny; the number of such divisions is unknown. Mature second generation meronts are found 4 - 5 weeks after infection and these, in turn, are released into the blood stream (Dubey et al., 1989 a). The meronts can be found free in the blood or within mononuclear cells, but mostly located in the mononuclear phagocyte system associated with the liver and visceral lymph nodes. Nuclear division within phagocytic cells has been reported (Fayer, 6

Review of literature 1979), these have been referred as third generation meronts but it is not known if this is an obligatory part of the life cycle. Meronts have also been found in circulating lymphocytes (Fayer, 1979). Second and 'third generation' meronts enter striated muscle cells or nervous tissue and subsequently immature cysts may be seen 6 weeks post infection. The developing intracellular sarcocysts is separated from the host cell by a parasitophorous vacuole which becomes incorporated into the cyst wall. The cysts are septate and the characteristics of the cyst wall represented important features used to differentiate species. Cysts vary in length from several micrometers to few centimeters. Early cysts contain globular zoites (metrocytes) which reproduce by endodyogeny (non-infective to the definitive host). The cyst continues to grow in size with an increase in the number of zoites contained within it. About 10 weeks post infection banana shaped bradyzoites are formed and become infective to the definitive host.

2. Incidence of Sarcocystis species in sheep: 2.1. Incidence of Sarcocystis species in sheep in Egypt: Mohamed (1979) investigated sheep in Egypt for Sarcocystis species infection by collecting meat samples from 514 freshly slaughtered sheep at Cairo abattoir. Samples were taken from diaphragm, esophagus and abdominal muscles of each sheep. Sarcocystis ovicanis were detected in all samples (100 %). No variation was detected in seasons as the rate of infection was 100% in all seasons. Ali (1985) examined different tissues of sheep carcass including esophagus, diaphragm, cardiac muscles and other muscles for presence of Sarcocystis species infection in Assuit abattoir. Sarcocystis infections were 7

Review of literature detected in 61.41% of examined sheep. Histological features revealed that microscopic cysts were only detected. Only one species of Sarcocystis was detected with smooth and thin cystic wall. Elsayed (1985) examined sheep muscular tissue for Sarcocystis infection in Aswan area using light and electron microscope. The prevalence of natural infection with Sarcocystis species in sheep was 90%. Esophagus showed the highest infection rate among infected tissues (85%). El-Ganiny (1989) studied the natural infection of Sarcocystis species in different tissues of sheep in El-Minia Provence. Esophagus, tongue, diaphragm and heart muscles were inspected. The natural infection was detected in 80% in examined sheep. The incidence was 83 % in the esophagus, 81% in the tongue, 65.3% in the diaphragm and 51.6% in the heart. The muscles of young animals showed very low infection rate, while in older ages the ratio reach 100%. Hassanien (1992) examined 46 sheep slaughtered at Kalubia abattoirs for presence of Sarcocystis species. Only heart muscles were inspected. The incidence rate was 69.57% in examined samples. Mohammed (1996) investigated slaughtered sheep in Assiut Govemorate for muscular parasites infection. The incidence rate of Sarcocystis species was 45.5%. Only microscopic cysts were detected in muscular tissues. Macroscopic cysts were absent in all examined animals. Seasonal variation revealed that incidence rate increased in autumn and decreased in winter. Sarcocystis species were also found in both sexes. Older sheep showed higher infection rate than that of younger ones. Concerning the infected tissues; the highest incidence of microscopic cysts was noticed in the esophagus followed by diaphragm, skeletal, masseter, heart and tongue respectively.

8

Review of literature El-Saieh (1998) studied the prevalence of Sarcocystis species in 30 slaughtered sheep in Qena Governorate abattoirs. The prevalence of infection was 69.95 %.

Both macroscopic and microscopic cysts were detected in

examined sheep carcasses. The identified cysts included: S tenella and S. gigantea. The prevalence rate in adult sheep was 98.3%. Concerning the effect of sex, all the examined females were positive for Sarcocystis species (100%) while the prevalence in males that 66.66%. Regarding to seasonal dynamics, Sarcocystis species infection had higher incidence in summer season (94.74%). Hassan (2004) carried out a study for diagnosis of the parasites causing abortion using serological technique (ELISA). A total of 70 female sheep from private farms in El Fayoum Governorate were examined. The prevalence rate of Sarcocystis species was 10% (7 / 70 sheep). Basher (2006) examined sheep in Sues Canal area for detection of Sarcocystis species cysts. The prevalence rate was 84%. Only microscopic cyst was found. Females had higher prevalence than that of males 54.3% and 33.8% respectively. Mahran (2009) examined esophagus, diaphragm, heart and tongue in addition to intercostal muscles tissue samples collected from 555 sheep slaughtered at the abattoirs in Shalatin area, Red Sea Governorate for detection of Sarcocystis species cysts using microscopic examination. The prevalence of Sarcocystis species cysts was 41.26% (229 / 555). Macroscopic and microscopic cysts were detected. Macroscopic cysts were detected in 9.9% of the examined sheep. The intensity of infection ranged from 1 to 35 cysts per carcass and identified as Sarcocystis gigantea. Microscopic cysts were found in (81.8%) of sheep carcasses and the intensity of infection ranged from 13 to 25 cysts per carcass and identified as Sarcocystis tenella. Esophagus appeared to be more affected when compared to the other organs. Animals more than one year old 9

Review of literature were more affected (46.96 %) than those younger than one year old (30.56 %). The females had a higher prevalence rate (54.86 %) than that of males (37.78 %). Infestation rate reached its peak in winter season. Aly (2012) examined sheep carcasses in Qena Governorate for detection of Sarcocysis species. The incidence of infection was 68.9%. The examination of Sarcocystis species cysts revealed occurrence of both macroscopic. The microscopic cysts and the rate of infection was 65.6% among microscopic ones, while that of macroscopic cysts was 2.8%. Referring to the seasonal dynamics, the higher incidence was recorded during summer and autumn. Heart muscles were the most common tissue of infection. Histological examination revealed presence of one microscopic species with smooth, thin cyst wall in different organs of sheep carcasses. Concerning the seasonal variations, the highest infection rate was recorded in summer (5.13%) followed by autumn (4%) and no reported cases of infection in winter and spring. ELbader et al. (2014) investigated the sero-prevalence of Sarcocystis species in sheep in New-Valley Governorate, Egypt by using the enzyme linked immunosorbant assay (ELIZA). Serum samples were taken from 330 sheep slaughtered in 9 abattoirs. The prevalence rate was 65.15 % (215 / 330 samples). The highest rate appeared in EL-Dakla followed by EL-Farafra and EL-Kharga. The highest rate of infection was recorded in females. At the same time older ages more affected than younger ones. Microscopic examination revealed that a high incidence of infection 88%.

2.1. Incidence of Sarcocystis species in sheep all over the world: Gut (1982) examined 100 samples of esophagus of sheep by gross trichinoscopy and pepsin digestion in Czech Republic. S. tenella was recorded 10

Review of literature in 92% of examined sheep, while 37% of the samples were infected with S. gigantea. Morgan et al. (1984) mentioned that 2 out of 60 Clun Forest-cross gimmer two yearling lambs showing progressive weakness of the front legs were examined. The progressive weakness was associated with severe non suppurative meningoencephalitis. Many lesions morphologically resembling Sarcocystis schizonts were scattered throughout the brain stem. Also mature sarcocysts were observed in the brain of both sheep at the same time cysts were seen in large numbers in the muscles. So, there were a relationship between the the neuropathological findings and the heavy infestation of sarcocysts in the muscles. O'Donoghue and ford (1986) reported that, the incidence of S. gigantea and S. meduciformis was 6.7% and 93.2 % of macroscopic cysts detected after observation of 864 samples of heart, diaphragm and abdominal muscle in Australia. Pomroy and Charleston (1987) examined cardiac muscles of 51 lambs from Australia and New Zealand area using pepsin digestion technique. S. tenella and S. arieticanis were detected in 92.1 % of the examined samples. Imai et al. (1989) detected 4 of Sarcocystis in sheep in Japan (S. tenella, S. arieticanis, S. gigantean and S. medusiformis) in a field survey. The parasite was detected from 2 out of 18 (11.1%) sheep in Niigata prefecture and 14 out of 15 (93.3%) in Gunma prefecture while those sheep from Saitama prefecture were negative. The positive rates of parasitic cysts were 41.2% (14 / 34) in the heart, 26.9 % (7 / 26) in tongue, 17.1 % (6 /35) in esophagus and finally 25 % (7 / 28) in diaphragm.

11

Review of literature Svobodova and Nevole (1990) mentioned that the infection rate of Sarcocystis gigantea was 60.3% during examination of 1014 esophagus and diaphragm samples of sheep of different ages by trypsin digestion and gross trichinoscopy in Czech Republic country. Granstorm et al. (1993) recorded that, the incidence rate of S. tenella and S. arieticanis after taking blood, muscles and nervous tissues of 342 lambs in Czech Republic was 35.7% by grossly techniques while it was 94.4 % by using in Immuno-flurecent antibody technique test (IFAT). Savini et al. (1993) examined heart and diaphragm samples of 146 sheep in Western Australia. Histopathology and pepsin digestion technique were used of detection of sarcocystis. S. tenella and S. arieticanis were detected in 48.8%. Hinaidy and Egger (1994) reported that the prevalence of Sarcocystis tenella was 25.6 % and the prevalence of Sarcocystis arieticanis was 24% while prevalence of Sarcocystis gigantea was 2.4% during examination of 500 samples of sheep esophagus by using trypsin digestion and gross trichinoscopy in Australia. Woldemeskel and Gebreeab (1996) collected 208 samples of sheep esophagus, diaphragm, and heart muscles in northwest area of Ethiopia. The incidence rate of Sarcocystis tenella was 93.7 %. Fukuyo et al. (2002) conducted a survey of Sarcocystis infection in Magnolia by examination of muscle samples from the heart, diaphragm, tongue, esophagus, and intercostal region of sheep using muscle compression method. The incidence of infection was 96.9% (753/777). The tongue was the most affected organs in sheep (100%). Al-Hoot et al. (2005) investigated the occurance of natural Sarcocystis infection in sheep

in Riyadh, Saudi Arabia. The natural infection with 12

Review of literature sarcocysts in sheep was 76% in Najdy sheep, 84% in Niemy sheep, 89% in Sawakny sheep. The microscopic cysts were 79% and macroscopic cysts were 13.5%. Daryani et al. (2006) determined the prevalence of Sarcocystis species in slaughtered sheep in Ardabil, Iran. A total of 2110 sheep were investigated. The incidence of Sarcocystis species cysts in sheep were detected in 33.9% (716 / 2110) distributed as 31.3% in the abdominal wall, 22.4% in diaphragm, 6.6% in intercostal, 2% in arm, 1.5% in thigh, 0.75% in rectus or neck and 0.23% in esophagus. Females showed higher incidence than those of males (p0.05) between sensitivities of two technique of detection of Sarcocystis species (digestion and histology). These results concluded that the environment was heavily contaminated with

14

Review of literature sporocysts and subsequent infection of sheep begining from the young ages in Izmir province. Titilincu et al. (2008) investigated the prevalence, etiology and intensity of infection of Sarcocystis species in sheep slaughtered in two abattoirs in Romania. The incidence of intestinal sarcocystosis in dogs and cats naturally infected were also studied. The macroscopic cyst was observed in esophagus of 10/38 (26.32%) carcasses. Concerning the prevalence of microscopic cysts, the highest incidence was observed in esophagus (81.6%), followed by heart (79.9%) and diaphragm (68.8%). Highest number of microscopic cysts (162 cysts/gm muscle tissue) was detected in heart muscles. The microscopic cysts were identified as Sarcocystis tenella The incidence of intestinal sarcocystosis in naturally infected dogs and cats was 1.1% and 1.8%, respectively. Da Silvaa et al. (2009) reported two cases of natural infections of S. tenella in sheep from Brazil for the first time after examination of 602 samples (0.33 %) of sheep heart, diaphragm and brain. Examination of serum and molecular typing of these sheep samples also suggested co-infection of T. gondii. Kojouri et al. (2011) investgated 145 heart tissue muscles from slaughtered sheep carcasses from different abattoirs in Iran for detection of Sarcocystis species. Histopathological findings showed presence of microscopic cyst of Sarcocystis species with evidence of myocardial lesions in 27 out of 145. Nematollahi et al. (2011) determined the prevalence of Sarcocystis species infection in slaughtered sheep in the old slaughter house of Tabriz, north of Iran. Striated muscles such as masseters, esophagus, tongue, heart, diaphragm and ocular muscles of 80 sheep sampled were investigated. The muscle was observed carefully and sectioned 2 - 3 mm slices for presence macroscopic

15

Review of literature cysts. The sections were examined using impression smear and digestive methods. Twinty sex out of 80 sheep (32.5%) were infected with microscopic cysts. While 4 /80 (15.4%) were infected with macroscopic cysts. Hosseini et al. (2012) studied the incidence of Sarcocystis species in sheep carcasses in three slaughter houses in Iran. A total of 650 muscle tissue samples of 325 sheep divided to 4 different age groups were surveyed by the impression smear and digestion examination methods for detection of Sarcocystis species. Esophagus and diaphragm were examined for detection of macroscopic and microscopic cysts.. Macroscopic cysts incidence were 4.3% (14/325) of sheep. The highest prevalence was recorded in the diaphragm in all age groups. Microscopic cysts were present in 92% (299 / 325) of sheep. There was no significant difference (p>0.05) between sensitivities of digestion and impression smear in detection of Sarcocystis species. The high incidence of Sarcocystis species ensured the fact that the environment is heavily contaminated with infective sporocysts and the ingestion of sporocysts by sheep begins from the young ages in Iran. Martínez-Navalón et al. (2012) detected macroscopic cysts of Sarcocystis species in sheep in 145 farms in Spain. The prevalence was 12% in 345 examined sheep carcasses. Most of affected sheep had distributed cysts in more than one organ so, 79% of infected sheep carcasses were totally condemned. Three types of cysts were noticed according to shape, size and location namely; S. tenella, S. aerticanis and S. gigantea, while S. medusiformis had not been reported in Europe. Al Quraishy et al. (2014) investigated Sarcocystis species from 3 strains of slaughtered sheep carcasses at Al-Azizia and Al-Saada abattoirs in Riyadh city, Saudia Arabia. Tissue samples of the esophagus, tongue, diaphragm, skeletal and heart muscles were examined. The prevalence of natural infection of 16

Review of literature the examined sheep strains was 81.5 % in Najdy sheep, 83 % in Niemy sheep and 90 % in Sawakny sheep. Tissue samples of the diaphragm showed the highest incidence rate than other organs except Najdy sheep in which esophagus has the highest rate. Also, the heart showed the lowest infection rate (44 % Najdy sheep, 40 % Niemy sheep and 53 % Sawakny sheep). Microscopic cysts of Sarcocystis arieticanis were easily seen in sections of the heart muscles of the examined sheep. Farhang-Pajuh et al. (2014) determined incidence of Sarcocystis species infection in sheep. Samples from 638 sheep slaughtered at Urmia abattoir, Iran were randomly collected. The incidence of Sarcocystis species was 36.83% (235/638). Males showed lower incidence than females (males were 7.63%, 38/498) and (females were 35 % 49/140). Sheep over 4 years-old had the highest incidence than younger ages. There was no significant difference between incidence of macroscopic cysts and sex. Two types of macroscopic cysts were found; S. gigantea 27.90% (178/638) and S. medusiformis (8.93%, 57/638) in striated muscles. Mixed infection with both S. gigantea and S. medusiformis was also found in 11.13% (71/638) of infected sheep.

3. General morphological findings of the Sarcocystis species in sheep: Sarcocysts vary in size and shape depending on species and age. Some species are always microscopic, for example S. tenella and S. areticanis, whereas others are macroscopic, as S. gigantea, and S. medusiformis. Common shapes are filamentous, elongated, or globular. Shape and size of sarcocysts vary according to the type of host cell as long slender cells contain long, slender sarcocysts. Macroscopic sarcocysts are always in skeletal muscle or esophageal 17

Review of literature muscle (Dubey et al., 1989 a). The sarcocysts consist of a cyst wall that surrounds metrocyte or bradyzoite stages (Odening, 1998). The structure and thickness of the cyst wall vary among Sarcocystis species; this feature is taken as a primary mean of differentiating species. A connective tissue capsule, formed by the host, surrounds the cyst wall of 14 species as in S. gigantea (Odening, 1998). Ultra structural sarcocysts wall morphology is classified based upon the system imposed by Dubey et al. (1989 a); 24 specific types have been described in detail. Recently, an additional 13 types have been described (Dubey and Odening, 2001) bringing the total to 37. Size, shape and spacing of cyst wall villi, and the presence or absence of microtubules within the villi, constitute this system of classification depending upon sarcocysts wall, ground substance underlying it, and the septae are remnants of the merozoite (Mehlhorn and Heydron, 1978). The metrocytes and bradyzoites within the sarcocysts are formed from endodyogenic divisions of the merozoite nucleus. Few species lack septae in the sarcocysts wall, and the density of bradyzoites within the sarcocysts may vary according to species (Dubey and Odening, 2001). Mature sarcocysts may contain both metrocytes and bradyzoites, although bradyzoites predominate (Dubey et al., 1989 a). Bradyzoites are surrounded by 3 membranes, forming the pellicle, and have distinct anterior and posterior ends. The apical complex structure is located at the anterior end and composed of numerous micronemes and several rhoptries. Both appear by transmission electron microscopy (TEM) as dark structures. They are believed to secrete products that aid in cell penetration (Dubey et al., 1989 a). Numbers of rhoptries in each bradyzoite may differ among Sarcocystis species. Although bradyzoites and metrocytes contain the same typical cell organelles such as nucleus, endoplasmic reticulum, 18

Review of literature mitochondria, inclusion bodies, etc., metrocytes lack the distinctive apical complex, micronemes, and rhoptries found in bradyzoites (Dubey et al., 1989 a). Other stages of Sarcocystis species are useful in differentiation of species like sporocyst size (Cheadle et al., 2001); a typical sporocyst measures 12 µm X 10 µm. Mundy and Obendorf (1984 a) collected tongue, heart, esophagus and diaphragm as well as tissues from fore and hind limb from experimentally inoculated sheep with Sarcocystis gigantea. The immature sarcocysts were detected from 40 - 84 day post infection. The cyst wall measured 1.5 - 2 µm in thickness. Immature cysts contained metrocytes only, while mature cysts contained both metrocytes and merozoites and did not have a secondary cyst wall. A mature cyst measuring 350 µm in length, was found in a sheep killed at 81 day post infection. After that cysts increased in size up to 0.5 mm long and a secondary wall of cyst was present. Dubey et al., (1989 a) described the morphology of the various Sarcocystis life stages. Sporocysts were surrounded by two membranes; the inner composed of 4 fused plates, and contained 4 sporozoites and a residual body. Sporozoite morphology was very similar to that of bradyzoites. Once inside the intestinal epithelial cells of the intermediate host, sporozoites differentiated

into

schizonts;

unlike

sarcocysts

and

merozoites.

A

parasitophorous membrane did not surround sporozoites and schizonts within host cells. Schizonts changed morphologically as they mature and divided by endopolyogeny; the nucleus became multi-lobed, each lobe gave rise to 2 merozoites. Merozoites varied in size and shape but approximately reported to be 8 µm X 2.5 µm. Merozoites also had anterior and posterior ends and an apical complex, but did not contain rhoptries. Gametogony in the definitive host 19

Review of literature produced rounded macrogamonts, 10 - 20 µm in diameter, and elongated microgamonts, approximately 7 X 5 µm. Microgamonts become multinucleated, and eventually containing 3 to 11 slender, bi-flagellated, microgametes (4 X 0.5 µm). After fertilization, the zygote became differentiated into an oocyst, approximately 24 X 20 µm cysts containing two sporocysts. Sarcocystis gigantea cysts were filamentous, elongated, or globular in shape. Shape and size of sarcocysts varied according to the type of host cell, the long, slender sarcocysts were found in long, slender cells. Imai et al. (1989) reported 4 species of Sarcocystis in sheep in Japan; (S. tenella, S. arieticanis, S. gigantean and S. medusiformis) in a field survey. The cysts were long or elliptical in shape with thin cystic wall provided with many protrusions. One hundred and thirty cysts in addition to 200 bradyzoites obtained from digested muscles of heart, esophagus, tongue and diaphragm of sheep were measured. The isolated cysts from esophagus, tongue and diaphragm were 520.6 x 57.72 µm but those obtained from heart were 290.9 x 76.95 µm. The protrusions of cyst wall were 2.3 - 2.8 µm in length. The bradyzoites were crescent in shape measuring 12.36 x 4.34 µm. The nucleus was situated near the blunt end. Heckeroth and Tenter (1998) described the Sarcocystis tenella cysts to be about 700 µm in diameter with thick cystic wall (1-3µm in thickness), striated, with villar protrusions (3.5 x 0.5µm). Sarcocystis arieticanis cysts were about 900 µm in length with thin cystic wall (lesser than 1µm in thickness), provided with hairy like villar protrusions (5- 9 µm long). Sarcocystis gigantea cysts were about 10 mm in diameter with thin smooth cystic wall (lesser than 2µm in thickness), provided with secondary wall of connective tissue. Sarcocystis medusiformis cysts were about 8 mm in diameter and the cystic wall was thin (lesser than 2 µm in thickness), smooth, without secondary wall. 20

Review of literature Odening (1998): described the Sarcocystis gigantea that it had a cyst wall surrounding metrocyte or bradyzoite stages within it. The cystic wall was thin surrounded with a connective tissue capsule, formed by the host. Haziroglu et al. (2002) described microscopy the cysts of Sarcocystis arieticanis within cardiac muscle of infected sheep. The size of S. arieticanis, were 52.5 – 162.5 µm in length × 35 – 62.5 µm in width. The cyst wall was provided with different-shaped protrusions. Al-Hoot et al. (2005) described Sarcocystis gigantea as macroscopic cysts usually observed in the esophagus wall. The cysts were enclosed by a secondary cystic wall. The primary one had many cauliflower - like protrusions supported by many fibellar structures, while many dense, dark granules usually expanded into the cyst cavity. The cyst of the parasites had globular to spherical metrocytes at the peripherally while the banana-shaped bradyzoites occurring in the center. Mahran (2009) examined esophagus, diaphragm, heart and tongue in addition to intercostal muscles tissue samples collected from 555 sheep slaughtered at the abattoirs in Shalatin area, Red Sea Governorate for detection of macroscopic and microscopic sarcocysts. According to morphometric studies, one type of macroscopic ovoid cysts were detected having thin primary cystic walls which identified as Sarcocystis gigantean. While, Microscopic cysts were smooth thin walls, measuring 34.8 to 58 µ in length 1.6- 2.4 µ in the cyst wall thickness which identified as Sarcocystis tenella. Nematollahi et al. (2011) described of Sarcocystis species cysts in slaughtered sheep in the slaughterhouse of Tabriz, north of Iran. Striated muscles such as masseters, esophagus, tongue, heart, diaphragm and ocular muscles of 80 sheep sampled were taken. The muscle samples were examined

21

Review of literature for detection of cysts by the impression smear and digestive methods. The macroscopic cysts were white in colored oval in shape, measuring 1 - 3 mm in length with thin wall. Martínez-Navalón et al. (2012) detected macroscopic cysts in sheep in 145 farms in Spain. Two cysts was noticed; one of them was narrow, filamentshaped measured 2 - 10 mm, found in striated muscles only, while the other type was oval-shaped esophageal sarcocysts and more elongated cysts in striated muscles measured 2 - 20 × 2 - 6 mm. Narrow macroscopic cysts were named Sarcocystis gigantea while the wide ones named as Sarcocystis medusiformis. Al Quraishy et al. (2014) detected Sarcocystis species from three strains of the slaughtered sheep carcasses at Al-Azizia and Al-Saada abattoirs in Riyadh city, Saudia arabia. Tissue samples of the esophagus, tongue, diaphragm, skeletal and heart muscles were examined. Cysts were measuring 62.4 – 173.6 μm (average: 82.14 μm) in length and 38.5 – 64.4 μm (average: 42.66 μm) in width. Cysts were identified as Sarcocystis arieticanis. Ultrastructural examination of the cyst revealed that the cyst wall was thin described as (0.1 – 0.27 μm in thickness) with presence of irregular shaped crowded hairy-like projections underlined by a thin layer of ground substance. This layer consisted mainly from fine, dense homogenous granules surrounded by developing metrocytes and merozoites that usually contained nearly all the apical complex structures and occupying the cavity of the cyst. Several septa or hyphae derived from the ground substance divided the cyst into compartments or champers. The merozoites were banana-shaped measuring 12–16 μm in length with centrally or posteriorly located nuclei. Experimental infection of dogs and cats by feeding heavily infected sheep muscles revealed that the dog and cats were the only final hosts of the present Sarcocystis species.

22

Review of literature 4. Molecular characterization of Sarcocystis species: Although Sarcocystis species was firstly described more than one hundred years ago and despite the importance of these parasites in animal health and meat hygiene, very little information about their molecular features is known. In recent years, the evident of new molecular biological techniques has provided new diagnostic means for parasitic infections. PCR has recently been developed as a methods for the genetically differentiation of Sarcocystis organisms (Welsh, and McClelland, 1990; Williams, et al., 1990; Clark and Lanigan 1993; Williams, et al., 1993 and Hamidinejat et al., 2014). Sequencing is performed to DNA product obtained from PCR reaction for extra species differentiation of Sarcocystis because it is the more sensitive technique has been performed. Sarcocystis species classification and identification was carried out traditionally according to type of hosts affected and morphology of the cysts microscopically (Levine, 1986). The phylogenetic relationships within the genus Sarcocystis remained unknown because of difficulties in evaluation of the phenotypic characters. It is possible that molecular data might aid in solving these problems (Ellis et al., 1995). There have been little differences among the results of the molecular studies for example; several molecular analysts have reported the monophylogeny of Sarcocystis (Tenter et al., 1992 a; Ellis et al., 1994 and Barta et al., 2001), while others do not say that (Ellis and Morrison, 1995). The phylogenetic analysis of the four species of sarcocysts (Sarcocystis tenella,

Sarcocystis

arieticanis,

Sarcocystis

gigantea

and

Sarcocystis

medusiformis) infecting sheep was tried to be studied, depending on complete ssu rDNA sequences (Ellis et al., 1995).

23

Review of literature 4.1. Molecular characterization of Sarcocystis species in sheep in Egypt: Unfortunately, there was no review about molecular characterization of Sarcocystis species in sheep in Egypt therefore; the present work was the first one that removes the mystery in molecular studies in sheep in Egypt.

4.2. Molecular characterization of Sarcocystis species in sheep all over the world: Atkinson and Collins (1981) designed a thin layer starch gel electrophoresis to differentiate 3 species of Sarcocystis taken from sheep in New Zealand including Sarcocystis tenella, S. gigantea and S. medusiformis using

3

enzymes,

NADP

dependent

glutamate

dehydrogenase,

phosphoglucomutase (PGM) and 6-phosphogluconate dehydrogenase (6PGD). Observation of enzyme banding patterns for the three species was performed. The results showed that each sample had a distinct banding pattern for each enzyme tested. Tenter et al., (1992 b) performed partial sequencing of 6 samples of sarcocysts at the small subunit ribosomal RNA which gave by reverse transcription of total cellular RNA. Six samples of Sarcocystis species did not cluster together in phylogenetic tree; two monophyletic groups were noticed; the first one containing two examined samples of Sarcocystis species with reference of felids as final hosts, while another one containing other four examined samples of Sarcocystis species with reference of canids as final hosts. The analysis of nucleotide divergence suggested that there were difference between the two groups of Sarcocystis species.

24

Review of literature Paikari et al. (2008) collected 60 muscle specimens from the heart, diaphragm and esophagus muscles of sheep carcasses slaughtered in Qazvin slaughterhouse in Iran. Fourty specimens contained macroscopic Sarcocystis species cysts and the other 20 specimens contained microscopic Sarcocystis species cysts.. DNA extraction was carried out using a commercial kits and PCR were optimized for 18S rRNA gen amplification. A comparative study was performed to investigate the specific primers of the Sarcocystis species according to the position of restriction sites of bands and also restricted enzymes were selected. PCR results indicated that the primers were completely specific for detecting Sarcocystis species. RFLP-PCR analysis showed that macroscopic cysts belonged to Sarcocystis gigantea while the microscopic cysts belonged to Sarcocystis arieticanis. The results concluded that Sarcocystis species of sheep cauld be classified through PCR-RFLP technique using the designed specific oligonucleotides (primers). In this technique application of Taq-I enzyme for microscopic cysts as well as Taq-I and Hinc-II enzymes for macroscopic cysts were that found more efficient than the other enzymes. Da Silva et al. (2009) examined 602 sheep carcasses slautghered in different abatoirs in Brazil to determine Toxoplasma gondii and Sarcocystis species infection. Twenty two of these sheep were positive for Sarcocystis species using RFLP-PCR genotyping. RFLP-PCR of 18S ribosomal RNA (18S rRNA) was carried out in all 22 animals to check the possibility of co-infection of T. gondii with other Apicomplexa parasites, such as S. tenella. The results reaveled that all 22 samples were positive for T. gondii and S. species. The 18S rRNA PCR products (310 bp) were sequenced and blasted to GenBank database. Samples were identical to S. tenella 18S rRNA gene (accession number L243831). These results suggested the presence of co-infection of S. tenella with T. gondii in sheep from Brazil.

25

Review of literature Gjerde (2013) performed molecular identification and phylogeny of Sarcocystis species based mainly on the nuclear ssrRNA gene. This gene was well suited for differentiation between different species but less sensitive for closely related species. The objective of his work was established using mitochondrial cytochrome oxidase subunit gene (cox1) as a new genetic marker for Sarcocystis species. The sequence (KC209733) obtained from S. gigantea cyst isolated from the esophagus of a sheep showed 98.9% and 98.8% identity with sequences of S. gigantea (L24384) in gen bank. A comparison of these sequences when aligned against each other approved that most of these differences were due to sequencing errors (missing nucleotides) in the sequences in gen bank. Four sequences obtained from four samples of microscopic sarcocysts isolated from different sheep were identical (KC209734–KC209736) and differed only in a single nucleotide position (different haplotype) from the fourth sequence (KC209737). BLAST revealed that sequence was similar to S. tenella (L24383) in gen bank with 96.4% identity. Shahbazi et al. (2013) examined heart and diaphragm muscle samples of 60 sheep collected from Tabriz abattoir, Iran for detection of Sarcocystis species. Microscopic cysts observed using direct tissue impression smears. DNA extraction was performed using a commercial kit. PCR amplification optimized for 18S rRNA gen according to the position of specific sites and restricted enzymes TAG1 selected. Microscopic cysts prevalence was 40 % of impression smears and 100% of tissue digestions. RFLP-PCR analysis cleared that microscopic cysts were Sarcocystis arieticanis and Sarcocystis tenella. These results concluded that Sarcocystis species cauld be recognized through PCRRFLP technique using TAG1 enzyme and the designed specific primers. Bahari, et al. (2014) performed a study for molecular identification of the macroscopic and microscopic cysts of Sarcocystis species in slaughtered sheep 26

Review of literature using a digestion method for muscular tissues obtained from heart and diaphragm. PCR analysis was performed on macroscopic and microscopic cysts and all species of cyst band found in 600 bp. Sequencing was conducting for ten PCR samples. Genotypes were analyzed by BLAST search. Digestion method and PCR analysis indicated positive results in all samples taken from heart, diaphragm and liver. Microscopic cysts are more prevalent than macroscopic ones. Genotyping of ten tissue samples proved that two genotype of macroscopic cysts belonged to Sarcocystis gigantea and they similar to accession number (KF489421 and KF489425 ) in gen bank while eight genotype of microscopic cysts to Sarcocystis tenella was similar to (KF489419, KF489427, KF489418, KF489422, KF489428, KF489429, KF489420 and KF489424) in gen bank. Farhang-Pajuh et al. (2014) determined the incidence of Sarcocystis species infection in sheep with and molecular description of Sarcocystis gigantea and Sarcocystis medusiformis. Samples from 638 sheep slaughtered at Urmia abattoir in Romania were randomly collected for Genomic DNA extraction and polymerase chain reaction was carried out to amplify a 964 bp fragment of nuclear 18S rRNA gene. The PCR products were digested with endonuclease Mbo-II and Mva-I for discrbtion of S. medusiformis and S. gigantea genatically. The RFLP-PCR patterns said that fat sarcocysts were S. gigantea 29.31% (187/638) and thin sarcocysts were S. medusiformis 7.52% (48/638). Baccia et al. (2016) studied the incidence of performed a study to determine prevalence of Sarcocystis species using PCR. Tissue samples were taken from Cornigliese sheep breed in northern Italy. The results showed that 24 / 24 sheep (100%) were positive by PCR for Sarcocystis species. Sarcocystis species cysts were visible in all animals’ tissues. Sequencing of PCR products

27

Review of literature showed the presence of Sarcocystis tenella only. So, S. tenella were present in a high percentage of Cornigliese sheep in northern Italy. Moré, et al. (2016) examined 50 small intestines from foxes and 38 from raccoon dogs in the Federal State of Brandenburg, Germany for detection of Sarcocystis species infection. Mucosal scrapings were collected and examined using sugar flotation technique, sedimentation occurred for 12 hrs and DNA extracted with extracting kit. A PCR was applied using primers targeting a part of the 18S rRNA gene (with a size about 850 bp) then purification and sequencing were performed to the genome. Sarcocystis species oocysts or sporocysts were detected in 38% (19/50) of fox and 52.6% (20/38) of raccoon dog samples. Sequencing data of genome obtained from oocyst, DNA revealed mixed infections in 9 fox and 5 raccoon samples. In the fox samples, the most identified Sarcocystis species were S. tenella (10.0%). Diagnosis of Sarcocystis infection using mucosal scrapings was better than faecal examinations. The methodology of 18S rRNA gene amplification and sequencing was useful to identify mixed infections with Sarcocystis species.

28

Material and methods

Material and methods 1. Study area and animals: A total number of 540 slaughtered sheep (ovis aries) collected from Mansoura abattoir in Dakahlia Province, Damietta abattoir

in Damietta

Province and also Elbasatine abattoir in Cairo, were examined during the period between July 2014 and June 2015. The samples of 540 esophagi, 50 diaphragms and 10 abdominal muscles were collected. Regular weekly visits were carried out to these abattoirs. The examined animals were divided into 2 groups according to their age, the first one was less than 2 years old (140 animals) and the second was over 2 years of age (400 animals). The age of the examined animals was assessed through the visual inspection of teeth. Both males and females were investigated for the presence of Sarcocystis species cysts.

2. Collection of specimens: In the present investigation, samples were collected from esophagus, diaphragm and abdominal muscle. Then, in an ice box, samples were transported to the laboratory of Parasitology Department, Faculty of Veterinary Medicine, Mansoura University for examination. Muscle samples concerning tissues and numbers of examined sheep were summarized in Table (1).

92

2y

All age 130 131 146 133 540

No. of Sheep

35 34 37 34 140

2y

2y

35 34 37 34 140

All age 130 131 146 133 540

0 0 1 0 1

2y


All age 3 1 3 3 10

144 145 164 147 600

No Of Examined Samples

Table (1) Seasonal examination of muscle samples concerning tissues and age of examined sheep.

Seasons

Winter Spring Summer Autumn Total

03

Material and methods 3. Examination of the collected samples: 3.1. Detection of macroscopic cysts. Macroscopic sarcocysts in the collected samples were detected by naked eyes in both abattoir and the Parasitological Lab. However, visual inspection was not always sufficiently sensitive in case of low infection density or cysts that did not reach to its full size. So, several cuts were performed to see sarcocysts impeded inside the muscular tissue. The dimensions of the macroscopic sarcocysts were measured using a ruler, then put in Hanks balanced salt solution (HBSS) at pH 7.4 preferably at 5 to 10 ºC for genetic studies (according to Dubey et al. 2015).

3.2. Detection of microscopic cysts. 3.2.1. Muscle squash technique: (according to Gut, 1982) Small pieces of meat specimens (sized pin head) were cut off and compressed between two glass slides and examined under the microscope at X10 magnification. Positive samples were marked and other specimens were taken in formalin buffer solution and sent to Pathology Department, Faculty of Medicine, Mansoura University, for histopathological examination. The rest of the positive samples were subjected for digestion technique to harvest Sarcocystis species bradyzoite for genetic expression studies (Abbas, 2011 and Alkappany, 2011). In this study, a stained compressed samples technique is proposed for better inspection of microscopic cyst. Small pieces of meat were taken, crushed and put in Petri dish containing methyl alcohol for 1 min then transfer it into Petri dish containing Giemsa stain for 5 min and finally washed by water then examined under microscope at X10 and X40 magnification. The microscopic 03

Material and methods cysts were easily visualized using this technique which appeared to be more clear than unstained ones.

3.2.2. Isolation, purification and preservation of bradyzoites: Bradyzoites were released from sarcocysts by incubation of the cysts in digestive fluid (acid pepsin), where the wall was dissolved by digestive fluid, but the released bradyzoites could survive in it according to Jacobs et al. (1960). The following methods were useful for obtaining Sarcocystis bradyzoites according to Farooqui et al., 1987 and Miller, 1993. a. Heavily infested tissues were selected by microscopic examination. b. Connective tissues and fat were removed as possible and muscles were grind into small pieces. c. About 50 g of ground meat was suspended in 100 ml of warm (37ºC) freshly prepared digestion fluid (5.2 g pepsin, 10 g NaCl, 14 ml HCl and distilled water to make 1000 ml, pH 1.1 – 1.2. Pepsin was dissolved in water and centrifugation was carried out). Bradyzoites were released from broken cysts during grinding at 37ºC on magnetic stirrer for 10- 60 min. d. The homogenate was pourd through cheesecloth to remove large particles followed by centrifugation at 400 r.p.m for 5 – 10 min. e. The supernatant fluid was discarded and the sediment was suspended in Hanks balanced salt solution (HBSS) at pH 7.4 preferably at 5 - 10 ºC. f. Recentrifugation at 400 r.p.m for 5 – 10 min was performed, the supernatant fluid was discarded and the whitish bradyzoites layer were collected in the bottom. 09

Material and methods g. A drop from the sediment was spread on a slide, fixed by methyl alcohol and stained with Giemsa stain for detection of bradyzoites. h. The rest of bradyzoites was added to 5- 10 ml saline containing 1000 I.U. of penicillin and 100 mg of streptomycin for arrest or prevent bacterial contamination and sent to Biotechnology unit - Reference lab for veterinary quality control on poultry production - Animal health research institute, Dokki, Giza, Egypt for PCR and sequencing studies. Formulation of digestion fluid.  5.2 g Pepsin .  10 g Sodium chloride.  14 ml Hydrochloric acid.  Distilled water was added up to 1000 ml and, was adjusted pH 1.1 – 1.2. Hanks’ Balanced Salt Solution (HBSS) Reagents:  1000 ml distilled water.  400 mg Potassium chloride.  60 mg Potassium phosphate, monobasic.  350 mg Sodium bicarbonate.  8 g Sodium chloride.  48 mg Sodium phosphate, dibasic, anhydrous.  1 g D-Glucose.  10 mg Phenol red. 00


Method: 1) All solids were dissolved in distilled water. 2) The solution was filtered by sterile filter into severall sterile 500 ml bottles.

3.3. Histopathological examination: Histopathological examination was performed to positive samples to examine the presence of microscopic cysts and macroscopic ones, which may be at early stage of development (Collins et al., 1980). Samples were cut into 0.5 cm³ pieces, fixed in buffered formalin 10 %, sectioned at 5 microns, stained with hemaotoxylin and eosin stain and examined by light microscopy, according to Bancroft and Stevens, (1996). Fine details of the cyst wall could not be studied due to the low magnification power of the light microscope and therefore, genetic studies on sarcocysts were performed (Dubey et al., 1989 a). Formation of neutral buffered formalin 10 %:  4.5 grams

monobasic sodium phosphate

 6.5 grams

dibasic sodium phosphate

 100 ml

formaldehyde

 900 ml

distilled water

03


4. DNA extraction and PCR amplification. 4. 1. Equipment of DNA extraction and PCR amplification. 4.1.1. QIAamp DNA Mini Kit

Catalogue no.51304

The QIAamp (Qiagen amplification) DNA Mini Kit provides silicamembrane-based nucleic acid purification from bradyzoites of

Sarcocystis

species samples. The spin-column procedure does not need mechanical homogenization, so total preparation time is only 20 minutes.

4.1.2. Equipment and instruments used for extraction of nucleic acids. 1. 1.5 ml capacity epindorff tubes. 2. 0.2 ml capacity PCR tubes. 3. 10-100 µl and 100-1000 µl monochannel micropipettes (Biohit). 4. 100 µl and 1000 µl capacity sterile filter tips. 5. Centrifuge (Sigma sartorius). 6. Freezer (-20˚C) (Toshiba). 7. 1300 Series Class II, Type A2 Biological Safety (Thermo Scientific). 8. Thermoblock (Biometra).

4.1.3. PCR Master Mix used for PCR. Emerald Amp GT PCR mastermix Code No. RR310A (Takara) Contains: a) Emerald Amp GT PCR mastermix (2x premix). b) PCR grade water. 03

Material and methods 4.1.4. Oligonucleotide primers used in PCR. Table (2): Oligonucleotide primers sequences used in PCR. Source:

Midland Certified Reagent Company_ oilgos (USA).

Gene 18S rRNA

Primer Sequence 5'-3' GCACTTGATGAATTCTGGCA CACCACCCATAGAATCAAG

Amplified product 600 bp

Reference Bahari et al., 2014

4.1.5. DNA ladder (Molecular weight marker): 1. Gel Pilot 100 bp ladder

(cat. no. 239035) obtained from QIAGEN (USA).

Size range: 100-600 bp.

4.1.6. Material used for agarose gel electrophoresis 4.1.6.1. Agarose 1.5% (Sambrook et al., 1989). High gel strength, multi-purpose agarose suitable for a wide range of molecular biology techniques from conventional constant field to Pulsed Field Gel Electrophoresis (PFGE). Agarose could effectively separate large DNA fragments with decrease running times due to agarose has high gel strength and exclusion limits. This means less band diffusion, that a problem often associated with long running times. It was prepared as follow: a) b)

Agarose powder (ABgene) TBE (Tris borate EDTA)

1.5 g 100 ml

4.1.6.2. Ethedium bromide solution 10 mg / ml (Sambrook et al., 1989) a) Ethedium bromide powder (Sigma) 10 mg b) Sterile DDW (Double-distilled water) 1.0 ml It was mixed and then stored covered at 4˚C. It was added to melted agarose to reach a final concentration of 0.1 - 0.5 μg/ml. 03

Material and methods 4.1.6.3. Tris borate EDTA (TBE) electrophoresis buffer (WHO, 2002) a) b) c)

Tris buffer (Fluka) Boric acid (Fluka) EDTA DINA salt (Winlab)

10.78 g 5.5 g 0.82 g

It was added up to 1 liter with deionized water, pH was checked up (range from 8 to 8.6). Changing in ion concentration would affect the movement of the DNA through the gel.

4.1.7. Equipment and instruments used in PCR and electrophoresis: 1. 0.2 ml capacity PCR tubes. 2. T3 Thermal cycler (Biometra). 3. Gel tank (Biometra). 4. Microwave (Panasonic). 5. 2 to 20 µl monochannel micropipette (Biohit). 6. Sterile filter tips. 7. Gel casting apparatus (Biometra). 8. Power supply (Biometra). 9. 1300 Series Class II, Type A2 Biological Safety (Thermo Scientific). 10. Gel documentation system (Alpha Innotech) 11. Deionizer (Millipore). 12. Double distillator (Sanyo).

03


4.2. Methods of DNA extraction and PCR amplification. 4.2.1. Extraction of Sarcocystis species DNA. (Methods performed according to QIAamp DNA mini kit guidelines and Tasara, et al., 2005) 1- One hundred and eighty μl of ATL (animal tissue lysis) buffer was added to 25 mg of the sample (to destroy nuclease activity without hurting the Proteinase K (PK) too much, and helping PK digest proteins) and also 20 μl QIAGEN protease was added into the bottom of a 1.5 ml micro-centrifuge tube then incubation at 56˚C till lysis were occurred. 2- Two hundred μl buffer AL were added to the sample, mixed for 15 seconds. After that the mixture was incubated at 72˚C for 10 min. 3- The micro-centrifuge tube (1.5 ml) was centrifuged to remove drops from the inside of the lid. 4- Two hundred μl ethanol (96%) were added to the sample, and mixed again for 15 seconds. After mixing, the 1.5 ml micro-centrifuge tube was briefly centrifuged to remove drops from the inside of the lid. 5- The mixture was carefully applied to the QIAamp minis pin column (in a 2 ml collecting tube) without wetting the rim. The closed cap was centrifuged at 8000 rpm for 1 min. The QIAamp mini spin column was placed in a clean 2 ml collection tube, and the tube containing the filtrate was discarded. 6- The QIAamp mini spin column was carefully opened and 500 ml buffer AW1 was added without wetting the rim. The closed cap was centrifuged at 8000 rpm for 1 min. The QIAamp mini spin column was placed in 2 ml tube, and the tube containing the filtrate was discarded.

03

Material and methods 7- The QIAamp mini spin column was carefully opened and 500 ml buffer AW2 was added without wetting the rim. The closed cap was centrifuged at full speed for 3 min. 8- The QIAamp mini spin column was placed in a new 2 ml tube and the old tube was discarded with the filtrate. Centrifugation at full speed for 1 min was done. 9- The QIAamp mini spin column was placed in a 1.5 ml micro-centrifuge tube, and the tube containing the filtrate was discarded. The QIAamp mini spin column was carefully opened and 100 μl buffer AE were added. The QIAamp mini spin column was incubated at room temperature (15 - 25˚C) for 1 min, and then centrifugated at 8000 rpm for 1 min. 4.2.2. Preparation of PCR Master Mix The preparations were performed depending on Emerald Amp GT PCR master mix instructions (Takara) Code No. RR310A kit as shown in table (3): Table (3) Composition of PCR Mixure. 12.5 μl

Emerald Amp GT PCR mastermix (2x premix) PCR grade water Forward primer (20 pmol) Reverse primer (20 pmol) Template DNA Total volume

4.5 μl 1 μl 1 μl 6 μl 25 μl

4.2.3. Cycling conditions of PCR PCR cycling condition were shown in Table (4) according to Bahari et al., 2014 and Emerald Amp GT PCR mastermix kit guidelines (Takara).

02

Material and methods Table (4): Cycling conditions of PCR. Initial denaturation Annealing Extension Final denaturation extension 94˚C 94˚C 55˚C 72˚C 72˚C 5 min. 45 sec. 1 min. 1 min. 10 min. Number of 1 35 1 cycles

4.2.4.

DNA Molecular weight marker

Ten μl of the required ladder were mixed gently by pipetting up and down then directly loaded.

4.2.5. Agarose gel electrophoreses

(Sambrook et al., 1989) with

modification: One and half % electrophoresis grade agarose was prepared by dissolving 1.5 g agarose in 100 ml TBE buffer in a sterile flask heated in microwave to dissolve all granules with agitation, and allowed to cool at 70˚C, then 0.5μg / ml ethedium bromide was added and mixed thoroughly. The warm agarose was poured directly in gel casting apparatus with desired comb in aposition and left at room temperature for polymerization. The comb was then removed, and the electrophoresis tank was filled with TBE buffer. Twinty μl of each PCR product samples, positive and negative controls were loaded to the gel. After about 30 min of 1- 5 volts / cm power supply, the run was stopped and the gel was transferred to UV transilluminator.

33

Material and methods 4.3. Materials used for PCR product purification and sequencing: 4.3.1. QIAquick PCR Product extraction kit. (Qiagen Inc. Valencia CA): It was used for purification of the PCR product directly. 4.3.2. Bigdye Terminator V3.1 cycle sequencing kit. (Perkin-Elmer, Foster city, CA) cat-number 4336817: It was used for performing gene sequencing using Applied Biosystems 3130 genetic analyzer (Hitachi, Japan). 4.3.3. Kit used for purification of the sequence reaction Centrisep (spin column): cat number CS-901 of 100 reactions.

4.3.4. Applied Biosystems 3130 automated DNA Sequencer (ABI, 3130, USA).

4.4. Methods for purification of the PCR Products: QIAquik PCR product purification protocol, Using QIA quick PCR Product extraction kit. (Qiagen Inc. Valencia CA) as a following: 1) 5 volumes of buffer BP1 were added to 1 volume of the PCR sample then mixed. 2) The yellow color of the mixture was checked (similar to Buffer BP1 without the PCR sample). 3) A QIA quick spin column was placed in a provided 2 ml tube. 4) To bind DNA, the sample was applied to the QIA quick column, and centrifuged for 1 min at 8000 rpm.

33

Material and methods 5) Centrifugate was discarded and QIA quick column was placed back in the same tube. 6) 750 ul of buffer PE were added to QIA quick column for washing, and centrifuged for 1 min at 8000 rpm. 7) Centrifugation was discarded and QIA quick column was placed back in the same tube. 8) Centrifugation for additional 1 min was occurred at 8000 rpm. 9) Into a clean 1.5 ml micro centrifuge tube QIA quick column was placed. 10) For eluting DNA, 30 µl of Buffer EB (10ml Tris.CL PH 8.5) were added to the center of the QIA quick membrane for 5 minutes then centrifugation for 1 min at 12000 rpm was performed.

4.5. Sequencing reaction: On an Applied Biosystems 3130 automated DNA Sequencer a purified RT-PCR product was sequenced in the forward and reverse directions (ABI, 3130, USA). Using a ready reaction Bigdye Terminator V3.1 cycle sequencing kit. (Perkin-Elmer/Applied Biosystems, Foster City, CA), with Cat. No. 4336817. Table (5): Preparation of master mix using Bigdye Terminator V3.1 cycle sequencing kit. Big dye terminator v.3.1 Primer Template of DNA Deionized water Total volume

2µl 1µl From 1 to 10 µl Up to 20µl 20µl (Mix well)

39

Material and methods 4.5.1. Purification of the sequence reaction:

Using (spin

column): Cat. No. CS-901 of 100 reactions according to the guidelines of the manufacture as following: COLUMN HYDRATION 1- The column was taped to insure that the dry gel has settled in the bottom of the spin column. 2- The top column cap was removed and the column was reconstituted by adding 0.80 ml of reagent grade water or buffer. 3- It was allowed at least 30 minutes at room temperature. REMOVEL OF INTERSTITAL FLUID 4- Inverting the column and sharply tapping the column to remove air bubbles were from the column gel. 5- The top column cap and the column end stopper was removed from the bottom after the gel has settled and is free of bubbles. 6- Excess column fluid was allowed to drain into a wash tube(2ml) by gravity, and then the fluid was discarded. 7- The column and wash tube were centrifuge at 2500rpm for 2 minutes to remove interstitial fluid. 8- The wash tube and the interstitial fluid were discarded. The gel material was not allowed to dry excessively. SAMPLE PROCESSING 9- Twenty µl of completed Dye DeoxyTm terminator reaction mixture (sample) were transferred to the top of the gel. Onto the center of GEL BED at the top of

30

Material and methods the column the sample was carefully dispensed directly, without disturbing the gel surface. 10- The column was placed into 1.5 ml sample tube, the column and collection tube were centrifuged at 2500 rpm for 2 minutes, the supernatant was discarded and the purified sample which collected in the bottom of the sample tube was taken.

4.5.2. Loading the sequencer machine: 1. The purified sample was taken and 10µl Hi-Di formamide were added and mixed well then loaded in the plate well then placed into thermal cycler at 95˚ C for 3 minutes for denaturation then into ice flakes especially into well containing samples (preventing re-annealing). 2. The loaded plate was placed in the sequencer (Applied Biosystems 3130 genetic analyzer, USA), the machine was adjusted and run. A BLAST® analysis (Basic Local Alignment Search Tool) (Altschul et al., 1990) was performed to establish sequence identity to Gen Bank accessions.

4.5.3. Phylogenetic analysis: A comparative analysis of sequences was performed using the Clustal W multiple sequence alignment program, version 1.83 of Meg Align module of Lasergene DNA Star software Pairwise, which was designed by Thompson et al., (1994). Sequence alignments and phylogenetic comparisons of the aligned sequences for the gene were also performed to determine nucleotide and amino acid sequence similarities and relationships.

33

Results

Results I. Prevalence and seasonal dynamics of Sarcocystis species infections among slaughtered sheep: During the period extended from July 2014 to June 2015, five hundred and forty slaughtered sheep were examined in three municipal abattoirs including: Mansoura abattoir in Dakahlia Province, Damietta abattoir in Damietta Province and also Elbasatine abattoir in Cairo, for detection of Sarcocystis species cysts. Examined animals were divided into 2 groups according to their ages; the first animals group were less than 2 years old (n = 140) and the second were over 2 years of age (n = 400). Samples were collected from esophagus, diaphragm and abdominal muscles.

1. Incidence and tissue distribution of sarcocystosis: The results showed that the overall incidence of Sarcocystis species cysts was 95.37%, where 515 sheep were found infected out of 540 examined sheep. Microscopic cysts were revealed at higher rate (95.37%) than macroscopic cysts (0.74%), as all infected sheep were infected with microscopic cysts, while mixed infection with both microscopic and macroscopic cysts was detected in 0.74%, where 4 sheep are found infected out of 540 examined, Table (6). Concerning tissue distribution of recovered cysts, esophageal samples are found infected (95.37%), followed by diaphragm (66%) then, abdominal muscles (20%), Table (6). Moreover, macroscopic cysts were detected only in esophageal muscles of over 2 years aged group (1%), while absent in other tissue samples, Table (7).

45

Results 2. Prevalence of the revealed Sarcocystis species among different age groups of examined sheep carcasses: Generally, higher infection rate was recorded in sheep over 2 years old (98.5%) than that of sheep less than 2 years old (86.43%). Macroscopic cysts were detected only in sheep aged more than 2 years (1%), while completely absent among age group of less than 2 years (0%), Table (7). Concerning the distribution of microscopic cysts, esophageal and diaphragmatic muscles of sheep aged over 2 years had the highest prevalence rate (98.5% and 67.5 %, respectively) while, the lowest prevalence was detected in sheep less than 2 years (86.43% and 60%, respectively). Regarding the infection with microscopic cysts in abdominal muscle, sheep aged over 2 years were the only infected group (22.23 %), Table (8).

3. Several tissues infected with Sarcocystis species in the same sheep. Regarding the several infection in several tissue samples in the same slaughtered sheep, the results revealed that infection of both diaphragm and esophagus was 6.11% and infection of esophagus, diaphragm and abdominal muscles was 0.37%, where 33 and 2 sheep were found to be infected out of 540 examined, respectively, Table (9).

4. Seasonal dynamics of the revealed Sarcocystis species: The prevalence of sarcocystosis among examined sheep was detected at its highest rate during summer season (96.95%), followed by Spring (93.10%), Autumn (91.16%) while the lowest infection was recorded in Winter (84.72%), Table (10).

46

Results Macroscopic cysts were revealed at higher rate during summer season (1.83 %), followed by Spring (1.03 %), Autumn (1.01%) and being completely absent in Winter in old age group, Table (11). Regarding the seasonal dynamics of microscopic cysts in esophageal tissue samples, sheep aged less than 2 years had the highest prevalence during summer (97.3 %) and spring (94.12%), followed by Autumn (85.29 %) and winter (68.57%), similarly sheep aged over 2 years had the highest prevalence during Summer (99.08 %) and Spring (98.97%), followed by Autumn (97.98 %) and Winter (97.89 %), Table (12). With respect to seasonal prevalence of microscopic cysts in diaphragm tissue samples, microscopic cysts in sheep less than 2 years reached its highest prevalence in Summer and Autumn (100% for each), while lower infection rate are detected during Winter and Spring seasons (33.34 % for each). On the other hand, microscopic cysts in sheep over 2 years reached highest rate of infection in Summer (91.67 %), followed by Spring and Autumn (60 % for each) and the lowest was in Winter (50 %), Table (13). With reference to seasonal fluctuation of microscopic cysts in abdominal muscle samples, sheep aged less than 2 years had no infection in all seasons (0 %), while sheep over 2 years had the highest prevalence rate in summer (50 %), followed by Autumn (33.34%), while no recorded infection during Spring and Winter (0 % for each), Table (14). Concerning the seasonal prevalence of mixed infection with macroscopic and microscopic cysts in esophageal samples, no mixed infection is recorded during all seasons in sheep less than 2 years, while in sheep over 2 years, Summer had the highest rate (1.83 %), followed by Spring (1.03 %), then autumn (1.01 %), while no mixed infection was detected during Winter, (Table 15).

47

Results Infection of esophagus, diaphragm and abdominal muscles in the same sheep is detected only in sheep over 2 years, where the highest rate was recorded in Autumn (1.01 %), followed by Summer (0.92 %) but not recorded in Spring and Winter (0 %), (Table 16). Regarding the seasonal prevalence of sheep had Infection in esophagus and diaphragm, in sheep less than 2 years, the highest rate was recorded in Summer (8.11 %), followed by Autumn and Spring (2.94 % for each) then, Winter (2.86 %); while in sheep over 2 years, the highest rate was in Summer (10.09 %) and Spring (6.19 %), followed by Autumn (6.06 %) and Winter (4.21 %), (Table 16).

5. Prevalence of Sarcocystis species in relation to sex of examined sheep: Concerning the influence of sex on infection rate, the results revealed that females were highly infected (99 %) than males (94.55%), where 99/100 and 416/440 sheep were found, respectively, (Table 17).

48

Organs examined Esophagus Diaphragm Abdominal muscles Total

2y No. inf. 394

Table (8): Prevalence of microscopic cysts in different muscle samples according to age.

Sheep less than 2 years No of No. of % of examined infected infection in esophagus esophagus esophagus 140 0 0

No. exam. 140

49

No. exam. 130 131 146 133 540

117 128 144 126 515

Esophagus No. inf.

90 97.71 98.63 94.74 95.37

%

No. exam. 11 13 15 11 50

5 7 14 7 33

Diaphragm No. inf.

45.45 53.85 93.34 63.64 66

%

Abdominal muscles No. No. inf. % exam. 3 0 0 1 0 0 3 1 33.34 3 1 33.34 10 2 20

Table (10): Seasonal prevalence of microscopic cysts in different tissues.

Infections in several tissue samples of the same slaughtered sheep Infection in esophagus, diaphragm & abdominal Infection in its esophagus & diaphragm. muscles No. of mixed infection % No. of mixed infection % 2 0.37 33 6.11

Table (9): The incidence of Infection in several tissues of the same slaughtered sheep.

Total No. of sheep examined 540

Seasons


50

Results

Results Table (11): Seasonal prevalence of macroscopic cysts in esophagus muscles according to age. Esophagus Seasons


Sheep less than 2 years No. of No. of % of examined infected infection esophagus esophagus in esophagus 35 0 0 34 0 0 37 0 0 34 0 0 140 0 0

Sheep more than 2years No of No. of % of examined infected infection esophagus esophagus in esophagus 95 0 0 97 1 1.03 109 2 1.83 99 1 1.01 400 4 1

Table (12): Seasonal prevalence of microscopic cysts in esophagus muscle samples according to age. Esophagus Seasons


Sheep less than 2 years No of No. of % of examined infected infection esophagus esophagus in esophagus 35 24 68.57 34 32 94.12 37 36 97.3 34 29 85.29 140 121 86.43

Sheep more than 2years No of No. of % of examined infected infection esophagus esophagus in esophagus 95 93 97.89 97 96 98.97 109 108 99.08 99 97 97.98 400 394 98.5

Table (13): Seasonal prevalence of microscopic cysts in diaphragm muscle samples according to age. Diaphragm Seasons


Sheep less than 2 years Sheep more than 2years No of No. of % of No of No. of % of examined infected infection examined infected infection diaphragm diaphragm in diaphragm diaphragm in diaphragm diaphragm 3 1 33.34 8 4 50 3 1 33.34 10 6 60 3 3 100 12 11 91.67 1 1 100 10 6 60 10 6 60 40 27 67.5

51

Results Table (14): Seasonal prevalence of microscopic cysts in abdominal muscles muscle samples according to age. Seasons


Abdominal muscles Sheep less than 2 years Sheep more than 2years No of No. of % of No of No. of % of examined infected infection examined infected infection abdominal abdominal in abdominal abdominal in muscles muscles abdominal muscles muscles abdominal muscles muscles 0 0 0 3 0 0 0 0 0 1 0 0 1 0 0 2 1 50 0 0 0 3 1 33.34 1 0 0 9 2 22.23

Table (15): Seasonal prevalence of mixed infection of microscopic and macroscopic cysts according to age. Seasons


Mixed infection of microscopic and macroscopic cysts in esophagus Sheep less than 2 years Sheep more than 2years Total No. No. of % of Total No. No. of % of of sheep mixed mixed of sheep mixed mixed examined infected infected examined infected infected esophagus esophagus esophagus esophagus 35 0 0 95 0 0 34 0 0 97 1 1.03 37 0 0 109 2 1.83 34 0 0 99 1 1.01 140 0 0 400 4 1

52

Males No. of infected males

94.55

% of infected males

Total No. of females examined 100

Females No. of infected females 99

Table (17): Prevalence of infection in relation to sex of slaughtered sheep.

416

Results

% of infected females 99

Infection in several tissue samples of the same slaughtered sheep Sheep has cysts in its esophagus, diaphragm & abdominal Sheep has cysts in its esophagus & diaphragm. muscles Sheep less than 2 years Sheep more than 2 years Sheep less than 2 years Sheep more than 2 years Total no. No. of % Total no. No. of % Total no. No. of % Total no. No. of % of sheep positive of sheep positive of sheep positive of sheep positive examined examined examined examined 35 0 0 95 0 0 35 1 2.86 95 4 4.21 34 0 0 97 0 0 34 1 2.94 97 6 6.19 37 0 0 109 1 0.92 37 3 8.11 109 11 10.09 34 0 0 99 1 1.01 34 1 2.94 99 6 6.06 140 0 0 400 2 0.5 140 6 4.29 400 27 6.75

Table (16): Seasonal prevalence of infection in several tissue samples of the same slaughtered sheep according to age. Seasons


Total No. of males examined 440

53

Results II. Morphological features of the revealed Sarcocystis species: Sarcocystis species could be differentiated depending on the size and shape of its cysts which in turn related to animal species. Some species are always microscopic, whereas others become macroscopic. Common shapes are filamentous, elongated, or globular. The sarcocysts consists of a cyst wall that surrounds metrocyte or bradyzoite stages within it. The structure and thickness of the cyst wall varies among Sarcocystis species and this feature is now the primary means for differentiating species. A connective tissue capsule, formed by the host, surrounds the cyst wall of some macroscopic species. It is important to emphasize that samples of the proposed stained compressed sample technique (of our study), revealed more obvious cysts than unstained compressed one (Fig. 5)

1. Morphological features of the revealed macroscopic cysts: Macroscopic cysts were ranged in size from 0.8 to 1 cm (mean 0.9 cm in length, n = 2). They were dull white, oval or pear shaped resembling rice grain (Fig. 1 & 2). Histological sections revealed that the cyst wall is thin and smooth measures 1.6 – 1.9 µm (mean 1.8 µm) and often surrounded by connective tissue as a secondary wall (Fig. 3). The space inside the cysts was separated by septae dividing the interior of the cyst into a number of compartments which packed with bradyzoites which crowded peripherally in the cyst leaving the central area nearly empty. Bradyzoites were crescent in shape measuring 11 – 14 µm (mean 12.5 µm, n = 15) in length and 4 – 6 µm (mean 4.5 µm) in width with the nucleus located near the blunt end of the body (Fig.4) (Table 18).

54

Results 2. Morphological features of the revealed microscopic cysts. Microscopic cysts were ranged in size from 600 – 700 µm (mean 630 µm, n = 12), being oval or pear shaped (Fig. 5) and the cyst wall is thick and ranged in size from 1 – 3 µm (mean 2.7 µm, n = 12) with smooth surface measuring 3.4 µm in length and 0.4 µm in width (Fig.6). The space inside the cysts was separated by septa. Some cysts wall was thick with striation, (Fig.7). Bradyzoites were located peripherally, crescent in shape and measuring 6.7 – 7.7 µm (mean 7 µm, n = 15) in length and 1 – 2.1 µm (mean 1.5 µm n = 15) in width. The nucleus was situated near the blunt end of the body (Fig.8) (Table 18).

Table (18): Morphometric data of microscopic and macroscopic cysts. Items Location

Macroscopic cysts Esophagus only

Wall Type

Thin smooth wall

Diameter of Cyst Diameter of Bradyzoites

0.8 – 1 cm in long Length 11 – 14 µm Width 4 – 6 µm

55

Microscopic cysts Esophagus, diaphragm and abdominal muscles Thick smooth and striated wall 600 – 700 µm Length 6.7 – 7.7 µm Width 1 – 2.1 µm

Results

Figure (1): Showing macroscopic cysts in fresh muscles of esophagus of sheep by necked eyes.

Figure (2): Showing macroscopic cyst with a ruler.

56

Results

Figure (3): Showing thin wall of macroscopic cysts (arrow) in sheep muscle, C.S. stained with H & E (X10).

Figure (4): Showing bradyzoites (arrow) stained with Giemsa from macroscopic cyst (X100).

57

Results

Figure (5): Showing Giemsa stained (A) and non-stained (B) microscopic cysts (arrow) in compressed sections of sheep esophagus (X10).

Figure (6): Showing smooth thick wall of microscopic cysts (arrow) in sheep muscle, C.S. stained with H & E (X100).

58

Results

Figure (7): Showing striated thick wall of microscopic cysts (arrow) in sheep muscle, C.S. stained with H & E (X100).

Figure (8): Showing unstained bradyzoites (arrow) from microscopic cyst (X40).

59

Results III- Molecular characterization of the recovered macroscopic and microscopic cysts: Molecular identification, delimitation and phylogeny of Sarcocystis species were performed and based mainly on the nuclear 18S ribosomal RNA (18S rRNA) gene.

1. PCR reaction: Genomic DNA of 40 samples containing sarcocysts bradyzoites (divided into 3 sets of 10, 10 and 20 samples) was extracted and RT-PCR amplification followed by gel electrophoresis was carried out. Ten samples only were successfully amplified resulted in gel bands of 600 bp, and were arranged as a macroscopic cyst (sample 1, Fig. 9) and 9 microscopic cysts (sample 2 - 10, Fig. 10 and 11).

Figure (9) Showing PCR results of the first 10 sample PCR products (Agarose gel).

60

Results

Figure (10) Showing PCR results of the second 10 sample PCR products (Agarose gel).

Figure (11) Showing PCR results of the last 20 sample PCR products (Agarose gel).

61

Results 2. Sequencing reaction and Species identification: DNA from gel bands of the 10 successfully amplified cysts were purified and commercially sequenced. The harvested sequences were compared to their similarities on Genbank using the BLAST search system. It was found that the only revealed macroscopic cyst was typed as S. gigantea, while the 9 microscopic cysts isolated were identified as S. tenella.

2.1. Alignment of the revealed sequences of Sarcocystis species. 2.1.1. S. gigantea isolate: Results of the blast search of the recovered partial 18S rRNA sequences of the present study isolate illustrated (S1) the complete identity with S. gigantea sequences from each of Norway (KC209733) and Iran (KF489421) as well as S. moulei (KF489432) from Iran. Moreover, there was interspecific nucleotide polymorphism with other Genbank sequences represented by 1- 13 nucleotide substitutions and 97 – 99 % identity percent. For example, 99 % identity was noted with S. moulei (KF489423) from Iran with a single nucleotide substitution (C 156 T), like in the case of S. gigantea (KF489429) from Iran but with a different position of nucleotide substitution (Δ 173 C). In addition, single nucleotide substitution (T 76 C) and double deletions/insertions at position 81 and 90 were noted with S. moulei (KF489430) from Iran. The maximum number for nucleotide substitutions was reported with S. gigantea (L24384) from Australia. Detailed description of the nucleotide polymorphism and identity were given in Fig. 12 and Table 19.

62

Results

Fig. (12) Alignment the revealed partial 18S rRNA of S. gigantea isolate with other sequences on Genbank. This figure showing the complete identity between S. gigantea isolate of the present study and S. gigantea (KC209733) Norway as well as S. moulei (KF489432) from Iran.

63

Results Table (19): Partial 18S r RNA Sarcocystis gigantea sequences retrieved from Genbank. This table showing the percent of identity and the nucleotide polymorphism between those sequences and the present study isolate. N o 1 2 3 4

Species Sarcocystis moulei Sarcocystis gigantea Sarcocystis moulei Sarcocystis gigantea

Identit y%

Country

Host

Nucleotid e difference

100%

Iran

Sheep

Non

KC209733

100%

Norway

Sheep

Non

KF489423

99%

Iran

Sheep

C 156 T

KF489429

99%

Iran

Sheep

Δ 173 C

Accession no. KF489432

5

Sarcocystis moulei

6

Sarcocystis moulei

L76473

99%

Australia

Sheep

7

Sarcocystis gigantea

L24384

98%

Australia

Sheep

8

Sarcocystis miescheriana

JN256123

98%

Lithuani a

Pig

9

Sarcocystis miescheriana

JX840464

98%

China

Pig

10

Sarcocystis scandinavica

EU282032, EU282031, EU282030,

97%

Norway

Moose

KF489430

99%

Iran

64

Sheep

T 76 C, Δ 81 A, T 90 Δ Δ 11 T, A 17 G, T 37 C, T 54 Δ, T 56 C A 35 Δ, C 38 Δ, G 67 Δ, T 79 Δ, A 85 Δ, A 86 Δ, T 89 Δ, T 97 Δ, T 109 Δ, A 125 Δ, G 186 Δ, G 506 T, N 578 G A 165 Δ, T 166 Δ, T 167 Δ, T 177 C, C 181 T, C 183 T, G 185 T, A 392 T, C 398 T, A 399 T, Δ 402 A, G 566 A T 110 A, A 165 Δ, T 166 Δ,

Refrence Bahari, et al. (2014) Gjerde (2013) Bahari, et al. (2014) Bahari, et al. (2014) Bahari, et al. (2014) Tenter and Johnson (1997)

Ellis et al. (1995)

Prakas, et al. (2015)

Yan, et al. (2013)

Dahlgren et al. (2008)

Results EU282029, EU282027, EU282026, EU282023, EU282022, EU282020, EU282028, EU282024, EU282021.

11

Sarcocystis hominis

AF176945, AF176944.

97%

China

Cattle

12

Sarcocystis scandinavica

EU282025

97%

Norway

Moose

Sarcocystis tarandi

GQ250975 , GQ250969 , GQ251020 , GQ251014.

97%

Norway

Tatra chamois

13

65

T 167 Δ, T 175 Δ, T 176 Δ, T 177 Δ, T 182 Δ, G 183 Δ, A 212 G, A 397 G, T 403 A T 109 Δ, T 110 Δ, G 113 A, T 177 Δ, T 178 Δ, T 179 Δ, T 180 Δ, C 181 Δ, A 294 G, Δ 398 T, C 399 T, G 403 Δ, T 405 C T 110 A, T 158 Δ, T 159 Δ, A 162 Δ, T 178 Δ, T 179 Δ, T 180 Δ, T 182 Δ, G 183 Δ, A 212 G, A 263 G, A 397 G, T 403 A. T 110 A, A 165 Δ, T 166 Δ, T 167 Δ, T 175 Δ, T 176 Δ, T 177 Δ, T 182 Δ, G 183 Δ, A 204 G, A 212 G, A 397 G, T 403 A

Yang et al. (2001)

Dahlgren et al. (2008)

Dahlgren and Gjerde (2010)

Results 2.1.2. S. tenella isolate: Alignment of the revealed partial 18S r RNA sequences of the examined nine Sarcocystis tenella samples (from 2 to 10) showed multiple intraspecific nucleotides polymorphism. This variation was demonstrated by triple nucleotide substitutions at positions 13, 23 and 44 (Fig. 13). According

to

the intraspecific nucleotides

polymorphism,

three

haplotypes were recovered from S. tenella isolates. The first haplotype (H1) was noted in 4 samples (2, 5, 9 and 10) in which the nucleotides G, T and T were found at positions 13, 23 and 44, respectively. This haplotype showed a complete identity with a number of S. tenella sequences on Genbank accession numbers

(KP263759,

KC209734,

KR155230,

KR155229,

KR155222,

KR155212, KR155209, KR155200, KR155199, KR155192, KX057996, KF831291 and KF831277) (Fig 13, 14 and Table 20). While, the second haplotype (H2) was described in another 4 samples (3, 4, 6 and 7) in which the nucleotides A, T and C were noted in the previously mentioned positions, respectively. This haplotype showed a complete identity to variable number of S. tenella isolates on Genbank (KP263758, KP263754, KP263752, KX057996 and KF831291) (Fig 13, 14 and Table 21). Moreover, the third haplotype (H3) was noted in a unique sample (sample 8) in which the nucleotides G, C and A were noted in the previously mentioned positions, respectively. This haplotype was completely identical to a number of S. tenella isolates in Genbank (KP263757, KP263756, KP263755 and KC209737) (Fig 13, 14 and Table 22).

66

Results

Fig. (13) Alignment of the present study S tenella isolates. Intraspecific nucleotide variation was noted at positions (13, 23 and 44) forming 3 haplotypes.

67

68

Results

Continued

Results

Fig. (14) Alignment the revealed partial 18S rRNA of S. tenella isolate with other sequences on Genbank. This figure showing the identity

between the revealed three haplotypes of S. tenella isolate of the present study with other sequences on Genbank.

69

Results Table (20): Partial 18S rRNA Sarcocystis tenella sequences retrieved from Genbank. This table showing the percent of identity and the nucleotide polymorphism between those sequences and first haplotype (H1) of S. tenella isolate in the present study (samples 2, 5, 9 & 10). No

1 2

3

4 5 6 7 8 9

10

11

12

13

Species

Sarcocystis tenella Sarcocystis tenella

Sarcocystis sp. YLL2015a

Sarcocystis heydorni Sarcocystis taeniata Sarcocystis tenella Sarcocystis tenella Sarcocystis tenella Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. SKV2015 Sarcocystis tarandivulpe s Sarcocystis hircicanis

Accession no.

KP263759 KC209734 KR155230 KR155229 KR155222 KR155212 KR155209 KR155200 KR155199 KR155192 KX057996

Identity %

Country

Host

Nucleotide difference

100%

Poland

Tatra chamois

Non

100%

Norway

Sheep

Non

Goat

Non

100%

Malaysia

100%

China

Cattle

Non

KF831277

100%

Canada

Moose

Non

KP263757 KP263756 KP263755

99%

Poland

Tatra chamois

T 23 C

KP263753

99%

Poland

Tatra chamois

A 56 G

99%

Norway

sheep

T 23 C

KR155224

99%

Malaysia

goat

KR155216

99%

Malaysia

goat

USA

deer

99%

Norway

deer

C 386 T

99%

china

goat

A 56 Δ

KC209737

KT378042

EF467657

KU820985

99%

70

Refrence

Kolenda, et al. (2015) Gjerde (2013)

Ng, et al. (2015)

Hu, et al. (2016) Gjerde, (2014) Kolenda, et al. (2015) Kolenda, et al. (2015) Gjerde, (2013)

C 399 T

Ng, et al. (2015)

A 411 G

Ng, et al. (2015)

C 486 T

CaleroBernal et al. (2015) Dahlgren, et al. (2007) Hu, et al. (2016)

Results Table (21): Partial 18S r RNA Sarcocystis tenella sequences retrieved from Genbank. This table showing the percent of identity and the nucleotide polymorphism between those sequences and second haplotype (H2) of S. tenella isolate in the present study (samples 3, 4, 6 & 7). N o 1 2 3 4

5

6

7

8

9

10

11

12 13 14 15

Species Sarcocystis tenella Sarcocystis heydorni Sarcocystis taeniata Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. SKV2015 Sarcocystis tarandivulpe s Sarcocystis hircicanis Sarcocystis tenella Sarcocystis tenella

Accession no. KP263758 KP263754 KP263752 KX057996

Identity %

Country

Host


100%

Poland

Tatra chamois

Non

100%

China

KF831291

100%

Canada

Moose

KR155235

99%

Malaysia

Goat

KR155228

99%

Malaysia

Goat

KR155224

99%

Malaysia

Goat

KR155216

99%

Malaysia

Goat

KR155208

99%

Malaysia

Goat

KR155201

99%

Malaysia

Goat

KR155198

99%

Malaysia

Goat

KT378042

99%

USA

99%

Iceland

99%

EF467656 EF467657 EF467612 KU820984 KU820985 KP263759 KC209734

Cattle

Deer

Non Non C 50 T

Kolenda et al. (2015) Hu,et al. (2016) Gjerde, (2014) Ng, et al. (2015)

A 319 G

Ng, et al. (2015)

C 399 T

Ng, et al. (2015)

A 411 G

T 313 C

Ng, et al. (2015) Ng, et al. (2015)

T 163 C

Ng, et al. (2015)

G 332 A

Ng, et al. (2015)

C 386 T

Deer

C 386 T

China

Goat

A 56 Δ

99%

Poland

Tatra chamois

99%

Norway

Sheep

A 14 G, C 44 T A 14 G, C 44 T

71

Refrence

CaleroBernal, (2015 Dahlgren, et al. (2007) Hu, et al. (2016) Kolenda, et al. (2015) Gjerde (2013)

Results

Table (22): Partial 18S r RNA Sarcocystis tenella sequences retrieved from Genbank. This table showing the percent of identity and the nucleotide polymorphism between those sequences and third haplotype (H3) of S. tenella isolate in the present study (sample 8). N o 1 2 3 4 5

6

7

8

9

10

11 12 13 14 15

Species Sarcocystis tenella Sarcocystis tenella Sarcocystis tenella Sarcocystis tenella Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. YLL2015a Sarcocystis sp. SKV2015 Sarcocystis tarandivulpe s Sarcocystis hircicanis Sarcocystis heydorni Sarcocystis sp. 103880 Sarcocystis tenella

Accession no. KP263757 KP263756 KP263755 KC209737

Identit y%

Country

Host


Refrence

100%

Poland

Tatra chamois

Non

Kolenda, et al. (2015)

100%

Norway

Sheep

non

99%

Poland

Tatra chamois

C 23 T

KC209734

99%

Norway

Sheep

C 23 T

KR155235

99%

Malaysia

Goat

KR155228

99%

Malaysia

Goat

KR155224

99%

Malaysia

Goat

KR155216

99%

Malaysia

Goat

KR155208

99%

Malaysia

Goat

KT378042

99%

USA

99%

Iceland

99%

KP263759

EF467656 EF467657 EF467612 KU820984 KU820985 KX057997 AF176925 KP263753

Deer

C 50 T

Ng, et al. (2015)

A 319 G

Ng, et al. (2015)

C 399 T

Ng, et al. (2015)

A 411 G

Ng, et al. (2015)

T 313 C

Ng, et al. (2015)

C 386 T

Deer

C 386 T

China

Goat

A 56 Δ

99%

China

Goat

G 252 S

99%

China

Buffalo

A 132 C

99%

Poland

Tatra chamois

A 56 G

72

Gjerde, (2013) Kolenda, et al. (2015) Gjerde (2013)

CaleroBernal, (2015 Dahlgren, et al. (2007) Hu,et al. (2016) Hu,et al. (2016) Yang, et al (2001) Kolenda, et al. (2015)

Results 3. Cluster analysis and diversity indices of the revealed Sarcocystis species: 3.1. S. gigantea isolates: Establishment of the haplotype frequencies tree of partial 18S rRNA for the isolate (S1) of S. gigantea in the present study altogether with eight S. gigantea isolates on Genbank confirmed the results of the nucleotides alignment which explained the sharing status the present study isolate with that from Norway (KC209733) and Iran (KF489432). Collectively, analysis of 9 S. gigantea isolates revealed 47 polymorphic sites with low nucleotide diversity (0.001713). Furthermore, six haplotypes (66.66%) were observed which were arranged as single haplotype was shared by 3 isolates, one haplotype comprised 2 isolates and four haplotypes consisted of single haplotype for each, (Fig. 15).

3.2. S. tenella isolates: Results of the cluster analysis of the nine isolates recorded in the present study were corroborated with the nucleotides alignment results. These isolates were arranged in 3 haplotypes named as haplotype 1, 2 and 3. Overall, cluster analysis of 32 S. tenella partial 18S rRNA gene sections (9 isolates of the present study and 23 isolates obtained from Genbank) was carried out. Alignment of sequences revealed 62 polymorphic sites. Moreover, a moderately low (0.34%) haplotype frequencies rate was noted of which 11 haplotypes out of the 32 isolates were observed (Fig. 16). For much clarification, there were 2 haplotypes comprised 9 isolates for each, one haplotype comprised 3 isolates, 3 haplotypes comprised 2 haplotypes for each

73

Results and finally five haplotypes consisted of single isolate for each. In addition, low nucleotide (0.001780) diversity was detected.

Fig. (15): Frequencies of sequence sections of 18S rRNA haplotypes of S. gigantea isolates of sheep from Egypt (S1) and variable geographical regions. Six haplotypes were noted. The scale bar refers to evolutionary distances in substitutions per site.

74

Results

Fig. (16): Frequencies of sequence sections of 18S rRNA haplotypes of S. tenella isolates of sheep from Egypt (S2-S10) and variable geographical regions. Eleven haplotypes out of 32 isolates were noted. The Egyptian isolates were arranged in three haplotypes. The scale bar refers to evolutionary distances in substitutions per site.

75

Results 4. Neutrality indices of the revealed Sarcocystis species: Taijma D neutral test was used for estimation of Sarcocystis species demographic expansion or contraction. Negative values of this index were observed for both S. gigantea (-3.969974) or S. tenella (-2.931114). Table (23): Different diversity and neutrality indices of the revealed Sarcocystis species: species

M

S

π

D

S. gigantea

9

74

0.001713

-3.969974

S. tenella

26

26

0.001780

-2.931114

Abbreviations: m = number of sequences, S = Number of segregating sites, π = nucleotide diversity, and D is the Tajima test statistic

5. Genetic differentiation among different species of Sarcocystis. Genetic distances among different species of Sarcocystis were estimated (Table. 24). Overall, high values of the genetic distance (0.238 - 0.398) were noted by comparing the genus Sarcocystis to E. granulosus. Moreover, this value was very low (0.000 - 0.018) within S. gigantea isolates including that of the present study. On the other hand, lower values were observed (0.000 - 0.016) within S. tenella isolates including the nine isolates of the present study.

76

MEGA version (6).

Results

group. These values were estimated using the software

of Sarcocystis. E. granulosus was used as an out

Table (24): Genetic distances among different species

KF489431_S._tenella_Iran KF489428_S._tenella_Iran 0.008 KF489425_S._tenella_Iran 0.011 0.019 KF489424_S._tenella_Iran 0.004 0.013 0.015 KF489422_S._tenella_Iran 0.010 0.017 0.019 0.014 S2_(H1) 0.000 0.008 0.010 0.004 0.010 S3_(H2) 0.000 0.008 0.010 0.004 0.010 0.004 S8_(H3) 0.000 0.008 0.010 0.004 0.010 0.002 0.005 KP263759_S.tenella_Poland 0.000 0.008 0.010 0.004 0.010 0.000 0.004 0.002 KC209734_S.tenella_Norway 0.000 0.008 0.010 0.004 0.010 0.000 0.004 0.002 0.000 KR155230_S._species_Malaysia 0.000 0.008 0.010 0.004 0.010 0.025 0.025 0.027 0.018 0.018 KX057996_S._heydorni_china 0.000 0.008 0.010 0.004 0.010 0.038 0.037 0.038 0.018 0.018 0.034 KF831291_S._taeniata_Canada 0.000 0.008 0.010 0.004 0.010 0.042 0.040 0.044 0.033 0.032 0.030 0.038 KP263757_S._tenella_poland 0.000 0.008 0.010 0.004 0.010 0.002 0.005 0.000 0.002 0.002 0.021 0.019 0.034 KP263753_S._tenella_poland 0.000 0.010 0.010 0.004 0.010 0.002 0.005 0.004 0.002 0.002 0.019 0.020 0.035 0.003 KC209737_S._tenella_Norway 0.000 0.008 0.010 0.004 0.010 0.002 0.005 0.000 0.001 0.001 0.019 0.018 0.033 0.001 0.002 KR155235_S._species_Malaysia 0.000 0.008 0.010 0.004 0.010 0.029 0.029 0.031 0.021 0.021 0.005 0.034 0.031 0.024 0.022 0.022 KR155228_S._species_Malaysia 0.002 0.010 0.013 0.006 0.012 0.027 0.027 0.029 0.018 0.018 0.002 0.034 0.030 0.021 0.019 0.019 0.005 KR155224_S._species_Malaysia 0.002 0.010 0.013 0.006 0.012 0.029 0.029 0.031 0.020 0.020 0.004 0.034 0.030 0.023 0.021 0.021 0.005 0.004 KR155216_S._species_Malaysia 0.002 0.010 0.013 0.006 0.012 0.029 0.029 0.031 0.019 0.019 0.003 0.033 0.029 0.022 0.020 0.020 0.004 0.003 0.003 KT378042_S._species_USA 0.002 0.010 0.013 0.006 0.012 0.031 0.031 0.033 0.026 0.026 0.013 0.034 0.035 0.027 0.027 0.027 0.017 0.013 0.016 0.015 EF467657_S._tarandivulpes_Norway 0.002 0.010 0.013 0.006 0.012 0.031 0.031 0.033 0.028 0.028 0.013 0.036 0.037 0.029 0.029 0.028 0.017 0.013 0.016 0.015 0.001 KU820985_S._hircicanis_china 0.000 0.008 0.010 0.004 0.010 0.046 0.045 0.046 0.031 0.031 0.037 0.029 0.033 0.031 0.032 0.031 0.038 0.037 0.038 0.037 0.041 0.043 KP263758_S._tenella_Poland 0.000 0.008 0.010 0.004 0.010 0.004 0.000 0.005 0.001 0.001 0.018 0.018 0.032 0.003 0.003 0.002 0.021 0.018 0.020 0.019 0.026 0.028 0.031 KX057996_S._heydorni_china 0.000 0.008 0.010 0.004 0.010 0.038 0.037 0.038 0.018 0.018 0.034 0.000 0.038 0.019 0.020 0.018 0.034 0.034 0.034 0.033 0.034 0.036 0.029 0.018 KF831291_S._taeniata_Canada 0.000 0.008 0.010 0.004 0.010 0.042 0.040 0.044 0.033 0.032 0.030 0.038 0.000 0.034 0.035 0.033 0.031 0.030 0.030 0.029 0.035 0.037 0.033 0.032 0.038 KR155208_S._species_Malaysia 0.002 0.010 0.013 0.006 0.012 0.029 0.029 0.031 0.022 0.022 0.006 0.036 0.032 0.025 0.023 0.023 0.007 0.006 0.006 0.005 0.018 0.018 0.038 0.022 0.036 0.032 KR155201_S._species_Malaysia 0.002 0.010 0.013 0.006 0.012 0.027 0.027 0.029 0.020 0.020 0.004 0.034 0.032 0.023 0.021 0.021 0.007 0.004 0.006 0.005 0.016 0.016 0.037 0.020 0.034 0.032 0.008 KR155198_S._species_Malaysia 0.002 0.010 0.013 0.006 0.012 0.029 0.029 0.031 0.022 0.022 0.006 0.036 0.032 0.025 0.023 0.023 0.007 0.006 0.006 0.005 0.018 0.018 0.040 0.022 0.036 0.032 0.008 0.008 KT378042_S._species_USA 0.002 0.010 0.013 0.006 0.012 0.031 0.031 0.033 0.026 0.026 0.013 0.034 0.035 0.027 0.027 0.027 0.017 0.013 0.016 0.015 0.000 0.001 0.041 0.026 0.034 0.035 0.018 0.016 0.018 EF467656_S._tarandivulpes_Iceland 0.002 0.010 0.013 0.006 0.012 0.031 0.031 0.033 0.028 0.028 0.013 0.036 0.036 0.029 0.029 0.028 0.017 0.013 0.016 0.015 0.002 0.001 0.042 0.028 0.036 0.036 0.018 0.016 0.018 0.002 KU820984_S._hircicanis_China 0.000 0.008 0.010 0.006 0.012 0.041 0.039 0.041 0.031 0.031 0.037 0.028 0.034 0.031 0.032 0.031 0.038 0.037 0.038 0.037 0.041 0.043 0.003 0.031 0.028 0.034 0.038 0.035 0.040 0.041 0.042 KX057997_S._heydorni_China 0.002 0.010 0.013 0.006 0.012 0.040 0.038 0.040 0.019 0.019 0.034 0.003 0.039 0.020 0.021 0.019 0.034 0.034 0.034 0.033 0.034 0.036 0.029 0.018 0.003 0.039 0.036 0.036 0.036 0.034 0.036 0.029 AF176925_S._species_china 0.002 0.010 0.013 0.006 0.012 0.042 0.040 0.042 0.021 0.021 0.035 0.002 0.039 0.022 0.022 0.021 0.035 0.035 0.035 0.034 0.039 0.040 0.030 0.020 0.002 0.039 0.037 0.037 0.037 0.039 0.041 0.030 0.004 S1_(S._gigantea) 0.021 0.031 0.025 0.026 0.028 0.068 0.069 0.069 0.070 0.070 0.077 0.064 0.083 0.072 0.072 0.072 0.077 0.077 0.079 0.079 0.064 0.064 0.070 0.072 0.064 0.083 0.079 0.077 0.079 0.064 0.064 0.065 0.066 0.066 KC209733S._gigantea_Norway 0.021 0.031 0.025 0.025 0.027 0.068 0.069 0.069 0.077 0.076 0.058 0.076 0.079 0.079 0.078 0.077 0.060 0.058 0.060 0.059 0.075 0.068 0.082 0.077 0.076 0.079 0.062 0.058 0.062 0.075 0.074 0.081 0.078 0.070 0.000 KF489429_S._gigantea_Iran 0.013 0.022 0.024 0.017 0.022 0.013 0.013 0.013 0.013 0.013 0.013 0.013 0.013 0.013 0.013 0.013 0.013 0.015 0.015 0.015 0.011 0.011 0.013 0.013 0.013 0.013 0.015 0.015 0.015 0.011 0.011 0.013 0.015 0.015 0.000 0.000 L24384_S._gigantea_Australia 0.023 0.034 0.028 0.027 0.029 0.071 0.072 0.072 0.073 0.072 0.058 0.072 0.075 0.075 0.074 0.073 0.060 0.058 0.060 0.059 0.069 0.069 0.076 0.073 0.072 0.075 0.062 0.058 0.062 0.069 0.068 0.075 0.073 0.071 0.004 0.004 0.002 KF489432_S._moulei_Iran 0.021 0.031 0.025 0.027 0.029 0.029 0.029 0.029 0.029 0.029 0.029 0.027 0.029 0.029 0.031 0.029 0.029 0.031 0.031 0.031 0.027 0.027 0.025 0.029 0.027 0.029 0.031 0.031 0.031 0.027 0.027 0.025 0.029 0.029 0.000 0.000 0.000 0.002 KF489423_S._moulei_Iran 0.015 0.024 0.026 0.019 0.023 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.017 0.017 0.017 0.013 0.013 0.015 0.015 0.015 0.015 0.017 0.017 0.017 0.013 0.013 0.015 0.017 0.017 0.002 0.002 0.002 0.004 0.002 KF489430_S._moulei_Iran 0.036 0.029 0.040 0.042 0.044 0.045 0.045 0.045 0.045 0.045 0.045 0.043 0.043 0.045 0.047 0.045 0.045 0.047 0.047 0.047 0.043 0.043 0.039 0.045 0.043 0.043 0.047 0.047 0.047 0.043 0.043 0.039 0.045 0.045 0.018 0.018 0.011 0.016 0.014 0.015 L76473_S._moulei_Australia 0.021 0.031 0.025 0.025 0.027 0.067 0.069 0.069 0.072 0.071 0.060 0.072 0.075 0.073 0.073 0.071 0.062 0.060 0.062 0.061 0.071 0.070 0.076 0.072 0.072 0.075 0.064 0.060 0.064 0.071 0.070 0.075 0.074 0.071 0.014 0.011 0.000 0.014 0.000 0.002 0.016 JN256123_S._miescheriana_Lithuania 0.017 0.029 0.023 0.027 0.027 0.077 0.075 0.078 0.063 0.062 0.058 0.061 0.059 0.064 0.064 0.062 0.059 0.060 0.060 0.059 0.062 0.065 0.065 0.062 0.061 0.059 0.062 0.060 0.062 0.062 0.063 0.065 0.062 0.064 0.073 0.073 0.017 0.068 0.036 0.019 0.052 0.071 JX840464_S._miescheriana_China 0.017 0.029 0.023 0.027 0.027 0.077 0.075 0.078 0.063 0.062 0.058 0.061 0.059 0.064 0.064 0.062 0.059 0.060 0.060 0.059 0.062 0.065 0.065 0.062 0.061 0.059 0.062 0.060 0.062 0.062 0.063 0.065 0.062 0.064 0.073 0.073 0.017 0.068 0.036 0.019 0.052 0.071 0.000 EU282032_S_scandinavica_Norway 0.019 0.029 0.023 0.021 0.021 0.069 0.070 0.070 0.063 0.063 0.051 0.057 0.066 0.065 0.063 0.063 0.051 0.051 0.051 0.050 0.064 0.066 0.066 0.063 0.057 0.066 0.053 0.051 0.053 0.064 0.065 0.065 0.059 0.060 0.064 0.068 0.011 0.065 0.021 0.013 0.039 0.066 0.063 0.063 AF176945_S._hominis_China 0.019 0.029 0.027 0.023 0.025 0.064 0.064 0.066 0.062 0.062 0.053 0.061 0.059 0.064 0.062 0.063 0.054 0.053 0.054 0.053 0.057 0.057 0.065 0.062 0.061 0.059 0.056 0.053 0.056 0.057 0.058 0.065 0.064 0.063 0.056 0.058 0.015 0.058 0.023 0.017 0.041 0.059 0.058 0.058 0.061 EU282025_S._scandinavica_Norway 0.025 0.035 0.029 0.027 0.027 0.070 0.070 0.071 0.062 0.062 0.053 0.056 0.062 0.064 0.062 0.063 0.053 0.053 0.053 0.052 0.061 0.063 0.063 0.062 0.056 0.062 0.055 0.053 0.055 0.061 0.062 0.063 0.058 0.059 0.063 0.068 0.017 0.065 0.027 0.019 0.045 0.066 0.061 0.061 0.008 0.059 GQ250975_S._tarandi_Norway 0.021 0.031 0.029 0.025 0.027 0.055 0.056 0.056 0.054 0.054 0.047 0.054 0.054 0.055 0.054 0.054 0.050 0.049 0.050 0.049 0.054 0.055 0.056 0.054 0.054 0.054 0.052 0.049 0.052 0.054 0.054 0.056 0.056 0.058 0.065 0.066 0.013 0.062 0.019 0.015 0.037 0.062 0.063 0.063 0.055 0.031 0.054 KR186123_S_fusiformis_Egypt 0.013 0.023 0.019 0.015 0.019 0.063 0.064 0.064 0.054 0.053 0.050 0.051 0.058 0.056 0.055 0.054 0.051 0.050 0.052 0.051 0.053 0.055 0.056 0.055 0.051 0.058 0.054 0.050 0.054 0.053 0.053 0.055 0.053 0.052 0.034 0.053 0.002 0.049 0.010 0.004 0.025 0.047 0.052 0.052 0.039 0.043 0.039 0.046 KU247912_S._buffalonis_Egypt 0.015 0.030 0.021 0.023 0.025 0.058 0.060 0.060 0.057 0.056 0.054 0.056 0.057 0.059 0.056 0.057 0.057 0.054 0.056 0.055 0.057 0.059 0.063 0.058 0.056 0.057 0.058 0.054 0.058 0.057 0.058 0.061 0.058 0.058 0.029 0.053 0.004 0.048 0.016 0.006 0.033 0.050 0.056 0.056 0.045 0.045 0.044 0.049 0.022 KJ778019_S._cafferi_South_Africa 0.015 0.025 0.021 0.017 0.022 0.063 0.065 0.065 0.054 0.054 0.050 0.051 0.058 0.056 0.054 0.054 0.051 0.050 0.052 0.051 0.052 0.052 0.057 0.054 0.051 0.058 0.054 0.050 0.054 0.052 0.051 0.056 0.052 0.052 0.037 0.054 0.004 0.049 0.012 0.006 0.027 0.047 0.055 0.055 0.038 0.041 0.038 0.041 0.007 0.021 KY019031_S._gracilis_Italy 0.002 0.017 0.013 0.010 0.012 0.043 0.043 0.045 0.037 0.037 0.021 0.043 0.041 0.039 0.038 0.037 0.024 0.021 0.023 0.022 0.040 0.042 0.047 0.037 0.043 0.041 0.025 0.023 0.025 0.040 0.041 0.049 0.043 0.041 0.077 0.086 0.013 0.079 0.037 0.015 0.053 0.080 0.066 0.066 0.068 0.060 0.065 0.063 0.057 0.060 0.060 AB731639_E._granulosus 0.244 0.244 0.252 0.238 0.249 0.269 0.270 0.270 0.375 0.376 0.278 0.390 0.384 0.377 0.377 0.377 0.280 0.280 0.280 0.279 0.382 0.374 0.377 0.376 0.390 0.384 0.282 0.279 0.281 0.382 0.382 0.377 0.390 0.333 0.290 0.398 0.243 0.395 0.253 0.242 0.259 0.393 0.394 0.394 0.384 0.330 0.385 0.376 0.390 0.392 0.385 0.394

77

Results 6. Phylogenetic tree of the revealed Sarcocystis species: During construction of the phylogenetic tree, representative haplotypes for each group of identical sequences were taken to avoid the inconvenience resulted from big ramified trees. The present study samples which subjected to phylogenetic analysis were sample 1 as S. gigantea, Samples 2, 3 and 8 representatives for the first (H1), second (H2) and the third (H3) haplotypes of S. tenella, respectively. A number of partial 18S rRNA sequences either of sheep Sarcocystis species or Sarcocystis species from the animals were included in the analysis. Using Echinococcus granulosus as out-group, all Sarcocystis species from different animals were clustered in the same clade other than that of E. granulosus. Within Sarcocystis species, 2 main clades were formed; the first comprised lonely S. miescheriana infecting pigs which use dogs as predators, while all the other Sarcocystis spp. were located in the other clade. Further investigations illustrated the clustering of Sarcocystis spp. which utilize felines (S. gigantea of sheep, S. fusiformis of buffaloes) as definitive hosts in a branch altogether with S. tarandi of reindeer and S. scandinavica of moose for whom the final host is still unknown. This branch was separated from that of Sarcocystis species transmitted via canines (S. tenella of sheep, S. heydorni of cattle, S. hircicanis of goats and S. tarandivulpes of reindeer). Moreover, S. gigantea isolate (S1) of the present study was intermixed with different S. gigantean isolates from variable geographical regions in the same branch which noted to be in a sister relationship with S. fusiformis infecting buffaloes from Egypt, (Fig. 17).

78

Results Concerning the three revealed haplotypes of S. tenella in the present study, they were located in the same branch of canines transmitted Sarcocystis spp. and were intermingled with globally reported different S. tenella isolates. The first haplotype (S2, H1) was found nearer to S. tenella from Poland (KP263769), while the second (S3, H2) and third (S8, H3) were located adjacent to S. tenella from Norway (KC2097343) and Iran (KF489428), respectively.

Table (25): Complementary table for the sequences used for phylogenetic analysis. No

Species

1

S.tenella

2

S.tenella

3 4 5

S. taeniata

Accession Country no. KF489422 Iran KF489424 KF489425 KF489428 Iran KF489431 KF831291

S. fusiformis

KR186123

Echinococcus granulosus

AB731639

79

Host

Reference

Sheep

Bahari, et al. (2014)

Sheep

Salehi, et al. (2014)

Canada

Moose

Egypt

Buffalo

China

---

Gjerde, (2014) Gjerde, et al. (2015) Nakao, et al. (2013)

Results

Fig. (17): Maximum Pairsmony phylogentic tree for different Sarcocystis spp. including isolates of the present study based on partial 18S rRNA gene sections. Tree

was

constructed

using

Maximum Pairsmony with SPR algorithm. The bootstrap analysis was

conducted

using

1000

replicates. Scale bar indicates the proportion of sites changing along each branch.

80

Results 7. Amino acids translation and alignment of the revealed Sarcocystis species sequences: Amino acids translation for the partial 18S rRNA gene sections of the revealed Sarcocystis spp. was carried out in order to confirm the nucleotides polymorphism.

7.1. Sarcocystis gigantea isolate: Nucleotide polymorphism was described as a functional when compared to the results of amino acids sequences alignment. There was complete identity in amino acids sequence of the present study isolate of S. gigantea and that from Norway (KC209733) and S. moulei from Iran (KF489432). Moreover, variable amino acids mutations was noted with the other S. gigantea isolates from Iran (KF489429) and Australia (L24384) as well as S. moulei from Iran (KF489423 and KF489430), (Fig. 18).

Fig. (18): Protein sequence alignment of partial 18S rRNA of different S. gigantea isolates including that of the present study. Complete identity was noted with S. gigantean isolate from Norway (KC209733). 81

Results 7.2. S. tenella isolates: Protein sequence analysis for the nine S. tenella isolates illustrated their arrangement in 3 haplotypes as stated previously in the nucleotides alignment. There mutation among the 3 haplotypes in 3 positions. The first haplotype (samples 2, 5, 9 and 10) was distinguished from the second one (samples 3, 4, 6 and 7) by double amino acids mutations at positions 16 and 27. Glycine and Cysteine in the first haplotype was substituted with Glutamic acid and Arginine in the previously mentioned positions, respectively. While, the third haplotype (sample 8) resembled the first haplotype in those double mutations, but had a unique mutation (Phenylalanine was substituted by Lucien) at position 20, (Fig. 19). Moreover, variable amino acids substitutions were noted by alignment of the revealed three haplotypes of the present study and those deposited on Genbank, (Fig. 20).

Fig. (19): Protein sequence alignment of partial 18S rRNA of the nine isolates of S. tenella of the present study. Three mutational sites were noted at positions 16, 20 and 27 resulting in three haplotypes formation. 82

Results

Fig. (20). Protein sequence alignment of partial 18S rRNA of the three S. tenella haplotypes of the present study with those published on Genbank. Variable amino acids substitutions at different positions were noted.

Table (26): The abbreviation of the amino acids. Amino acid Alanine Cysteine Aspartic acid Glutamic acid Phenylalanine Glycine Histidine

Abb. litter A C D E F G H

Amino acid Isoleucine Lysine Leucine Methionine Asparagine Proline Glutamine

Abb. litter I K L M N P Q

83

Amino acid Arginine Serine Threonine Valine Tryptophan Tyrosine Stopping codon

Abb. litter R S T V W Y *

Discussion

Discussion The present study was carried out in order to investigate the prevalence and seasonal dynamics of Sarcocystis species infection among slaughtered sheep at different abattoirs in Egypt (Damietta, Dakahlia and Cairo). Special references were given to tissue distribution and morphological features as well as molecular characterization and diversity of Sarcocystis species cysts found embedded in three tissues of sheep carcasses. PCR reaction and sequencing the specific DNA fragment in S18 rRNA gene were used for differentiation of Sarcocystis species. Also, alignment and identity percent of studied sequences and Genbank was performed. Contaminated food, water and pastures by disseminated Sarcocystis sporocysts are the main source of infection for sheep (Dubey et al., 1989 a). The presence of infected definitive hosts causes shedding of large number of sporocysts which has internal sporulation so, they are infective already when passed in the feces High percent of the parasite in the tissues of the intermediate host will increase the possibility of definitive hosts to become infected through ingestion of the raw meat from the slaughtered sheep at abattoirs. Therefore, Sarcocystis species can keep the life cycle active and continually promote the spread of infection. Also, large number of sporocysts can be disseminated by the final host (Dubey et al., 1989 a) besides the long time of sporocyst excretion (Huong et al., 1995). In addition, Sarcocystis sporocysts had considerable long life cycle under different environmental conditions (Savini et al., 1996). This information revealed the fact that the environment is heavily contaminated with infective sporocysts and the ingestion of sporocysts by sheep starts from the young ages. The previous mentioned causes may explain the high infection rate with Sarcocystis species. 84

Discussion This study revealed a high incidence of Sarcocystis species (95.37%). This might be attributed to the widespread existence of Sarcocystis species sporocysts in the environment, also due to the massive contact of sheep with infected dogs and cats which act as definitive hosts (Abbas, 2011 and ElDakhly et al., 2011), as well as the ability of sporocysts to face and survive in unsuitable environmental conditions (Savini et al., 1996). This result found within the range recorded in Egypt by Mohamed, 1979 in Cairo abattoirs (100%); Ali, 1985 (61.41%) in Assiut Province; Elsayed, 1985 (90 %) in Aswan area; El-Ganiny, 1989 (83 %) in El-Minia Province; Hassanien, 1992 (69.57%) in Kalubia abattoirs; El-Saieh, 1998 ( 69.95 %) and Aly, 2012 (68.9 %) in Qena Province; Basher, 2006 (84%) in sues canal area, and finally ELbader et al., 2014 (65.15 %) in New-Valley Province. On the other hand, the present results are found higher than some studies in Egypt recorded by Mohammed, 1996 (45.5%) in Assiut Province, Hassan, 2004 (10%) in El Fayoum Province and Mahran, 2009 (41.26 %) at the abattoirs in Shalatin Abattoir, Red Sea Province. This difference may be due to low number of examined sheep as in Assiut and El Fayoum studies or may be due to lesser contact between sheep and definitive hosts as in Red Sea study (desert area). Regarding the prevalence rate allover the world, higher infection rate was reported by Gut, 1982 (92%) and Granstorm et al., 1993 (94.4 %) in Czech Republic; O'Donoghue and ford, 1986 (93.2 %) in Australia; Pomroy and Charleston, 1987 (92.1 %) in New Zealand area; Imai et al., 1989 (93.3 %) in Japan; Woldemeskel & Gebreeab, 1996 (93.7 %) In Ethiopia; Fukuyo, 2002 (96.9 %) in Mongolia; Al-Hoot et al., 2005 (76 % in Najdy sheep, 84 % in Niemy sheep, 89 % in Sawakny sheep) in Saudi Arabia and Al Quraishy et al., 2014 (81.5 % in Najdy sheep, 83 % in Niemy sheep and 90 % in Sawakny sheep) in Saudi Arabia; Yazicioğlu & Beyazit, 2005 (100 %); Ozkayhan et al., 85

Discussion 2006 (58.92 %); Beyazit, et al., 2007 (86.5 %) and Dehaghi et al., 2013 (100%) in Turkey; Arshad et al., 2007 (100 %) and Hosseini et al., 2012 ( 92 %) in Iran, while little studies recorded low incidence as Daryani et al., 2006 (33.9 %) in Iran; Da Silvaa et al., 2009 (0.33 %) in Brazil; Martínez-Navalón et al., 2012 (12 %) in Spain and Farhang-Pajuh et al., 2014 (36.83%) in Urmia. This difference in the incidence rate may be attributed to the difference in ambient temperature and humidity in different countries as Savini et al. (1996) recorded that the infectivity of some Sarcocystis species sporocysts maintained long life span in cool weather and reduced by increasing of humidity and ambient temperatures. Also, Collins (1981) reported that sporocysts cannot survive for a long period in hot and dry conditions. Concerning the incidence of sarcocysts in different tissues, microscopic cysts were revealed at higher rate (95.37%) than macroscopic cysts (0.74%). It is known that cats are the definitive hosts of all macroscopic cysts, so the low incidence of macroscopic cysts may be due to low contact of sheep with infected cats which act as definitive hosts in comparison with dogs which act as definitive hosts for microscopic ones, therefore Dubey et al. (1989 a) reported that canines had a great role for transmission of Sarcocystis species more than felines due to their close live with sheep herds. Dealing with the prevalence of macroscopic cysts in different tissue samples, the results revealed that macroscopic cysts were detected only in esophagus of sheep over 2 years with a low incidence (1%) being in agreement with Titilincu et al., 2008 and Dubey et al., 1989 a as they mentioned that macroscopic sarcocysts are always located in esophageal muscle. Esophagus as active muscle may have more blood supply so; the opportunity of coming of parasite is higher than diaphragm and abdominal muscles that may be the cause of presence of macroscopic cyst in esophagus only (Abbas, 2011 & El-Dakhly et al., 2011). 86

Discussion These results were agreed with Ali, 1985;

Mohammed, 1996 and

Basher, 2006 (0 %); Mahran, 2009 (9.9%); Aly, 2012 (2.8%); O'Donoghue and ford, 1986 (6.7%); Hinaidy and Egger, 1994 (2.4%); Hosseini et al., 2012 (4.3%) and Dehaghi et al., 2013 (6% in esophagus and 2.88% in diaphragm) while, lower than Svobodova and Nevole 1990 (60.3%); Al-Hoot et al., 2005 (13.5%);Ozkayhan et al, 2006 (20.53%); Arshad et al., 2007 (24.7%); Beyazit, et al., 2007 (24.5 %); Titilincu et al., 2008 (26.32%); Nematollahi et al., 2011 (15.4%) and Farhang-Pajuh et al., 2014 (27.90%). Approaching the prevalence of microscopic cysts in different tissue samples, our results showed the highest prevalence in esophageal muscles (95.37 %), followed by diaphragm (66 %) then, abdominal muscles (20 %). This significant difference may be attributed to activity of the tissue as the more active tissue the more blood supply and the more chance to exposure to infection. These results were nearly similar to that reported by Ali, 1985; Elsayed, 1985 (85%); El-Ganiny, 1989 (83 % in the esophagus and 65.3% in the diaphragm); Mahran, 2009 (46.96 % in esophagus); Arshad, et al. 2007 (24.7% in esophagus and 27% diaphragm); Ozkayhan, et al., 2006; Beyazit, et al., 2007 and Titilincu et al., 2008 (81.6% in esophagus, and 68.8% in diaphragm). On the other hand, our percentage is found disagreed with Imai et al., 1989 (17.1 % in esophagus and 25 % in diaphragm); Daryani et al., 2006 (31.3% in the abdominal wall, 22.4% in diaphragm and 0.23% in esophagus) and Al Quraishy et al., 2014 who reported that diaphragm showed the highest incidence rate than all organs except Najdy sheep in which esophagus has the highest rate. Concerning the prevalence of microscopic cysts, our results revealed that the microscopic cysts were detected in all tissue examined and in all ages with a high incidence rate (95.37 % in sheep over 2 years and 86.43 % in sheep less 87

Discussion than 2 years). This may be due to high contact with infected dogs as definitive hosts of Sarcocystis species more than felines. This result agreed with Ali, 1985 (61.41%); Basher, 2006 (84%); Mahran, 2009 (81.8%); Aly, 2012 (65.6%); Gut, 1982 (92%); O'Donoghue & ford, 1986 (93.2 %); Pomroy & Charleston, 1987 (92.1 %); Granstorm et al., 1993 (94.4 %); Woldemeskel & Gebreeab, 1996 (93.7 %); Al-Hoot et al., 2005 (79 %); Arshad et al., 2007 (100 %); Beyazit, et al., 2007 (86.5 %); Titilincu et al., 2008 (81.6%); Hosseini et al., 2012 ( 92%); Martínez-Navalón et al., 2012 (79%) and Dehaghi et al., 2013 (100%). On the other hand, the present results are found higher than that reported by Mohammed, 1996 (45.5%); Hassan, 2004 (10%); Savini et al., 1993 (9.8 %); Hinaidy and Egger 1994 (25.6 %); Ozkayhan et al., 2006 (47.32%) and Nematollahi et al., 2011 (32.5%), which may be attributed to the difference in ambient temperature and humidity in different countries (Savini et al., 1996). Concerning the prevalence of cysts in tissue samples in relation to different ages, our results revealed that sheep over 2 years had higher prevalence rate (esophagus 98.5%, diaphragm 76.5 % and abdominal muscles 22.23 %) than sheep less than 2 years (esophagus 86.43 %, diaphragm 60 % and abdominal muscles 0 %). This may be attributed to the time of exposure to infective stages as higher ages have more exposure time to infection than younger ones. These results is coincided with Mahran, 2009 (46.96 % in old and 30.56 % in young); Ozkayhan et al., 2006 (16.12 % in lambs and 59.25% in old sheep), and Beyazit, et al., 2007 (46 % in lambs and 100 % old sheep), while differed with El-Ganiny, 1989 (100% in old ages). With regard to seasonal dynamics, the prevalence of sarcocystosis among examined sheep is found to increase during Spring (93.10%) to reach its maximum during Summer season (96.95%), while decreased during Autumn (91.16%) to reach its lowest incidence during Winter (84.72%). 88

Discussion This difference in the seasonal prevalence may be attributed to the difference in ambient temperature and humidity between different seasons (Savini et al., 1996). These results are consistent with the results of El-Saieh, 1998 (infection had higher incidence in the summer 94.74%) and Aly, 2012 (high incidence occurred during summer and autumn). On the other hand, different seasonal dynamics were reported by Mohammed, 1996 as he reported that the infection increase in autumn, and Mahran, 2009 as he noted that infection reached peak in winter season. The cause of these differences in seasonal dynamics may be attributed to the difference of temperature in different geographical area which may affect sporocysts infectivity. Concerning the prevalence of infection among different sex of slaughtered sheep, our results revealed that females were highly infected (99 %) than males (94.55%), being agreed with Basher, 2006 (54.3% in females and 33.8% in males); Mahran, 2009 (54.86 % in females and 37.78 % in males); Daryani et al., 2006 and Farhang-Pajuh et al., 2014 (35 % in female and 7.63% in male). On the other hand, Dehaghi et al., 2013 recorded that there was no important difference between males and females. This difference may be explained as female animals in Egypt slaughtered mainly at old age, while males can be slaughter in young age so, time exposure to infective stages in females is longer than males resulting in higher incidence in females and as well as the immunity of females lower than that of males. Concerning the morphological features of the revealed Sarcocystis species, macroscopic cysts were ranged in size from 0.8 – 1 cm in length (mean 0.9 cm in length, n = 2). The cyst wall was thin and smooth ranged from 1.6 – 1.9 µm (mean 1.8 µm) and often surrounded by connective tissue as a secondary wall. This being in agreement with Odening, 1998, as he reported that a 89

Discussion connective tissue capsule, formed by the host, surrounds the cyst wall of S. gigantea obtained from sheep carcasses over than 2 years. These morphological parameters were found similar to that reported by Mundy and Obendorf, (1984 a) who described the immature Sarcocystis gigantea as the cyst wall was measured 1.5 - 2 µm in thickness. Immature cysts containing metrocytes only, while mature cysts containing both metrocytes and merozoites and had a secondary cyst wall). Also, Munday and Obendorf, 1984 b observed Sarcocystis gigantea as macroscopic full sized cysts measured 0.35 mm long at 8.5 months and gradually increased in size till 7.5 mm at 45 months; Dubey et al., 1989 a described Sarcocystis gigantea as filamentous, elongated, or globular. They stated that shape and size of sarcocysts are also dependent upon the type of host cell where the long, slender sarcocysts found in long, slender cells; Heckeroth and Tenter, 1998 measured Sarcocystis gigantea cysts as about 10 mm in diameter, with thin cyst wall lesser than 2µm in thickness and smooth, with secondary wall of connective tissue. Odening, 1998 described the Sarcocystis gigantea that consists of a cyst wall surrounds metrocyte or bradyzoite stages. He also mentioned that the cyst wall was thin and a connective tissue capsule, formed by the host externally surrounds the cyst wall). Al-Hoot et al., 2005 described Sarcocystis gigantea as macroscopic cysts usually enclosed by a secondary cystic wall. The cyst of the parasites had peripheral globular to spherical metrocytes containing central banana-shaped merozoites. Mahran, 2009 detected Sarcocystis gigantea cysts as ovoid cysts have thin primary cystic walls; Nematollahi et al., 2011 observed that the macroscopic cysts were oval in shape, measuring 1 to 3 mm in length with thin wall. Martínez-Navalón et al., 2012 noticed Sarcocystis gigantea as narrow, filament-shaped measuring 2 - 10 mm, found in striated muscles only.

90

Discussion Concerning the revealed microscopic cysts, length was ranged from 600 – 700 µm with thick cyst wall. Some cysts have thick wall with striation and others were thick smooth wall. This morphological pattern of recovered microscopic cysts agreed with Heckeroth and Tenter, 1998 who described the Sarcocystis tenella cysts as about 700 µm in diameter with thick wall, striated with villar protrusions; Mahran, 2009 described Sarcocystis tenella cysts in sheep with smooth thin walls, measuring 34.8 to 580 µ in length 1.6- 2.4 µ in the cyst wall thickness; Imai et al., 1989 described the cysts as long elliptical in shape with thin cystic having many protrusions and measuring about 290.9 x 76.95 µm and others with thick wall measured 2.3 to 2.8 µm in length. Al Quraishy et al., 2014 measured the Sarcocystis tenella cysts as 62.4 – 173.6 μm in length and 38.5 – 64.4 μm in width with a cyst wall measured 0.1 – 0.27 μm in thickness. Regarding the revealed species in the present study, two species of Sarcocystis were identified, the macroscopic cysts of Sarcocystis gigantea and the microscopic cysts of Sarcocystis tenella. Previous investigations recorded high prevalence of Sarcocystis gigantea and Sarcocystis tenella in sheep like El-Saieh, 1998 who identified the cysts isolated from sheep as S tenella, and S. gigantea; Mahran, 2009 detected Sarcocystis gigantea cysts as 9.9% While, Sarcocystis tenella cysts was 81.8%; Gut, 1982 found 92% of the samples infected with S. tenella and 37% of the samples infected with S. gigantea; O'Donoghue & ford, 1986 detected the incidence of S. gigantea as 6.7% of cysts in different tissues; Pomroy and Charleston, 1987 found that the prevalence was 92.1 % for S. tenella; Imai et al., 1989 reported S. tenella and S. gigantea in a field survey as 11.1% in Japan; Svobodova and Nevole, 1990 mentioned that the infection rate of Sarcocystis gigantea was 60.3%; Granstorm et al., 1993 mentioned that the incidence rate of S. tenella was 35.7% by grossly techniques and 94.4 % by using antibodies in 91

Discussion IFAT test Savini et al., 1993 found that the percent of infection of S. tenella was 9.8 %; Hinaidy and Egger, 1994 reported that the prevalence of Sarcocystis tenella was 25.6 % while prevalence of Sarcocystis gigantea was 2.4%; Woldemeskel and Gebreeab, 1996 noted that incidence rate of Sarcocystis tenella was 93.7 %; Heckeroth and Tenter, 1998 mentioned that Sarcocystis tenella cysts were found in all striated muscles, CNS, Purkinje fibers of sheep with high degree of pathogenicity; Al-Hoot et al., 2005 recorded Sarcocystis tenella as 79% and Sarcocystis gigantea as 13.5%; Yazicioğlu and Beyazit, 2005 reported S. tenella in all muscle samples from lambs; Ozkayhan et al., 2006 noted the incidence of Sarcocystis tenella was 47.32% while, Sarcocystis gigantea was observed only in every sheep over one year age; Arshad et al., 2007 recorded that the prevalence of Sarcocystis gigantea was 24.7% in esophagus and 27% in diaphragm. While, the Sarcocystis tenella was found in 100 % of the all organs; Beyazit, et al., 2007 recorded that S. gigantea were found in 24.5 % while S. tenella was 86.5 %; Titilincu et al., 2008 observed S. gigantea in esophagus only as 26.32% while Sarcocystis tenella had the highest prevalence in esophagus 81.6%, followed by heart 79.9% and diaphragm 68.8%; Da Silvaa et al., 2009 reported two cases of Sarcocystis tenella in sheep from Brazil; Hosseini et al., 2012 reported Sarcocystis gigantea as 4.3%, being the highest prevalence in the diaphragm in all age groups; Dehaghi et al., 2013 recorded that the prevalence of Sarcocystis gigantea in the esophagus was 6% and in diaphragm was 2.88%. While, the Sarcocystis tenella infection was found in 100% of the organs. Farhang-Pajuh et al., 2014 recorded Sarcocystis gigantean from in infected sheep. Moreover, one of the main objectives of the present study was to molecularly characterize the different Sarcocystis species infecting sheep in Egypt and to explain their phylogenetic status. Molecular identification, nucleotides and amino acids sequences` alignment,as well as haplotypes and 92

Discussion phylogenetic analysis for the revealed Sarcocystis species were carried out and based mainly on the nuclear 18S ribosomal RNA (18S rRNA) gene. This gene is widely used for discrimination among variable species of Sarcocystis (Shahbazi et al., 2013; Bahari, et al., 2014 & Baccia et al., 2016). Molecular characterization of sheep sarcocystosis was carried out in different countries (Tenter and Johnson, 1997 in Australia; Yang et al., 2001 in China; Dahlgren et al., 2008 in Norway; Bahari, et al., 2014 in Iran; Gjerde, 2014 in Norway and Kolenda, et al., 2015 in Poland). In Egypt, few studies were interested in studying the evolutionary relationship among different Sarcocystis species infecting animals and humans, although some reports were conducted on Sarcocystis species infecting buffaloes (El-Seify, et al., 2014 and Gjerde, et al., 2016). Herein, sheep Sarcocystis species were molecularly typed for the first time. A total of 40 macroscopic and microscopic cysts were recovered from the examined sheep tissues, their bradyzoites were harvested and subjected to PCR amplification. Unfortunately, 10 samples only (one macroscopic and nine microscopic cysts) were successfully amplified. Purified PCR product of each cyst was subjected to the gel electrophoresis resulting in 600 bp band length for all the tested cysts, which agreed with that reported by Bahari et al. (2014). Concerning species identification of the revealed sarcocysts, sequencing data of the present study were analyzed via BLAST® analysis (Basic Local Alignment Search Tool). Results showed that the only successfully amplified macroscopic cyst was typed as Sarcocystis gigantea, while all the nine microscopic cysts isolates were characterized as Sarcocystis tenella. These results are coincided with Tenter and Johnson, (1997); Yang et al., 2001; Dahlgren et al., (2008); Bahari, et al., (2014); Gjerde, (2013) and Kolenda, et al., (2015). 93

Discussion Approaching the alignment of S. gigantea revealed sequences; a haplotype was reported from that only successfully amplified macroscopic cyst. This haplotype was completely identical to partially amplified 18S rRNA sequences of S. gigantea from either Iran (KF489421) or Norway (KC209733) as as well as S. moulei from Iran (KF489432) and without any differences in the nucleotides sequence. S. moulei is a synonym for S. gigantea. These results are agreed with Tenter and Johnson (1997), Gjerde (2013) and Bahari et al. (2014). On the other hands, three haplotypes were evoked by alignment of the revealed nine partially amplified 18S rRNA sequences of S. tenella (microscopic cysts) with each other. These haplotypes were named as Haplotype (H) 1, 2 and 3. The difference was noted in three segregation sites. Regarding the first haplotype (H1), it has nucleotide G in position 13, nucleotide T in position 23 and nucleotide T in position 44. A number of S.tenella isolates on GenBank were completely identical to this haplotype. Those isolates were originated from Poland (KP263759, Kolenda, et al., 2015), Norway (KC209734, Gjerde, 2013), Malaysia (KR155230, KR155229, KR155222, KR155212, KR155209, KR155200, KR155199 and KR155192, Ng, et al., 2015), China (KX057996, Hu, et al., 2016), Canada (KF831291and KF831277, Gjerde, 2014). The second haplotype (H2) has nucleotides A, T and C in positions 13, 23 and 44, respectively. This haplotype was completely matched to KP263758, KP263754, KP263752, KX057996 and KF831291 which reported Poland, (Kolenda, et al., 2015), China (Hu, et al., 2016) and Canada (Gjerde, 2014). Finally, the last haplotype (H3) has G, C and A in the previously mentioned positions, respectively. This haplotype has 100 % identity to

94

Discussion KP263757, KP263756 and KP263755 which recorded from Poland, (Kolenda, et al., 2015), as well as KC209737 from Norway (Gjerde, 2013). In the present study, cluster analysis was carried out for 9 S. gigantea isolates including that of this study, and a total of 32 S. tenella isolates, of them nine isolates were originated from this study. Results of the haplotype distribution of this analysis were corroborated with the nucleotide alignment results. In addition, moderate (66.66%) and low (34.00%) haplotype diversities were noted for S. gigantea and S. tenella, respectively. Furthermore, low nucleotides diversities (0.001713 and 0.001780) were reported for these two species. It is well known that Sarcocystis species are host-specific protozons (Gjerde et al., 2016). Each species circulated between two hosts of them, one acts as a definitive and the other plays the intermediate host role. Only few species distracted from this fact, for example S. cruzi infecting cattle may sometimes utilizes buffaloes as intermediate hosts (Gjerde et al., 2016). Low nucleotide and haplotype diversities of Sarcocystis species infecting sheep may be explained by the strict circulation of these species between sheep and either cats or dogs for the macroscopic and microscopic cysts forming species, respectively giving limited chances for mutations resulted from transmission of the parasite among variable hosts. Moreover, negative values of the Taijma D neutrality index were reported for the two reveled species. The previous results are indicative for the population expansion of different Sarcocystis species infecting sheep which might be attributed to the heavily infection of both definitive and intermediate hosts (Dubey et al., 1989 a and Huong et al., 1995) and the worldwide circulation of the parasite through humans and animals' transportation (Dubey et al., 2015).

95

Discussion Previous reports illustrated the infection of sheep with four species of Sarcocystis: microscopic S. tenella and S. arieticanis are pathogenic, while macroscopic S. gigantea and S. medusiformis are non-pathogenic. The two pathogenic species may induce abortion during the early stage of infection if infected with high number of sporocysts and chronic disease (cyst formation) during the late phase of infection. Moreover, Diagnosis of sarcocystosis is based mainly on either inspection of the macroscopic cysts after the animal being slaughtered at abattoirs or detection of Sarcocystis-specific antibodies which are only genus-specific by the different immunological techniques (Heckeroth and Tenter, 1998). In the present study, amino acids translations for the revealed sequences were carried out for providing information about the antigenic nature of the revealed Sarcocystis species from sheep. In addition, it considered as a trial to develop a species specific immunological test for diagnosing this disease and thus limiting the economic losses. Data inferred from the phylogenetic analysis explained that S. miescheriana infecting pigs which use dogs as definitive hosts was clustered in a separate branch other than that including the different Sarcocystis species transmitted via both canids and felids. Kia, et al. (2011) illustrated the clustering of this species separately from those of felids but in the same clade comprised Sarcocystis species transmitted via humans (S. hominis in cattle) and canines (S. rangferi and S. tarandivulpes). Furthermore, results of the phylogenetic analysis of the present study are fully agreed with that of Gjerde, et al., (2016) which explained the clustering of Sarcocystis species which utilize either canids or felids each in a separate branch. Regarding Sarcocystis species isolates of the present study, S. gigantea was intermingled with variable globally reported S. gigantea isolates either from 96

Discussion Norway (Dahlgren et al., 2008, Gjerde, 2013 and Dahlgren and Gjerde, 2010), Iran (Bahari, et al., 2014) or Australia (Ellis et al., 1995 and Tenter and Johnson, 1997) and in the same felids transmitted Sarcocystis species clade. On the other hand, the three revealed S. tenella haplotypes were mixed with other S. tenella isolates from variable geographical regions in the canids transmitted Sarcocystis species clade. These results are agreed with that reported by Dahlgren, et al. (2007); Gjerde, (2013); Kolenda, et al., (2015); CaleroBernal et al., (2015) and Hu, et al. (2016). By looking carefully to the distribution of the three recorded S. tenella haplotypes of the present study in the phylogenetic tree, each haplotype was located nearer to a haplotype of S. tenella from variable countries, i. e. the first (H1), second (H2) and third (H3) haplotypes were clustered beside those from Poland, Norway and Iran, respectively. These results illustrated the population expansion of this species which confirmed previously by the negative value of Taijma D neutrality index.

97

Summary Summary Sarcocystis species is one of the most prevalent protozoal infections among domestic animals. A unique characteristic of sarcocystosis that it has a diheteroxenous life cycle shared between two different types of hosts. Carnivorous animals including dogs, cats and man serve as predator

or

definitive hosts while all herbivorous animals ( cattle, buffalo, sheep, goat, camel, pig, rat…..etc.) act as prey or intermediate hosts. Both intermediate and final hosts may harbor one or more Sarcocystis species, where this genus has more than 200 species. Few studies involved the infection of the Egyptian sheep with these protozoa. So, this study was conducted to investigate the prevalence and distribution patterns of different Sarcocystis species infecting sheep slaughtered at 3 Egyptian Provinces (Dakahlia, Damietta and Cairo), for detection of Sarcocystis infection using light microscopy in addition to molecular characterization of that parasites. Sheep is considered as a biological guide for the environmental pollution with different parasites because of their grazing habits and rearing patterns. Herein, we examined 540 slaughtered sheep of different ages and sexes (540 esophagi + 50 diaphragms + 10 abdominal muscles). Regular weekly visits were carried out to abattoirs during the period between July 2014 and June 2015. Visual inspections along with microscopic examination were used for detection of sarcocysts either macroscopic or microscopic. Small pieces of meat specimens were cut, compressed between two glass slides and examined under the dissecting microscope using X10 magnification. Fast 5 minutes 10% Geimsa solution immersion of the fresh samples was performed for better observation of the microscopic sarcocysts. Moreover, formalin-buffered preserved samples were subjected to histopathological examination. 98

Summary The results showed that the overall incidence of Sarcocystis species cysts was 95.37%, where 515 / 540 sheep were found to be infected. Microscopic cysts were prevalent at higher rate (95.37%) than macroscopic cysts (0.74%), as all infected sheep were harboring microscopic cysts, while mixed infection with both microscopic and macroscopic cysts was detected in 0.74% of the examined sheep, where only 4 sheep were infected with both types of cysts. Concerning tissue distribution of recovered cysts, all esophageal samples were infected (95.37%), followed by diaphragm (66%) then, abdominal muscles (20%). Moreover, macroscopic cysts were detected only in esophageal muscles of sheep over 2 years old group (1%). Mixed infection of both diaphragm and esophagus was 6.11% while mixed infection of esophagus, diaphragm and abdominal muscles was 0.37%, where 33 and 2 sheep were found to be infected out of 540 examined, respectively. Concerning the prevalence of the revealed sarcocysts in different ages, higher infection rate was recorded in sheep over 2 years old (98.5%) than that of sheep less than 2 years old (86.43%). Regarding to relation between animal sex and the infection rate, the results of the present study showed that females were more infected (99%) than males (94.55%). Approaching the seasonal dynamics of sheep sarcocystosis in the present study, incidences equal to or over than 90% were reported in all seasons of the year. The incidence was observed to be increased during Spring (93.10%) to reach its maximum during Summer (96.95%), then decreased in Autumn (91.16%) to reach its lowest rate during Winter (84.72%). Concerning the morphological features of the revealed sarcocysts, Macroscopic cysts ranged from 0.8 – 1 cm in length (mean 0.9 cm, n = 7). They

99

Summary appeared as dull white, oval shaped cysts resembling rice grain. The cyst wall was thin and smooth ranging from 1.6 – 1.9 µm (mean 1.8 µm) and often surrounded by connective tissue as a secondary wall. Microscopic cysts ranged from 600 – 700 µm (mean 630 µm, n = 12) in length. They were oval shaped and the cyst wall was thick, measured 1 – 3 µm (mean 2.7 µm, n = 12). Their walls appeared either smooth or striated, With respect of the PCR reaction, genomic DNA of 40 samples of the parasite was extracted using RT-PCR using oligonucleotide primers to amplify specific DNA fragments 600-bp of 18S ribosomal RNA. An oligonucleotide primers sequence was Sar-F1 Forward 5'GCACTTGATGAATTCTGGCA3' and Sar-R1 Reverse 5'CACCACCCATAGAATCAAG 3. The DNA fragments were separated on agarose gels electrophoresis. PCR products were purified for sequencing reaction. Purified RT-PCR products obtained from 10 bands derived from Sarcocystis species DNA were sequenced in the forward and reverse directions. Analysis of data was performing using BLAST 2.0 software were performed to establish sequence identity to Gen Bank accessions. The sequencing data revealed that Sarcocystis gigantea, genotyping of one tissue sample (sample1) was identical to accession numbers (KF489421 and KC209733 ) in gen bank. While Sarcocystis tenella, genotyping revealed three haplotype. The first haplotype was identical to accession numbers (KP263754, KP263752 and KP263758) in gen bank. While the second haplotype was identical to accession numbers (KP263759, KP263757 and KP263756) in gen bank but, the last haplotype was identical to accession numbers (KP263757 & KP263756) in gen bank.

100

References References Abbas, I. E. A. (2011): Studies on Sarcocystis species infecting Buffaloes in Dakahlia Province. Ph. D. Thesis, Fac. Vet. Med. Mansoura Univ. Al-Hoot, A. S.; Al-Qureishy, S. A.; Al-Rashid, K. and Bashtar, A. R. (2005): Microscopic study on Sarcocystis moulei from sheep and goats in Saudi Arabia. J. of the Egyptian Society of Parasitol., 35(1): 295 - 312.‫‏‬ Ali, G. A. T. (1985): Studies on sarcocystis of animals in Assuit Province. Ph. D. Theses Fac. Vet. Med. Assuit Univ. Alkappany, Y. M. A. (2011): Genetic diversity of viable Toxoplasma gondii isolated from cats in Egypt. Ph. D. Thesis, Fac. Vet. Med. Mansoura Univ. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W. and Lipmanl, D. J. (1990): Basic Local Alignment Search Tool. J. Mol. Biol. 215, 403- 410. Al Quraishy, S.; Morsy, K.; Bashtar, A. R.; Ghaffar, F. A. & Mehlhorn, H. (2014): Sarcocystis arieticanis (Apicomplexa: Sarcocystidae) infecting the heart muscles of the domestic sheep, Ovis aries (Artiodactyla: Bovidae), from KSA on the basis of light and electron microscopic data. Parasitol. Res., 113(10): 3823 - 3831. Aly, A. A. (2012): Prevalence of some Parasitic Infestation in Tissues of Animals Slaughtered in Qena Abattoirs, Egypt. Ph. D. Thesis Fac. Vet. Med. Assuit Univ. Arshad, M.; Dalimiasl, A. and Ghafarifar, F. (2007): Comparative study on Sarcocystis diagnosis in meat of slaughtered sheep in Tabriz.‫ ‏‬Animal and fishers Sci., 20 (2): 68 - 72.

101

References Atkinson, E. M. and Collins, G. H. (1981): Electrophoretic studies on three enzymes from Sarcocystis species in sheep. Sys. Parasitol., 2 (3): 213 216. Bahari, P.; Salehi, M.; Seyedabadi, M. and Mohammadi, A. (2014): Molecular Identification of Macroscopic and Microscopic Cysts of Sarcocystis in Sheep in North Khorasan Province, Iran. J. of Molec. and Cellul. Med., 3(1): 51- 56. Bancroft, J. D. and Stevens, A. (1996): Theory and practice of histological technique. 4th Ed. Churchill, Livingston, Edinburgh, London, Melbourne and New York. Barta, J. R.; Martin, D. S.; Carreno, R. A.; Siddall, M. E.; ProfousJuchelkat, H.; Hozza, M.; Powles, M. A. and Sundermann, C. (2001): Molicular phylogeny of the other tissue coccidian: Lankesterella and Caryospora. J. Parasitol., 87: 121 - 127. Baccia, C.; Vismarraa, A.; Passeria, B.; Sciarroneb, F.; Mangiaa, C.; Genchic, M.; Fabbic, M.; Vicaric, N.; Bruinia , I.; Brindania, F. and Kramera, L. (2016): Detection of Toxoplasma gondii and Sarcocystis tenella in indigenous Cornigliese sheep in Italy using serological and molecular methods. Small Rum. Res., 135: 13 - 16. Basher, M. E. M. (2006): Isometric folding and variation of immersions of manifolds. M. V. Sc. Thesis Fac. Vet. Med. Suze Canal Univ. Beyazit, A.; Yazicioglu, O. and Karear, Z. (2007): The prevalence of ovine Sarcocystis species in Izmir province. Ankara Univ. Vet. Fac. Derg, 54: 111- 116. Calero-Bernal, R.; Verma, S. K.; Cerqueira-Cézar, C. K.; Schafer, L. M.; Van Wilpe, E. and Dubey, J. P. (2015): Sarcocystis mehlhorni, n. 102

References sp.(Apicomplexa: Sarcocystidae) from the black-tailed deer (Odocoileus hemionus columbianus). Parasitol. Res., 114(12): 4397- 4403.‫‏‬ Cawthorn, R.; Reduker, D. W.; Speer, C. A. and Dubey, J. P. (1986): In vitro excystation of Sarcocystis capricanis, Sarcocystis cruzi and sarcocystis tenella (Apicomplexa). J. Parasitol., 72: 880 - 884. Cheadle, M.A.; Dame, J.B. and Greiner, E. C. (2001): Sporocyst size of isolates of Sarcocystis shed by the Virginia opossum (Didelphis virginiana). Vet. Parasitol. 95, 305- 311. Clark, A. G. and Lanigan, C. M. S. (1993): Prospects for estimating nucleotide divergence with RAPDs. Molec. Biol. and Evolu. J., 10: 1096 -1111. Collins, G. H. (1981): Sarcocystis and the meat industry. Bibliography p. 13 14. Collins, G. H., Charleston, W. A. G. and Wiens, B. G. (1980): Studies on Sarcocystis species. VI. A comparison of three methods for the detection of Sarcocystis species in muscle. N. Z. Vet. J., 28(9): 173 - 179. Da Silva, R.C.; Sub, C. and Langoni, H. (2009): First identification of Sarcocystis tenella (Railliet, 1886) Moulé, 1886 (Protozoa: Apicomplexa) by PCR in naturally infected sheep from Brazil. Vet. Parasitol., 165: 332– 336. Dahlgren, S. S. and Gjerde, B. (2010): Molecular characterization of five Sarcocystis species in red deer (Cervus elaphus), including Sarcocystis hjorti n. sp., reveals that these species are not intermediate host specific. Parasitol., 137(5): 815 - 840.

103

References Dahlgren, S. S.; Gjerde, B.; Skirnisson, K. & Gudmundsdottir, B. (2007): Morphological and molecular identification of three species of Sarcocystis in reindeer (Rangifer tarandus tarandus) in Iceland. Vet. Parasitol., 149(3): 191-198.‫‏‬ Dahlgren, S. S.; Gouveia-Oliveira, R. and Gjerde, B. (2008): Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences. Vet. Parasitol., 151(1): 27 - 35. Daryani, A.; Alaei, R.; Dehghan, M. H.; Arab, R.; Sharif, M., and Ziaei, H. (2006): Survey of Sarcocystis infection in slaughtered sheep and buffaloes in Ardabil, Iran. J. of Anim. and Vet. Advan., 5: 60 – 62.‫‏‬ Dehaghi, M. M.; Fallahi, M.; Sami, M., and Radfar, M. H. (2013): Survey of Sarcocystis infection in slaughtered sheep in Kerman Abattoir, Kerman, Iran. Comparative Clinical Pathol., 22(3): 343 - 346.‫‏‬ Dubey, J. P. (1976): A review of Sarcocystis of domestic animals and of other coccidia of cats and dogs. J. Am. Vet. Med. Assoc. 169 (10): 1061-1078. Dubey, J. P. and Odening, K. (2001): Tissue‐Inhabiting Protozoans: Toxoplasmosis and Related Infections. Parasitic Diseases of Wild Mammals (2 nd Eds.), Iowa State University Press, Ames, pp. 478 - 511. Dubey, J. P.; Speer, C. A.; Callis, G. and Blixt J. A. (1982): Development of the sheep–canid cycle of Sarcocystis tenella. Canada J. Zool., 60: 2464 2477. Dubey, J. P.; Speer, C. A. and Fayer, R. (1989 a): Sarcocystosis of animals and man. CRC Press Inc, Boca Raton, Florida.

104

References Dubey, J. P.; Speer, C. A.; Munday, B.L. and Lipscomb, T.P. (1989 b): Ovine sporozoan encephalomyelitis linked to Sarcocystis infection. Vet. Parasitol., 34: 159-163. Dubey, J. P.; Calero-Bernal, R.; Rosenthal, B. M.; Speer, C. A. and Fayer, R. (2015): Sarcocystosis of animals and humans. CRC press. Boca Raton, Florida. ELbader, A. E. R. M.; Osman, F. A. & Hussien, S. M. (2014): Studies on Sarcocystis in sheep and goats using serological survey in New Valley governorate. Egypt. International J. for Agro Vet. and Med. Sci., 8(5): 150 -153. El-Dakhly, K. M.; El-Nesr, K. A.; El-Nahass, E.; Hirata, A.; Sakai, H. and Yanai, T. (2011): Prevalence and distribution patterens of Sarcocystis species in buffaloes in Beni-Suef, Egypt. Trop. Anim. Health and Produc., Epub a head of print. El-Ganiny, S. S. I. (1989): Studies on Sarcocystis Infection in Buffalo Cattle Sheep and Goat at El-Minia Province. M. Sc. Thesis Fac. of Sci. Minia Univ. El-Saieh, A. F. A. (1998): Incidence of toxoplasma and sarcosporida in slaughtered animals in Qena Governorate. Ph. D. Theses Fac. Vet. Med. Assuit Univ. El-Seify, M.; El-Morsey, A.; Hilali, M.; Zayed, A.; El-Dakhly, K.; Haridy, M.; Sakai, H. and Yanai, T. (2014): Molecular characterization of Sarcocytis fusiformis and Sarcocystis buffalonis infecting water buffaloes (Bubalus bubalis) from Egypt. Am. J. Anim. Vet. Sci. 9: 95- 104.

105

References Ellis, T. J. and Morrison, D. (1995): Effect of sequence alignment on the phylogeny of Sarcocystis deduced 18S rDNA sequences. Parasitol. Res., 81: 696 - 699. Ellis, T. J.; Luton, K.; Baverstock, P. R.; Brindaley, P. J.; Nimmo, K. A. and Johnson, A. M.(1994): The phylogeny of Neospora caninum. Mol. Biochem. Parasitol., 64: 303 - 311. Ellis, T. J.; Luton, K.; Baverstock, P. R.; Whiteworth, G.; Tenter, A. M. and Johnson, A. M. (1995): Phylogenitic relationships between Toxoplasma and Sarcocystis deduce from a comparison of 18S r DNA sequences. J. Parasitol., 110 (5): 521 - 528. Elsayed, M. E. A. (1985): Light and Electron Microscope Studies on Sarcocystis Species Infecting Goats and Sheep at Aswan Erea (Upper Egyp). Ph. D. Thesis Aswan Fac. of Sci. Assiut Univ. Farhang-Pajuh, F.; Yakhchali, M. and Mardani, K. (2014): Molecular determination of abundance of infection with Sarcocystis species in slaughtered sheep of Urmia, Iran. Vet. Res. forum: an International quarterly J., 5(3): 181 – 187. Farooqui, A. A.; Adams, D.D.; Hanson, W. L. and Prestwood, A. K. (1987): Studies on the enzymes of Sarcocystis suicanis: Purification and characterization of an acid phosphatase. J. Parasitol., 73: 681- 688. Fayer, R. (1972): Gametogony of Sarcocystis species in cell culture. Sci., 175: 65 - 67. Fayer, R. (1979): Multiplication of Sarcocystis bovicanis in the bovine bloodstream. J. Parasitol., 65: 980 - 982.

106

References Frenkel, J. and Smith, D. (2003): Determination of the genera of cyst-forming coccidian. Parasitol. Res., 91:384 - 389. Fukuyo, M.; Battsetseg, G. and Byambaa, B. (2002): Prevalence of Sarcocystis infection in meat-producing animals in Mongolia. Southeast Asian J. of Trop. Med. and Public health, 33(3): 490 - 495.‫‏‬ Gjerde, B. (2013): Phylogenetic relationships among Sarcocystis species in cervids, cattle and sheep inferred from the mitochondrial cytochrome oxidase subunit I gene. International J. for Parasitol., 43: 579 - 591. Gjerde, B. (2014): Morphological and molecular characteristics of four Sarcocystis spp. in Canadian moose (Alces alces), including Sarcocystis taeniata n. sp. Parasitol. Res., 113(4): 1591-1604. Gjerde, B.; Hilali, M. and Abbas, I. E. (2016): Molecular differentiation of Sarcocystis buffalonis and Sarcocystis levinei in water buffaloes (Bubalus bubalis) from Sarcocystis hirsuta and Sarcocystis cruzi in cattle (Bos taurus). Parasitol. Res., 115 (6): 2459 - 2471. Gjerde, B.; Hilali, M. and Mawgood, S. A. (2015): Molecular characterisation of three regions of the nuclear ribosomal DNA unit and the mitochondrial cox1 gene of Sarcocystis fusiformis from water buffaloes (Bubalus bubalis) in Egypt. Parasitol. Res., 114(9): 3401- 3413. Granstorm D. E.; Dubey, J. P.; Davis, S.W.; Fayer, R.; Fox, J. C.; Poonacha, K. R.; Giles, R. C. and Comer, P. F.(1993): Equine protozoal myeloencephalitis: antigen analysis of cultured Sarcocystis neurona merozoites. J. Vet. Diagn. Invest., 5: 88 - 90. Gut, J. (1982): Effectiveness of methods used for the detection of Sarcosporidiosis in farm animals. Folia Parasitol. (Praha), 29: 189 - 295.

107

References Hamidinejat, H.; Moetamedi, H.; Alborzi A. and Hatami A. (2014): Molecular detection of Sarcocystis species in slaughtered sheep by PCR– RFLP from south-western of Iran. J. Parasit Dis, 38(2):233 - 237. Hassan, G. H. A. (2004): Parasitic Agents as Predisposing Cause of Abortion in Farm Animals. M. V. Sc. Thesis Fac. Vet. Med. Cairo Univ. Hassanien, F. S. (1992): Incidence of protozoa among slaughtered animals in kalybia governorate with special reference to toxoplasmosis. Ph. D. thesis. Fac. Vet. Med. Banha Univ. Haziroglu, R.; Guvenc, T. and Tunca, R. (2002): Electron microscopical studies on cysts of Sarcocystis arieticanis within cardiac muscle of naturally infected sheep. Parasitol. Res., 89(1): 23 – 25. Heckeroth, A. R. and Tenter, A. M. (1998): Comparison of Immunological and Molecular Methods for the Diagnosis of Infections with Pathogenic Sarcocystis species in Sheep. Tokai J. Exp. Clinic. Med., 23 (6): 293- 302. Henderson, J. M.; Dies, K. H.; Haines, D. M.; Higgs, G. W. and Ayroud, M. (1997): Neurological symptoms associated with sarcocystosis in adult sheep. Canada Vet. J., 38: 168-170. Herbert, I. V. and Smith, T. S. (1987): Sarcocystosis. Parasitol. Today, 3: 16 - 21. Heydron,

A. O., Gestrich, R., Mehlhorn, H. and Rommel, M. (1975):

Proposal for a new nomenclature of Sarcosporidia. Z. Parasitenkd., 48: 7382. Hinaidy, H. K. and Egger, A. (1994): Die Sarkosporidien des scafesin Österreich. J. Vet. Med., 41 (2): 417 - 427.

108

References Hosseini, S. R.; Shakerian, A. and Tahamtan, N. (2012): Survey of Sarcocystis Infection in Slaughtered Sheep in Isfahan, Qom and ShahreKord, Iran. J. of Anim. and Vet. Adv., 11(15): 2683 - 2686. Hu, J. J.; Wen, T.; Chen, X. W.; Liu, T. T.; Esch, G. W. and Huang, S. (2016): Prevalance, Morphology, and Molecular Characterization of Sarcocystis heydorni Sarcocysts from Cattle (Bos Taurus) in China. J. Parasitol, 102(5): 545 - 548.‫‏‬ Huong, L. T. T. (1999): Prevalence of Sarcocystis spp. in water buffaloes in Vietnam. Vet. Parasitol., 86 (1): 33- 39. Huong L. T. T., Dubey, J. P. and Uggla, A. (1995): Prevalence and identity of Sarcocystis in water buffaloes and cattle slaughtered at some abattoirs in Ho Chi Minh City. Proc. 1st Conf. Vet. Med. Anim. Husb., Univ. of agricul. and Forersty, Ho Chi Minh City, Vietnam, I: 88- 97. Imai, Y.; Inoue, I. and Yamada, M. (1989): Sarcocystis tenella from the sheep in Japan (Protozoa, apicomplexa). The Japn. J. of Vet. Sci., 51(4): 815 817.‫‏‬ Jacobs, L.; Remington, J. S. and Melton, M. L. (1960): A survey of meat samples from swine, cattle and sheep for the presence of encysted Toxoplasma J. of Parasitol., 46: 23 - 28. Kia, E. B.; Mirhendi, H.; Rezaeian, M.; Zahabiun, F. and Sharbatkhori, M. (2011): First molecular identification of Sarcocystis miescheriana (Protozoa, Apicomplexa) from wild boar (Sus scrofa) in Iran. Exper. Parasitol., 127(3): 724 - 726. Kojouri, G. A.; Aghajani, E.; Jahanabadi, S. and Kojouri, A. (2011): Mineral status of myocardial Sarcocystosis. Iranian J. of Parasitol., 6(2): 17 - 22. 109

References Kolenda, R.; Schierack, P.; Zieba, F.; Zwijacz-Kozica, T. and Bednarski, M. (2015): First molecular characterization of Sarcocystis tenella in Tatra chamois (Rupicapra rupicapra tatrica) in Poland. Parasitol. Res, 114(10): 3885 - 3892.‫‏‬ Levine, N. D. (1986): The taxonomy of Sarcocystis (Protozoa, Apicomplexa) species. J. of Parasitol., 72: 372 - 382. Levine, N. D. and Tadros, W. (1980): Named species and hosts of Sarcocystis (Protozoa: Apicomplexa: Sarcocystidae). Syst. Parasitol., 2: 41- 59. Lindsay, D. S.; Blagburn, B. L. and Braund, K. G. (1995): Sarcocystis spp. and sarcocystosis. Bacteriol. Analyt. Manual, 5: 249 – 254. Mahran, O. M. (2009): Sarcocystis infection in sheep and goats slaughtered in Shalatin Abattoir, Red Sea Governorate, Egypt. Assiut Vet. Med. J., 55(121): 341- 355. Martínez-Navalón, B.; Anastasio-Giner, B.; Cano-Fructuoso, M.; SanchezMartínez, P.; Llopis-Morant, A.; Perez-Castarlenas, B. & de Larrea, E. B. F. (2012): Short communication. Sarcocystis infection: a major cause of carcass condemnation in adult sheep in Spain. Spanish J. of Agricul. Res., 10(2): 388 - 392.‫‏‬ Mehlhorn, H. and Heydorn, A. O. (1978): The Sarcosporidia (Protozoa, Sporozoa): life cycle and fine structure. Advan. in Parasitol. Academic Press: 43- 91. Mehlhorn, H., Hartley, W. J. and Heydron, A. O. (1976): A comparative ultrastructural study on the cyst wall of 13 Sarcocystis species. Protistologica 12: 451- 467.

110

References Miescher, F. (1843): Über eigenthümliche Schläuche in den Muskeln einer Hausmaus.

Bericht

der

Verhandlungen

der

Naturforschenden

Gesellschaft, 5: 198 – 202. Miller, I. (1993): On the occurrence of the cattle sarcocystosis in different regions of Estonia. Biologija 1: 34 - 35. Mohamed, A. S. H. (1979) : Morpho-biological studies on sarcocystis in sheep. M. V. Sc. Thesis . Fac. Vet. Med. Cairo Univ. Mohammed, M. S. (1996): Muscular Parasites in Slaughtered Animals in Assiut Governorate. Ph. D. Thesis Fac. Vet. Med. Assuit Univ. Moréa, G.; Maksimovc, A.;

Conrathsc, F. J. and Scharesc, G. (2016)

Molecular identification of Sarcocystis spp. in foxes (Vulpes vulpes) and raccoon dogs ( Nyctereutes procyonoides) from Germany. Vet. Parasitol., 220: 9 - 14. Morgan, G.; Terlecki, S. and Bradley, R. (1984):

A Suspected case of

sarcocysts encephalitis in sheep. Br. Vet. 140 (1): 64 - 69. Mostafa, N. Y. and Yasein, S. A. (2010): Quality of buffaloe`s meat infected with sarcocysts. Global Vet, 4 (4): 331- 336. Munday, B. L. and Obendorf , D. L. (1984 a) Morphology of Sarcocystis gigantea in experimentally- infected sheep. Vet. Parasitol., 16 : 193 - 199. Munday, B. L. and Obendorf , D. L. (1984 b) Development and growth of Sarcocystis gigantia in experimentally- infected sheep. Vet. Parasitol., 15 : 203 - 211. Nakao, M.; Lavikainen, A.; Iwaki, T.; Haukisalmi, V.; Konyaev, S.; Oku, Y. and Ito, A. (2013): Molecular phylogeny of the genus Taenia (Cestoda: Taeniidae): proposals for the resurrection of Hydatigera Lamarck, 1816

111

References and the creation of a new genus Versteria. International J. for Parasitol., 43(6), 427- 437. Nematollahi, A.; Ashrafi-Helan, J.; Haghi, A. and Yousefkhani, M. (2011): Determination of prevalence of Sarcocystis spp. by using gross examination, impression smear and digestion methods in muscles of slaughtered sheep in the old slaughterhouse of Tabriz, North of Iran. International Congress of Mediterannean Federation of Health and Production of Ruminants, Belgrade, 19: 25 - 28. Ng, Y. H.; Fong, M. Y.; Subramaniam, V.; Shahari, S. and Lau, Y. L. (2015): Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA. Res. Vet. Sci., 103: 201204. O'Donoghue, P. J. and Ford, G.E. (1984): The asexual pre-cyst development of Sarcocystis tenella in experimentally infected specific- pathogen-free lambs. Int. J. Parasitol., 14: 345 - 355. O'Donoghue, P. J. and Ford, G. E. (1986): The prevalence and intensity of Sarcocystis spp. infection in sheep. Aust. Vet. J., 63: 273 - 278. O'Donoghue, P. and Rommel, M. (1992): Australian-German collaborative studies on the immunology of Sarcocystis infections. Angew Parasitol., 33:102-119. Odening, K. (1998): The present state of species-systematics in Sarcocystis Lankester, 1882 (Protista, Sporozoa, Coccidia). Syst. Parasitol., 41: 209 – 233. Ozkayhan, M. A.; Karaer, Z.; Ilkme, A. N. and Atmaca, H. T. (2006): The prevalence of Sarcocystis species in sheep slaughtered in municipality

112

References slaughterhouse in Kirikkale. Turkiye parazitolojii dergisi, 31(4): 272 276.‫‏‬ Paikari, H. A.; Dalimi, A. A. H.; Esmaeilzadeh, M.; Valizadeh, M.; Karimi, G. R.; Motamedi, G. R. and Abdi, G. M. (2008): Identification of Sarcocystis species of slaughtered sheep in Gazvin Ziaran slaughterhouse using PCR-RFLP. Modares J. of Med. Sci. (Pathobiol.) , 11 (2): 65 - 72. Pescador, C. A.; Corbellini, L. G.; De Oliveira, E. C.; Bandarra, P.M.; Leal, J.S.; Pedroso, P. M .O. and Driemeier, D. (2007): Aborto ovino associado com infecção por Sarcocystis sp. Pesq. Vet. Bras., 27: 393 397. Pomroy, W. E. and Charleston, W. A. G. (1987): Prevalence of dog-derived Sarcocystis spp. in New Zealand lambs. N. Z. Vet. J., 35: 141 - 142. Prakas, P.; Liaugaudaitė, S.; Kutkienė, L.; Sruoga, A. and Švažas, S. (2015): Molecular identification of Sarcocystis rileyi sporocysts in red foxes (Vulpes vulpes) and raccoon dogs (Nyctereutes procyonoides) in Lithuania. Parasitol. Res., 114(5): 1671- 1676. Rommel, M.; Heydron, A. O. and Gruber, F. (1972): Contribution on the life cycle of Sarcocporidia I. the sporocyst of Sarcocystis tenella in the feces of the cat. Berl. Munich. Tierztl. Wochenscher, 85: 101-105. Salehi, M.; Bahari, P. and Vatanchian, M. (2014): First Molecular Identification of Sarcocystis ovicanis (Protozoa, Apicomplexa) in the Brain of Sheep in Iran. Iranian J. of Parasitol., 9 (2): 286 - 296. Sambrook, J.; Fritscgh, E. F. and Mentiates (1989): Molecular cloning. A laboratory manual. Vol. I., Cold spring Harbor Laboratotry press, New York.

113

References Savini, G.; Dunsmore, J. D.; Robertson, I. D. and Seneviratna, P. (1993): Sarcocystis spp. in Western Australian sheep. Aust. Vet. Med. J., 70: 152 - 154. Savini, G.; Robertson, I. D. and Dunsmore, J. D. (1996): Viability of sporocysts of Sarcocystis cruzi after exposure to different temperatures and relative humidities. Vet. Parasitol., 67: 153-160. Shahbazi, A.; Asfaram, S.; Fallah, E.; Khanmohammadi, M.; Nematollahi, A., and Moharami, T. (2013): Identification of Sarcocystis tenella and Sarcocystis arieticanis isolated from slaughtered sheep in Tabriz abattoir using parasitological and pcr-rflp methods.‫ ‏‬J. of Comp. Pathobiol. Iran., 10 (2): 959 - 964. Svobodova, V. and Nevole, M. (1990): Use the muscle digestion methods and indirect immunofluorescence reaction in the diagnosis of Sarcocystosis in sheep. Acta. Vet. Brno, 59: 157 - 170. Tasara, T.; Schumacher, S. and Sephan, R. (2005): Conventional and RealTime PCR–Based Approaches for Molecular Detection and Quantitation of Bovine Species Material in Edible Gelatin. J. of Food Protection, 68 (11): 2420 - 2426. Thompson, J. D.; Higgins, D. G. and Gibson, T. J. (1994): Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22(22): 4673 - 4680. Tenter, A. M. (1995): Current research on Sarcocystis species of domestic animals. International J. for Parasitol., 25: 1311-1330. Tenter, A. M. and Johnson, A. M. (1997): Phylogeny of the tissue cystforming coccidia. Advan. in Parasitol., 39: 69 - 139. 114

References Tenter, A. M.; Baverstock, P. R. and Johanson, A. M. (1992 a): Comparison of in vitro translation products of Sarcocystis gigantea and Sarcocystis tenella. Int. J. Parasitol., 22: 153 - 164. Tenter, A. M.; Baverstock, P. R. and Johnson, A. M. (1992 b): Phylogenetic relationships of Sarcocystis species from sheep, goats, cattle and mice based on ribosomal RNA sequences. Int. J. Parasitol., 22(4): 503 - 513. Titilincu, A.; Mircean, V.; Blaga, R.; Bratu, C. N. and Cozma, V. (2008): Epidemiology and etiology in sheep sarcocystosis. Bulletin of Univ. of Agricul. Sci. and Vet. Med. Cluj-Napoca., 65(2): 49 - 54. Uggla, A. and Buxton, D. (1990): Immune responses against Toxoplasma and Sarcocystis infections in ruminants diagnosis and prospects for vaccination. Rev. Sci. Tech, 9: 441- 462. Welsh, J. and McClelland, M. (1990): Fingerprinting genomes using PCR with arbitrary primers. Nucl. Acids Res., 18: 7213 - 7218. WHO (2002): World Health organization. Department of communicable diseases surveillance and response. Williams, J. G. K.; Hanafey, M. K.; Rafalski, J. A. and Tingey, S. V. (1993): Genetic analysis using random amplified polymorphic DNA markers. Methods in Enzymol., 218: 704 – 740. Williams, J. G. K.; Kubelik, A. R.; Livak, K. J.; Rafalski, J. A. and Tingey, S. V. (1990): DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucl. Acids Res. 18, 6531- 6535. Woldemeskel, M. and Gebreeab, F. (1996): Prevalence of Sarcocystis in livestock of northwest Ethiopia. Zentralbl. Vet., 43 (2): 55 - 58.

115

References Yan, W.; Qian, W., Li, X.; Wang, T.; Ding, K. and Huang, T. (2013): Morphological

and

molecular

characterization

of

Sarcocystis

miescheriana from pigs in the central region of China. Parasitol. Res., 112(3): 975 - 980. Yang, Z. Q.; Zuo, Y. X.; Yao, Y. G.; Chen, X. W.; Yang, G. C. and Zhang, Y. P. (2001): Analysis of the 18S rRNA genes of Sarcocystis species suggests that the morphologically similar organisms from cattle and water buffalo should be considered the same species. Molecular and Biochem. Parasitol., 115: 283 - 288. Yazicioğlu, Ö. and Beyazit A. (2005): Encephalomyelitis associated with a Sarcocystis-like protozoan in a ten-month-old ewe lamb. Türkiye J. Vet. Anim. Sci., 29 (5): 1209 - 1212.

116

‫الملخص العربي‬ ‫الملخص العربي‬ ‫" إستخدام البيولوجيا الجزيئيه في تصنيف أنواع المتكيسات العضلية التي تصيب األغنام "‬ ‫تشمل شعبة ذوات القمة المركبة عددًا كبيرًا من الطفيليات األولية عالمية االنتشار ‪ ،‬وهي‬ ‫طفيليات إجبارية تسبب أمراضًا تعرف باسم أمراض الكوكسيديا لإلنسان وحيواناته المنزلية مما يؤدي إلى‬ ‫كثير من الخسائر االقتصادية الطبية والبيطرية‪ .‬ومن هذه األجناس طفيل المتكيسات العضلية ‪ ،‬ويعتبر‬ ‫جنس المتكيسات العضلية من الطفيليات التي تسبب أمراضًا مزمنة للعوائل التي تصيبها مثل األبقار‬ ‫واألغنام والماعز‪ ،‬وكذلك الحيوانات البرية مسببة خسائر اقتصادية كبيرة‪ ،‬وحتى اآلن تم وصف أكثر من‬ ‫‪ 022‬نوع من طفيل المتكيسات العضلية التي تصيب العوائل المختلفة‪.‬‬ ‫تعتبر المتكيسات العضلية من أكثر الطفيليات األولية انتشارا في الحيوانات‪ ،‬ومنها االغنام‬ ‫موضوع الدراسة‪ .‬كما أن الدراسات التي أجريت على المتكيسات العضلية التي تصيب االغنام في مصر‬ ‫قليلة جدا‪ ،‬ولذلك تم إجراء هذه الدراسة لتحديد مدى انتشار األنواع المختلفة من هذه الطفيليات في االغنام‬ ‫المذبوحة بمحافظة الدقهلية ودمياط والقاهرة‪ ،‬بمصر‪ .‬وكذلك إجراء دراسات مورفولوجية باستخدام‬ ‫الميكروسكوب الضوئي باالضافة الى التوصيف الجزيئي لتلك الطفيليات‪.‬‬ ‫وتم فحص عدد ‪ 042‬من ذبائح االغنام التي ذبحت بمجازرالمحافظات الثالثة في الفترة ما بين‬ ‫يوليو ‪ 0204‬ويونيو ‪ ،0200‬حيث قسمت الحيوانات المذبوحة إلى مجموعتين عمريتين‪ ،‬األولى اقل من‬ ‫سنتان وكان عددها ‪ 042‬حيوان والثانية أكثر من سنتان وتتكون من ‪ 422‬حيوان‪.‬‬ ‫وقد تم فحص أنسجة كل من المريء‪ ،‬الحجاب الحاجز وعضالت من البطن لكل حيوان على حده‪.‬‬ ‫وكان تحديد المتكيسات العضلية الظاهرة للعين يعتمد على فحص األنسجة بالعين المجردة‪ ،‬بينما تم‬ ‫استخدام طريقة ضغط العضالت وصبغها بصبغة الجمسا لتحديد المتكيسات العضلية المجهرية‪ .‬ثم بعد‬ ‫ذلك تم توصيف العينات االيجابية باستخدام البيولوجيا الجزيئية التي تشمل تفاعل البلمرة المتسلسل‬ ‫(‪ (PCR‬و تتابع النيوكليتيدات في االحماض النووية لهذة الطفيليات )‪. ( Sequencing‬‬ ‫ووجد أن إصابة االغنام محل الدراسة بالمتكيسات العضلية الظاهرة في االنسةجة ككةل ‪% 70.59‬‬ ‫حيث وجد ‪ 000‬حيوان مصاب‪ ،‬وقد لوحظ ان االغنام المصابة كان جميعهةا مصةاب بالمتكيسةات العضةلية‬ ‫المجهرية (‪ ،)% 70.59‬بينما كانت نسبة االصابة بالمتكيسةات العضةلية التةي تةرى بةالعين المجةردة ‪2.94‬‬ ‫‪ ،%‬حيث وجد كال النوعين من المتكيسات العضلية في اربعة حيوانةات فقةط مةن ‪ 042‬حيةوان تةم فحصةهم‬ ‫(‪.)% 2.94‬‬ ‫‪1‬‬

‫الملخص العربي‬ ‫وبفحص االنسجة المختلفة لالغنام وجد ان نسبة المتكيسةات العضةلية المجهريةة كانةت ‪% 70.59‬‬ ‫في المرئ و ‪ % 66‬في الحجاب الحاجز و ‪ % 02‬في العضةالت البطنيةة‪ ،‬بينمةا المتكيسةات العضةلية التةي‬ ‫تري بالعين المجردة كانت في مرئ االغنام الكبيرة فقط (‪.)% 0‬‬ ‫اما بالنسبة النتشار الطفيل في االعمار المختلفة‪ ،‬فقد لوحظ ان نسبة االصابة في االعمار اكبر مةن‬ ‫سنتين (‪ )% 7..0‬كانت اكبر من نسبة االصابة في االغنةام اقةل مةن سةنتين (‪ ،)% .6.45‬وبدراسةة تةاثير‬ ‫الجنس على نسبة االصابة فقد وجد ان االناث (‪ )% 77‬اكثر اصابة من الذكور (‪.)% 74.00‬‬ ‫وبدراسة تباين االصةابة الموسةمية فقةد وجةد ان نسةبة االصةابة بةدات فةي الزيةادة فةي فصةل الربيةع‬ ‫(‪ )% 75.02‬لتصل الى اعلى معدل لها في فصل الصيف (‪ ،)% 76.70‬ثةم بةدات فةي النقصةان فةي فصةل‬ ‫الخريف (‪ )% 70.06‬لتصل الي ادنى نسبة لها في فصل الشتاء (‪.)% .4.90‬‬ ‫وقد وجد أن االغنام المذبوحةة موضةع الدراسةة مصةابة بنةوعين مةن أوليةات المتكيسةات العضةلية‪،‬‬ ‫احدهم يرى بالعين المجةردة ( ساركوسيسةتس جايجانتيةا ) بينمةا االخةر مجهةري (ساركوسيسةتس تينةيال) ‪،‬‬ ‫وقد تم التوصيف الظاهري لهما تحت الميكرسكوب الضوئي فوجد حويصةلة ساركوسيسةت جايجانتيةا ‪2.7‬‬ ‫سم في الطول بيضاء اللون بيضاوية الشكل وتتميز بجدار رفيع سمكة ‪ 0..‬ميكروميتر ويحاط بنسيج ضام‬ ‫كجدار ثانوي‪ ،‬بينما ساركوسيست تينيال ‪ 652‬ميكةرون فةي الطةول بيضةاوية الشةكل وتتميةز بجةدار سةميك‬ ‫سمكة ‪ 0.9‬ميكروميتر وكان هذا الجدار محزز في بعض الحويصالت وناعم في البعض االخر‪.‬‬ ‫وبالدراسة البيولوجية الجزيئية للطفيل‪ ،‬تم اجراء تفاعل البلمرة المتسلسل لزيةادة تتةابع معةين علةى‬ ‫جةةين خةةا‬

‫فةةي الحمةةض النةةووي للطفيةةل هةةذا التتةةابع يسةةاعد فةةي التصةةنيف الجزيئةةي للطفيةةل بعةةد الفصةةل‬

‫الكهربي لمستخلص الحمض النووي‪ ،‬وقد كان الوزن الجزيئي للجين محل الدراسة ‪ 622‬زوج قاعدي‪.‬‬ ‫وقد تم عمل كشف تتابع للنيوكليدات للجين محل الدراسة وقد وجد ان عينة طفيل ساركوسيستس‬ ‫جايجانتيا يشبه التتابع الجيني الرقام الدخول ) ‪ (KF489421 and KC209733‬علي بنك الجينات‪،‬‬ ‫بينما طفيل ساركوسيست تينيال قسمت الي ثالثة تحت مجموعة (هابلوتايب) ‪،‬المجموعة االولي تشبه‬ ‫التتابع الجيني الرقام الدخول )‪ (KP263754, KP263752 and KP263758‬علي بنك الجينات‬ ‫والمجموعة الثانية تشبه التتابع الجيني الرقام الدخول )‪(KP263759, KP263757 and KP263756‬‬ ‫علي بنك الجينات بينما المجموعة الثالثة تشبه التتابع الجيني الرقام الدخول‬ ‫‪ ( KP263756‬علي بنك الجينات‪.‬‬

‫‪2‬‬

‫)‪& KP263757‬‬

‫جامعة المنصورة‬ ‫كلية الطب البيطري‬ ‫قسم الطفيليات‬

‫السادة أعضاء لجنة الحكم والمناقشة‬ ‫السادة المشرفون‬ ‫عنوان الرسالة‪ :‬إستخدام البيولوجيا الجزيئيه في تصنيف أنواع المتكيسات العضلية التي‬ ‫تصيب األغنام‬ ‫اسم الباحث‪ :‬ط‪ .‬ب‪ /‬باسم محمد محمد المشمشي‬

‫تحت اشراف‬ ‫االسم‬

‫الوظيفة‬

‫‪1‬‬

‫األستاذ الدكتور‪ /‬صالح‬ ‫أحمد عثمان أبوالوفا‬

‫أستاذ ورئيس مجلس قسم الطفيليات‬ ‫كلية الطب البيطري‪ -‬جامعة المنصورة‬

‫‪2‬‬

‫الدكتور ‪ /‬مصطفى عبد‬ ‫السالم أحمد العربي‬

‫أستاذ مساعد الطفيليات‪ -‬كلية الطب البيطري‪ -‬جامعة‬ ‫المنصورة‬

‫لجنة الحكم والمناقشة‬ ‫االسم‬ ‫‪1‬‬

‫أ‪.‬د‪ /‬محمود عبد النبي عمر الصيفي‬

‫‪2‬‬

‫أ‪.‬د‪ /‬يحيى زكريا خير هللا عطيفى‬

‫‪3‬‬

‫أ‪.‬د‪ /‬صالح أحمد عثمان أبوالوفا‬

‫الوظيفة‬ ‫أستاذ الطفيليات المتفرغ ‪ -‬كلية الطب‬ ‫البيطري‪ -‬جامعة كفر الشيخ‬ ‫أستاذ الطفيليات المتفرغ ‪ -‬كلية الطب‬ ‫البيطري‪ -‬جامعة اإلسكندرية (ادفينا)‬ ‫أستاذ ورئيس مجلس قسم الطفيليات ‪ -‬كلية‬ ‫الطب البيطري‪ -‬جامعة المنصورة (مشرفا)‬

‫رئيس مجلس قسم الطفيليات‬

‫وكيل الكلية لشئون الدراسات‬ ‫العليا والبحوث‬

‫عميد الكلية‬

‫أ‪.‬د‪ .‬صالح أحمد عثمان أبو الوفا‬

‫أ‪.‬د‪ .‬جهاد رمضان محمد السيد‬

‫أ‪.‬د‪ .‬نبيل أبو هيكل السيد أحمد‬


‫السادة المشرفون‬ ‫عنوان الرسالة‪ :‬إستخدام البيولوجيا الجزيئيه في تصنيف أنواع المتكيسات العضلية التي‬ ‫تصيب األغنام‬ ‫اسم الباحث‪ :‬ط‪ .‬ب‪ /‬باسم محمد محمد المشمشي‪.‬‬

‫تحت اشراف‬ ‫التوقيع‬

‫م‬

‫االسم‬

‫الوظيفة‬

‫‪1‬‬

‫األستاذ الدكتور‪ /‬صالح‬ ‫أحمد عثمان أبوالوفا‬

‫أستاذ ورئيس مجلس قسم‬ ‫الطفيليات ‪ -‬كلية الطب البيطري‪-‬‬ ‫جامعة المنصورة‬

‫‪2‬‬

‫الدكتور ‪ /‬مصطفى عبد‬ ‫السالم أحمد العربي‬

‫أستاذ مساعد الطفيليات‪ -‬كلية‬ ‫الطب البيطري‪ -‬جامعة المنصورة‬

‫رئيس مجلس قسم الطفيليات‬

‫وكيل الكلية لشئون الدراسات‬ ‫العليا والبحوث‬

‫عميد الكلية‬

‫أ‪.‬د‪ .‬صالح أحمد عثمان أبو الوفا‬

‫أ‪.‬د‪ .‬جهاد رمضان محمد السيد‬

‫أ‪.‬د‪ .‬نبيل أبو هيكل السيد أحمد‬

‫جامعة المنصورة‬ ‫كلية الطب البيطرى‬ ‫قسم الطفيليات‬

‫‪Mansoura University‬‬ ‫‪Faculty of Vet. Medicine.‬‬ ‫‪Parasitology Department‬‬

‫قرار لجنة المناقشة و الحكم‬ ‫قررت لجنة المناقشة والحكم المنعقدة بكلية الطب البيطرى – جامعة المنصورة‬ ‫يوم الثالثاء الموافق ‪ – 7102 / 5 / 9‬قبول رسالة دكتوراة الفلسفة المقدمة من‬

‫السيد ط‪.‬ب‪ /‬باسم محمد محمد المشمشي – بعنوان " إستخدام البيولوجيا‬ ‫الجزيئيه في تصنيف أنواع المتكيسات العضلية التي تصيب األغنام " وترشيح‬ ‫سيادته للحصول على درجة دكتوراة الفلسفة فى العلوم الطبية البيطرية تخصص‬ ‫(الطفيليات)‪.‬‬ ‫أعضاء اللجنة‪:‬‬

‫‪ .١‬أ‪.‬د‪ /‬محمود عبد النبي عمر الصيفي‬

‫‪ .٢‬أ‪.‬د‪ /‬يحيى زكريا خير هللا عطيفى‬

‫‪ .٣‬أ‪.‬د‪ /‬صالح احمد عثمان ابو الوفا‬

‫تحريرا فى ‪7102 / 5 / 9‬‬

‫أستاذ الطفيليات المتفرغ ‪-‬‬ ‫كلية الطب البيطري‪ -‬جامعة‬ ‫كفر الشيخ‬ ‫أستاذ الطفيليات المتفرغ ‪ -‬كلية‬ ‫الطب البيطري‪ -‬جامعة‬ ‫االسكندرية‬

‫أستاذ ورئيس مجلس قسم‬ ‫الطفيليات ‪ -‬كلية الطب‬ ‫البيطري‪ -‬جامعة المنصورة‬ ‫( مشرفا )‬


‫" إستخدام البيولوجيا الجزيئيه في تصنيف أنواع المتكيسات العضلية التي‬ ‫تصيب األغنام "‬ ‫رسالة مقدمه من‬

‫ط‪.‬ب‪/.‬باسم محمد محمد المشمشي‬ ‫(بكالوريوس العلوم الطبية البيطرية – جامعة المنصورة ‪) 6002 .‬‬ ‫)ماجستير الطفيليات – جامعة المنصورة ‪)6022 .‬‬ ‫تحت إشراف‪:‬‬

‫ا‪.‬د‪ /‬صالح أحمد عثمان أبو الوفا‬ ‫أستاذ ورئيس مجلس قسم الطفيليات‬ ‫كلية الطب البيطري – جامعة المنصورة‬

‫د‪ /‬مصطفى عبد السالم احمد العربي‬ ‫أستاذ مساعد الطفيليات‬ ‫كلية الطب البيطري – جامعة المنصورة‬

‫الرسالة مقدمة للحصول على‬ ‫درجة دكتوراه الفلسفة في العلوم الطبية البيطرية‬

‫كلية الطب البيطري‬ ‫جامعة المنصورة‬ ‫(الطفيليات)‬ ‫‪1027‬‬