Molecular Cloning and Characterization of a ... - Plant Physiology

Plant Physioi. (1 995) 109: 853-860

Molecular Cloning and Characterization of a Soluble lnorganic Pyrophosphatase in Potato’ Patrick du Jardin*, Jorge Rojas-Beltran, Christiane Cebhardt, and Robert Brasseur

Department of Plant Biology (P.d.J., J.R.43.) and Center of Numerical Molecular Biophysics (R.B.), Faculty of Agricultura1 Sciences of Gembloux, B-5030 Gembloux, Belgium; and Max-Planck-lnstitute for Plant Breeding Research, W-50829 Koln, Germany (C.G.) In plants, inorganic pyrophosphatases also participate in the assimilation of mineral nutrients. In particular, PPi hydrolysis is coupled to sulfate activation into adenosine phosphosulfate, hence essential for sulfur metabolism (Schmidt and Jager, 1992). Remova1 of PPi can also be achieved by conserving the free energy of the phosphoanhydride bond of PPi either in phosphorylated metabolites or as a transmembrane proton gradient. The occurrence of a tonoplastic proton-translocating inorganic pyrophosphatase is remarkable in that respect (Rea and Poole, 1993). In the cytosol, two soluble enzymes (UDP-Glc pyrophosphorylase and the PPi-dependent phosphofructokinase) use PPi as a substrate in energy-conserving reactions. Plant tissues are remarkably rich in PPi (Edwards et al., 1984; Smyth and Black, 1984; Weiner et al., 1987; Dancer and ap Rees, 1989; Takeshige and Tazawa, 1989), which is essentially limited to the cytosolic compartment (Weiner et al., 1987; Takeshige and Tazawa, 1989). The physiological importance of the cytosolic PPi pool is substantiated by the observation that expression of a soluble inorganic pyrophosphatase of bacterial origin in the cytosol of transgenic tobacco and potato (Solanum tuberosum L.) plants leads to significant alterations in metabolism, growth, and development (Jelitto et al., 1992; Sonnewald, 1992; Lerchl et al., 1995). Thus far, little information is available concerning the control of PPi levels in the different plant cell compartments and most notably the diversity and regulation of soluble inorganic pyrophosphatases. Soluble alkaline pyrophosphatases have been characterized in plant extracts and some of them have been purified (Naganna et al., 1954; Gould and Winget, 1973; Klemme and Jacobi, 1974; Popli and Singh, 1977; Kumar and Singh, 1983; Mukherjee and Pal, 1983; Ho and Khoo, 1985; Ananda Krishnan and Gnanam, 1988; Gama Branda0 and Aoyama, 1992; MortainBertrand et al., 1992).Based on the subcellular fractionation studies carried out by Gross and ap Rees (1986) and by Weiner et al. (1987), it is likely that most of these soluble alkaline activities correspond to plastidic isoforms. One notable exception is the soluble pyrophosphatase purified from the latex of Hevea brasiliensis (Jacob et al., 1989), a

A cDNA clone encoding a soluble inorganic pyrophosphatase(EC 3.6.1 .l) of potato (Solanum tuberosum 1.)was isolated by screening a developing tuber library with a heterologous probe. The central domain of the encoded polypeptide i s nearly identical at the sequence leve1 with i t s Arabidopsis homolog (J.J. Kieber and E.R. Signer [1991] Plant MOIBiol 16: 345-348). Computer-assistedanalysis of the potato, Arabidopsis, and Escherichia coli soluble pyrophosphatases indicated a remarkably conserved organization of the hydrophobic protein domains. The enzymatic function of the potato protein could be deduced from the presence of amino acid residues highly conserved in soluble pyrophosphatases and was confirmed by its capacity to complement a thermosensitive pyrophosphatase mutation i n E. coli. The potato polypeptide was purified from complemented bacterial cells and its pyrophosphatase activity was shown t o be strictly dependent on Mg2+ and strongly inhibited by Ca2+. The subcellular location of the potato pyrophosphatase is unknown. Structure analysis of the N-terminal protein domain failed to recognize typical transit peptides and the calculated molecular m a s of the polypeptide (24 kD) i s significantly inferior t o the values reported for the plastidic (alkaline) or mitochondrial pyrophosphatasesin plants (28-42 kD). Two unlinked loci could be mapped by restriction fragment length polymorphism analysis in the potato genome using the full-length cDNA as probe.

Inorganic pyrophosphatases (EC 3.6.1.1) are ubiquitous enzymes catalyzing the hydrolysis of PPi into two Pi’s. PPi hydrolysis is highly exergonic (AG” = -33.5 kJ mol-l) and provides a thermodynamic driving force to a range of anabolic processes. Most notably, the synthesis of biological polymers produces PPi either during the activation of monomers (e.g. ADP-Glc synthesis prior to starch elongation, amino acid activation into amino acyl-tRNA prior to polypeptide elongation) or during the elongation of the polymers (eg. DNA and RNA synthesis, polyisoprene [rubber] synthesis). According to the Kornberg (1962) model, the energy “wasted“ by PPi hydrolysis is needed for making these processes thermodynamically irreversible. Hence, the first and most ubiquitous function of inorganic pyrophosphatases is presumably to drive anabolism.

* This work was supported by the Communauté française de Belgique (Action de Recherche Concertée contract No. 90/ 94-143) and by the European Community (Biotech Project of Technological Priority B102 CT930400, contract No. PL920150). * Corresponding author; e-mail dujardin8fsagx.ac.be; fax 3281-600727.

Abbreviations: GST, glutathione S-transferase; HCA, hydrophobic cluster analysis; IPTG, isopropylthio-/3-galactoside; LB, Luria broth; RFLP, restriction fragment length polymorphism. 853

854

du Jardin et al.

cytosolic protein participating in rubber synthesis in this very particular cellular environment. At the gene level, a cDNA and a partia1 genomic sequence in Arabidopsis thaliana have been briefly described (Kieber and Signer, 1991).The pyrophosphatase function of the cloned cDNA was inferred from sequence analysis, and no information was provided regarding the subcellular location of the encoded polypeptide. In the present paper, we describe the cDNA cloning and sequence analysis of a potato soluble pyrophosphatase homologous to the Arabidopsis gene product, provide experimental evidence of its pyrophosphatase function, and map two corresponding loci in the potato genome. MATERIALS A N D METHODS Plant Material

The potato (Solanum tuberosum L.) cv Désirée was used throughout this work. Plants were grown in a greenhouse under natural light supplemented with fluorescent light. D N A Techniques and RFLP Mapping

Screening of the developing tuber cDNA library (du Jardin and Berhin, 1991) and dideoxynucleotide sequencing (with T7 DNA polymerase) were performed using standard procedures (Sambrook et al., 1989). Potato DNA extraction, restriction digestion, electrophoresis, blotting, and hybridization with 3ZP-labeledprobes were performed as previously described (du Jardin, 1990, for the standard Southern blot analysis; Gebhardt et al., 1989, for the RFLPmapping work). Expression in bcherichia coli

For expression in E. coli, the potato cDNA was inserted as a BamHI-EcoRI fragment (nucleotides 147-948) into the pGEX3X vector (Pharmacia), resulting in the IPTG-driven expression of a fusion polypeptide comprising residues 21 to 211 of the cDNA product and the vector-encoded GST. For the genetic complementation assay, the pGEX plasmid derivative (named pGEX::ppase) was introduced by standard CaCI, transformation into the E. coli strain K37EKTR(pE), encoding a temperature-sensitive cytoplasmic pyrophosphatase (Chen et al., 1990). Maintenance of the thermosensitive replicon harboring the E. coli pyrophosphatase gene and a chloramphenicol resistance gene is achieved by cultivation of the strain at 30°C on LB plus chloramphenicol (25 mg L-') medium. Loss of the endogenous pyrophosphatase activity was achieved by cultivating the cells of a single colony overnight at 37°C in 2 mL of LB medium. Plating an aliquot of the overnight culture on LB medium failed to develop any colony, indicating the loss of the pyrophosphatase activity. For fusion protein induction, 10 pL of 0.1 M IPTG were added to the agar plates 30 min before inoculation. In liquid cultures, IPTG concentrations between 20 and 100 p~ were used. Purification of the fusion protein from sonicated bacteria1 extracts was achieved by affinity with glutathioneagarose beads (Pharmacia) according to the batch pro-

Plant Physiol. Vol. 109, 1995

cedure recommended by the supplier. The fusion polypeptide was cleaved on the agarose beads by the Xa factor (Boehringer) in 18 h at 4°C under the recommended conditions. Assay of the Mg*+-Dependent Soluble lnorganic Pyrophosphatase Activity

For assaying the pyrophosphatase activity ol' the polypeptide purified from E. coli, the protein fraction released from the glutathione-agarose beads by Xa factor digestion was passed through a Sephadex G-25 column (Pharmacia) and eluted with 50 mM 1,3-bis[tris(hydroxymethy1)-methylaminolpropane.Enzyme activity (100 ng of protein in 50 pL) was assayed at room temperature for 15 min in 200 p L of the reaction buffer (50 mM 1,3-bis[tris(hydroxymethyl)-methylaminolpropane, pH 7.0, 1 mM Na,H,P,07, O or 2.5 mM MgCl,). pH 7.0 corresponds to the optimal value for the potato polypeptide. The reactiori was stopped with 750 pL of staining buffer (3.4 mM ammonium molybdate in 0.5 M sulfuric acid, 0.5 M SDS, 0.6 M ascorbic acid, 6:2:1, v / v / v ) as described by Burchell et al. (1988). After 20 min, the A,,, was measured. The standard curve was constructed using known quantities of Pi from a KH,PO, solution replacing the protein extract. Computer Analysis of the Sequence Data

Primary sequence alignment was performed by the PILEUP program of the Genetics Computer Group software package (version 8.0; Madison, WI) using the default parameters (GapWeight, 3.000; GapLengthWeight, 0.100), available through the BEN (Belgian EMBL Node) network. Hydrophobic cluster analysis (HCA) was performed using the programs of the Center of Numerical Molecular Biophysics of the University of Gembloux. A review of the method was presented by Lemesle-Varloot et al. (1990). RESULTS c D N A Cloning and Sequence Analysis of a Soluble lnorganic Pyrophosphatase in Potato

A hgtll cDNA library constructed from developing tuber poly(A)' RNA (du Jardin and Berhin, 1991) was screened with a cloned probe corresponding to the pro teincoding region of the published sequence in A. thdiana (Kieber and Signer, 1991). Two positive phage plaques were isolated out of 200,000. The longest cDNA (0.95 kb) was subcloned in pBluescript and sequenced (Fig. 1). The correspondence between the size of the cDNA and that of the corresponding mRNA (between 1.0 and 1.1kb, as estimated by northern blot hybridization) indicates that the cDNA is full length or nearly full length, considering that only a few residues of the poly(A) tail are present in the cDNA. The environment of the first ATG (position 79) satisfies the rules for the upstream residues of the ATG translation start (A residues at positions -1, -3, -4, -5), but the downstream triplet AGC (at +4, +5, +6) is less common (Joshi, 1987). The presence of 24 contiguous A residues at the 5' extremity of the cDNA is worth mention-

Soluble lnorganic Pyrophosphatase in Potato

855

"fingerprint" of soluble inorganic pyrophosphatases, are scattered over the conserved domain of the plant proteins (in potato, the first conserved residue occupies position 53 11 Q R R A P R L N E R I L S S I CAA AGA CGT GCC CCT CGT TTG AAT GAG AGG ATC CTA TCA TCT ATA 109 and the last one occupies position 177). 26 S R R S V A A H P W H D L E I Further comparison of the three proteins was achieved 154 TCC AGG AGG TCT GTT GCT GCT CAT CCT TGG CAC GAC CTT GAG ATA with the HCA algorithm, which examines the distribution 41 G P E A P S V F N V V I E I S GGA CCT GAA GCT CCA AGT GTT TTC AAT GTT GTC ATT GAG ATT TCA 199 of the globular protein domains along a peptide sequence. K G S K V K Y E L D K K T G L 56 This algorithm combines homology detection with secondAAA GGA AGC AAA GTC AAA TAT GAG CTG GAC AAG AAA ACC GGT CTT 244 ary structure analysis (see Lemesle-Varloot et al., 1990, for I K V D R I L Y S S V V Y P Q 71 ATT AAG GTT GAT CGC ATC CTA TAC TCT TCA GTG GTT TAC CCT CAA 289 a detailed description) and is an efficient way for extracting N Y G F I P R T L C E D N D P 06 structural and functional information from primary seAAC TAT GGC TTC ATT CCC CGA ACA CTC TGT GAA GAT AAT GAC CCA 334 quences and for the identification of conserved structural 101 M D V L V L M Q E P V L P G C 379 ATG GAT GTA TTA GTC CTC ATG CAG GAA CCT GTC CTT CCA GGT TGT elements between distantly related proteins. Figure 2B L R A R A I G P M L M F I 116 D Q indicates a common organization of the hydrophobic TTC CTT CGA GCT AGG GCA ATA GGT CTG ATG CCT ATG ATT GAT CAG 424 131 G E K D D K I I A V C A D D P domains in the potato, Arabidopsis, and E . coli pyro469 GGA GAG AAA GAT GAC AAG ATC ATA GCA GTG TGT GCT GAT GAT CCA phosphatases. Identical anchor points (homologous hy146 E Y R H Y T D I K Q L P P H R 514 GAA TAT CGC CAC TAC ACT GAT ATA AAG CAG CTC CCC CCT CAC CGC drophobic clusters and 1or identical motifs) are visualized 161 L A E I R R F F E D Y K K N E and might indicate a common folding pattern for the core 559 CTG GCT GAA ATT CGC CGC TTT TTT GAA GAC TAC AAG AAG AAT GAA of the three proteins. For example, interna1 p-strands sta176 N K D V A V D D F L P P N S A 604 AAC AAA GAC GTT GCT GTT GAC GAT TTC CTG CCT CCA AAT TCT GCT tistically occur as short and vertical clusters of hydrophobic N A I Q Y S M D L Y A E Y I 191 V residues (circled residues on the HCA plot) and such a 649 GTC AAT GCC ATT CAG TAC TCC ATG GAT CTG TAT GCT GAA TAC ATA motif is found around positions 105, 162, and 72 in the 206 L H S L R K 694 TTA CAC AGC TTG AGG AAG taaggtacaatgggacacatataaaacagaatat=ta potato, Arabidopsis, and E. coli proteins, respectively. This 748 t a g g t a c a a t g g g a a a t g a a g a c t g t c a c a a g t c ~ c ~ = g t t ~ t c t t ~ = t g ~ t t t g ~ ~ a t = ~ t a t t t t cluster is probably part of the hydrophobic core of the 008 tttttgtactgttattttctctttgtttgaatttttgtgtt~tatgatgttatgacttag proteins. Three contiguous short a-helices are also evident, 868 CaagggtttatcccttgCtgctctaaatttgtactgtttttaattatattg~c~ttcacta close to the C-terminal extremity of the proteins, visualized 920 ttgctaaaaaaaaaaaaaaaa as sloping hydrophobic segments in the HCA plots. Based on this algorithm, no particular two-dimensional structure Figure 1. Nucleotide and deduced amino acid sequences of the can be assigned to the N- and C-terminal extensions of the potato c D N A isolated from a developing tuber library. plant proteins. Overall, the regular distribution of hydrophobic clusters separated by short hydrophilic areas is ing, a feature also found in the leader sequence of the A. characteristic of a classical globular fold. The HCA plot also thaliana gene (with a few A to G substitutions, Kieber and fails to identify any membrane-spanning helix, typically Signer, 1991). This unusual conserved motif could have denoted by long (approximately 20 residues) and horizonsome regulatory significance. The polypeptide deduced tal hydrophobic clusters. Based on the sequence homology from the potato cDNA (211 amino acid residues) has a with soluble pyrophosphatases and on the two-dimencalculated molecular mass of 24.26 kD. The sequence idensional information, the two plant proteins can be reasontity between the Arabidopsis 1potato pyrophosphatases ably considered as soluble pyrophosphatases, well apart and the other published pyrophosphatases (from both profrom the proton-pumping pyrophosphatases inserted in karyotes and eukaryotes) is below 40%, and the plant enthe vacuolar membrane. zymes are more similar to the E. coli cytoplasmic pyrophosCompared with E. coli, the potato and Arabidopsis prophatase than to any other homolog (for review and teins contain N-terminal extensions of 33 and 40 residues, sequence alignments, see Cooperman et al., 1992). respectively, with a limited sequence similarity in their The plant tonoplast proton-pumping pyrophosphatases C-terminal domains and, as already mentioned, with no form a very different group of enzymes (Rea et al., 1992). remarkable two-dimensional structure. A possible function Figure 2A aligns the sequences of the potato, Arabidopsis, of N-terminal sequences is the targeting of the polypepand E. coli pyrophosphatases. A central domain (between tides to organelles, a question of special significance in the residues 40 and 201 of the potato polypeptide) shows a present case, since it is assumed that plant soluble pyrohigh sequence identity with the Arabidopsis polypeptide phosphatases are essentially limited to the plastidic comand a significant sequence similarity with the E. coli pyropartment. This question can be discussed on the basis of the phosphatase when conservative substitutions are included. structural features of the chloroplast transit peptides deThe two plant proteins possess both N-terminal and Cfined by von Heijne et al. (1989). In the potato sequence, terminal extensions compared with the bacterial protein, assuming that the mature protein starts at residue 33, bewith little (N-terminal extremity) or no (C-terminal extremcause that is where the homology with E. coli begins, a ity) sequence similarity with one another. Alignment of fairly good cleavage site can be found: the segment VAAH eight eukaryotic and prokaryotic soluble pyrophosphatacorresponds well with the loosely defined consensus V / Ises has identified 24 conserved residues, 15 of which are part of a group of 17 putative active site residues, accordX-A/C i A, and an R residue occupies position -6. Moreing to x-ray crystallographic studies in yeast (Cooperman over, the N-terminal extension is enriched in Ser residues et al., 1992).These residues, thus constituting some kind of compared with the putative mature protein (19 versus 1

1 61

aaaaaaaaaaaaaaaaaaaaaaaaccgttgctgctgtcggtcttctttcgttca=tccaaggt

ttaccagaaattgtaaaa

M S N E N D D L S P ATG AGC AAT GAA AAT GAT GAT TTG TCT CCA

d u Jardin et al.

856 Figure 2. Comparison of the one- and two-dimensional structures of the soluble inorganic pyrophosphatases from potato (ppast,this work), A. thaliana (ppara, Kieber and Signer, 1991), and E. coli (ppacoli, Lahti et al., 1988). A, Alignment of the three amino acid sequences using the PILEUP program from Genetics Computer Group. The conserved residues, including conservative substitutions, are boxed. Dots indicate t h e 24 amino acid residues highly conserved between all soluble pyrophosphatases. Filled dots correspond to putative active site residues, and open dots correspond to residues with no proposed function (Cooperman et al., 1992). B, HCA plot of the three pyrophosphatases. The basics of the representation are t h e following (Lemesle-Varloot et al., 1990): t h e sequences are written on a classical a-helix (3.6 amino acids per turn) smoothed on a cylinder. The cylinder is then cut parallel to its axis and unfolded. Because some adjacent amino acids are separated by the unfolding, the representation is duplicated to restore full connectivity of each residue. Such a two-dimensional plot makes short- and medium-distance interactions readily detectable, since, for a given residue, the first and second neighbors are located in a 17-residue seament. Hvdrophobic residues are circled, " allowing the identification of hydrophobic clusters possibly involved in the three-dimensional fold of the protein. Two-dimensional structure elements tend to have characteristic signatures on such plots. Vertical lines delimit structurally homologous domains, and some typical pstrands (p) and a-helices (a)are positioned under the three plots. Pro/Gly residues are indicated by symbols */#, respectively, considering their specific conformational characteristics. I


A .IPPdrel M A E I K D E G S A K G Y A F P 1 R N P N V T L N

{piY:P;;

.

:

-

!@I4

D

1:

Q

R !A

P

E R N F

A A

RFl!o!

R V a-

F T H R IS

S A A A

H P W H D L E I G P E

175

K I- S. I G A- F- N F V- M- L I R K- H. C IppBcOlll . . - - . - - .

2h3

ipposti IPParai

211 17s

B

,

I 1

ppast

c$$R$sp. A%! @p$; a:N.; 0.e-R

ppacoli

(L

4.5%) and the 9 N-terminal residues lack both positively charged and Gly/Pro residues. However, despite a net positive charge, the content in acidic residues is not lowered in the putative presequence compared with the mature protein and the last 10 residues of the presequence have no potential to form an amphiphilic p-strand, according to the HCA plot. Based on these observations, it is thus difficult to draw firm conclusions regarding the capacity of the N-terminal extension to target the protein to plastids and, after all, von Heijne's rules are not without exceptions (Dreses-Werringloer et al., 1991; Willey et al., 1991). Targeting the protein to the mitochondrion has also to be envisaged, since mitochondrial pyrophosphatases have been described in mammalians, in yeasts (for refs., see Cooperman et al., 1992), and more recently in plants (Vianello et al., 1991; Zancani et al., 1995). The net positive charge of the potato N-terminal extension and the enrichment in Ser residues are properties shared by mitochondrial transit peptides (von Heijne et al., 1989), but the N-terminal domain of the putative presequence does not

P

a

a

a

show amphiphilic a-helical properties and the content in acidic residues is not lowered compared with the mature protein, in opposition to the rules proposed by von Heijne et al. (1989). Again, an increasing number of exceptions to these rules have been described (Braun and Schmitz, 1995, and refs. therein) and no firm conclusion can be inferred from this one- and two-dimensional sequence analysis. Cenetic Complementation of an E. coli PyrophosphataseDeficient Mutant

Further evidence that the potato cDNA codes for an inorganic pyrophosphatase was obtained by the genetic complementation of an E. coli strain with a thermosensitive cytoplasmic pyrophosphatase. The mutant mmed K37EKTR(pE) is disrupted in its chromosomal ppa gene encoding the cytoplasmic inorganic pyrophosphatase and contains a wild-type copy of the gene on a thermosensitive replicon (Chen et al., 1990). At 37"C, replication od the plasmid is inhibited, the active ppa gene is lost, and growth

857

Soluble Inorganic Pyrophosphatase in Potato

stops. The potato cDNA was expressed in the mutant from the expression vector pGEX-3X (Pharmacia), after fusing the cDNA in frame with the GST-coding sequence. Expression is controlled by the IPTG-inducible tac promoter. Both the parental pGEX vector and the recombinant plasmid (pGEX::ppase) were introduced separately in the mutant strain. Transformed cells were plated either at 30°C on LB plus ampicillin plus IPTG (permissive conditions) or on the same medium at 37°C after overnight incubation at the same temperature for eliminating the thermosensitive replicon (restrictive conditions). Figure 3A shows that plasmid

Table I. Inorganic pyrophosphatase activity of the cDNA product purified from E. coli The assay was performed at room temperature and at pH 7.0 (optimum pH of the pyrophosphatase as expressed in E. coli). Means are of replicate samples. Assay Conditions

Inorganic Pyrophosphatase Activity nmol PPi hydrolyzed mg~ ' protein 75 min~ '

0 mM Mg2+ 2.5 mM Mg2 +

2.5 mM Mg2+ + 0.05 mM Ca 24 2.5 mM Mg2+ + 0.5 mM Ca2 +

n.d."

683 320

n.d.°

•' n.d., No detectable activity.

B .5

r-i

i-

-i

2

DK37 .5

• K37EKTR(pE)

- ——

1

.5

f I

0

0

I 2

10

50

• K37EKTR(pE, pGEX::ppase)

1 100

pGEX::ppase allowed the transformed cells to grow in restrictive conditions, while the pGEX vector was inefficient in complementing the mutation. Complementation was controlled by IPTG, with an optimal concentration between 2 and 10 /XM in liquid culture (Fig. 3B), and was correlated with the expression of a polypeptide with an electrophoretic mobility expected for the chimeric pyrophosphatase (not shown). As a conclusion, the potato cDNA provides the mutant with the capacity to remove PPi at 37°C, which is essential for growth. However, this complemented phenotype is not necessarily due to an inorganic pyrophosphatase but could be conferred by any PPi-consuming enzyme encoded by the cDNA. It was thus decided to purify the potato polypeptide from complemented bacteria and to assay its inorganic pyrophosphatase activity. The fusion protein was purified from sonicated bacterial extracts by affinity with glutathione-agarose beads. The potato polypeptide was then separated from the carrier protein (GST) by Xa factor digestion. Finally, the potato polypeptide is deleted from its 20 N-terminal residues and contains an N-terminal Gly residue from GST. The inorganic pyrophosphatase activity was assayed by measuring the Pi released from PPi, in either the presence or the absence of Mg 2+ . The data presented in Table I indicate that the potato cDNA actually codes for an inorganic pyrophosphatase, with a strict requirement for Mg 2+ , and that the enzyme is strongly inhibited by Ca2+, which are typical features of soluble inorganic pyrophosphatases. Incidentally, since the protein lacks the 20 N-terminal residues, this experiment also indicates that this nonconserved domain is dispensable for the catalytic activity.

IPTG (pM) Figure 3. Genetic complementation of the thermosensitive E. col! strain K37EKTR(pE), deficient in inorganic pyrophosphatase, by the potato cDNA. A, The strain was transformed either by the parental vector (pGEX) or by the recombinant plasmid (pGEX::PPase), and transformed cells were incubated either in permissive (30°C) or in restrictive (37°C) conditions. B, IPTG dependence of the complemented phenotype. The wild-type strain (K37), the untransformed mutant strain |KE7EKTR(pE)l, and the mutant strain transformed by pGEX::ppase [KE7EKTR(pE, pGEX::ppase)] were cultivated in restrictive conditions with different IPTG concentrations. A's of the liquid cultures were measured when K37 reached saturation.

At Least Two Separate Genes Code for Soluble Pyrophosphatases in Potato

Nuclear DNA was isolated from the tetraploid cv Desiree and analyzed by Southern blot with either the full-length cDNA or a 3' probe (NcoI-EcoRI fragment corresponding to nucleotides 669-948). This 3' probe covers the 3' untranslated region of the cDNA and the last 15 codons of the open reading frame, corresponding to the nonconserved C-terminal domain. Both probes identified multiple bands above 4 kb (Fig. 4) that might indicate the existence of

du Jardin et al.

858

B (kb)

H

H

23.13 -

9.42 . 6.56 -

4.36 -

2.32 2.03


plasmic enzymes from prokaryotic and eukaryotic sources composed of a single type of polypeptide (Cooperman et al., 1992). The catalytic subunits of the mitochondrial pyrophosphatases from yeast (Lundin et al., 1991), animals (Volk et al., 1983; Volk and Baykov, 1984), and plants (Vianello et al., 1991; Zancani et al., 1995) can probably be assigned to the same category, based on the published sequence of the yeast protein. These mitochondrial pyrophosphatases are loosely bound to the inner membrane, as parts of multisubunit complexes, and can also be found in the soluble matrix phase. Finally, the plant vacuolar H+pumping pyrophosphatases and the pyrophosphatase (reversible H + -PPi synthase) from Rhodospirillum rubrum chromatophores form a separate group of enzymes, with no significant sequence similarity with any other pyrophosphatases (Rea et al., 1992). Since the potato pyrophosphatase is presumably a soluble enzyme, its correspondence with the plastidic alkaline pyrophosphatase accounting for most of the soluble activity in plant cells has to be considered. Overall, plant alkaline pyrophosphatases have molecular masses between 28

1.35 -

vnr

Figure 4. Southern blot experiment using either the full-length cDNA (A) or a 3'-specific probe (B) hybridized with genomic DMA from 5. tuberosum cv Desiree. H, H/ndlll; R, fcoRI.

several copies of the cloned gene or close relatives in potato. Considering the alternative possibility of multiple alleles for a single locus in the tetraploid background of cv Desiree, a complementary RFLP-mapping analysis was performed as previously described (Gebhardt et al., 1989), using the full-length cDNA as probe. The segregating RFLP fragments identified two loci on chromosomes VIII and XII (Fig. 5). Based on the observation of additional homomorphic fragments, the existence of a third locus cannot be ruled out. We propose the terms Ppal(a) and Ppal(b) for the two mapped loci, in accordance with the nomenclature of the published potato map (Gebhardt et al., 1989) and with the recommendations of the Commission on Plant Gene Nomenclature (1994). The existence of at least two genes per chromosome set in potato contrasts with the conclusions of Kieber and Signer (1991) pointing to a single-gene copy in Arabidopsis. DISCUSSION

wx _

-CP134(a)

— Ppa1(b) - CP14

CP158(a)

-

GP173 _ — GP229

- GP40(a) GP68 -

GP122 _ TG28 —

CPS3 _CP74(b) GP217 GP36(a)

_ '— GP130

GP8S(b) GP84(a)

_ -TG16

GP189 -

-GP126

GP204 GP168 _ -CP112(b)

Ppa1(a)-^9

GP170

_

TG45

~

-GP21S(a)

CP20(b)— GP104(f) 4CL(c) > -GP96