Molecular Cloning and Characterization of ... - Journal of Virology

Vol. 62, No. 1

JOURNAL OF VIROLOGY, Jan. 1988, p. 211-217

0022-538X/88/010211-07$02.00/0 Copyright © 1988, American Society for Microbiology

Molecular Cloning and Characterization of Cytoplasmic Polyhedrosis Virus Polyhedrin and a Viable Deletion Mutant Gene MAX ARELLA,1 CLAUDE LAVALLEIE,12 SERGE

BELLONCIK,l

AND

YASUHIRO FURUICHI2*

Department of Virology, Institut Armand-Frappier, University of Quebec, Montreal, Quebec, Canada,' and Nippon Roche Research Center, Department of Molecular Genetics, Kamakura, Japan2 Received 12 May 1987/Accepted 21 September 1987

The double-stranded RNA genome of Bombyx mori cytoplasmic polyhedrosis virus (CPV) was converted to double-stranded DNA and cloned into plasmid pBR322. The complete nucleotide sequence of cloned genome segment 10, which encodes virus polyhedrin polypeptide, was determined. The CPV polyhedrin gene consists of 942 based pairs and possesses a long open reading frame that codes for a polypeptide of 248 amino acids (molecular weight, 28,500), consistent with an apparent molecular weight of 28,000 previously determined for purffied polyhedrin. No sequence homology was found between CPV polyhedrin and polyhedrins from several nuclear polyhedrosis viruses. In addition to the polyhedrin gene, we completed the sequence analysis of a small deletion mutant gene derived from the polyhedrin gene. This mutant gene consists of two subset domains of the polyhedrin gene, i.e., the 5'-terminal 121 base pairs and the 3'-terminal 200 base pairs. An in vitro transcription demonstrated that the small mutant gene is transcribed by virion-associated RNA polymerases. These data confirm the importance of CPV terminal sequences in virus genome replication.

reported previously (12). During the process, unexpectedly, we found in a CPV dsRNA mixture an extra subgenomic segment of about 300 base pairs referred to here as the SP gene (small polyhedrin gene). Since the SP gene appeared to be related in sequence to the polyhedrin gene, we also cloned the cDNA into Escherichia coli plasmid pBR322 and investigated it together with the polyhedrin gene. A direct sequencing and a comparative study clearly indicated that the SP gene is a deletion mutant derived from the polyhedrin gene. This report describes the complete sequence information of CPV polyhedrin as well as its deletion mutant gene.

Cytoplasmic polyhedrosis viruses (CPVs), one genus of the family Reoviridae, infect midgut cells of a wide range of insects (22). Cytoplasmic polyhedrosis disease caused by CPV infection results in the accumulation of occlusion bodies or polyhedra in the cytoplasm which are formed by the crystallization of the viral polyhedrin polypeptide. In the late infection stage, newly formed viruses are occluded in the polyhedron complex, perhaps to stabilize infectious virus particles. Greater biological meaning of the virus occlusion bodies may lie in the accurate delivery of virus to the target intestinal cells, where the occlusion bodies are solubilized by intestinal alkaline pH and the infectious virus particles are released. The genome of CPV, like that of other members of the Reoviridae, consists of 10 double-stranded RNA (dsRNA) segments (4). Each genome dsRNA segment is composed of an mRNA (plus strand) and its complement (minus strand) in an end-to-end base-paired configuration, except for the protruding 5' cap in the plus strand (6, 7). The segments are transcribed by virus-associated RNA polymerase to form capped mRNAs which also function as templates for a replicase in virus-infected cells. Thus, each genome segment should contain recognition sites for genome transcription, mRNA translation, duplex segment replication, and correct assembly into virus particles. Consistently, a terminal sequence of

MATERIALS AND METHODS Preparation of CPVs and genomic dsRNAs. The type 1 CPV of B. mori was propagated by infecting fifth-instar larvae with purified CPV. The polyhedra that contain virus particles were isolated from infected midguts, and the virus was purified from polyhedra as described previously (6, 27). Other CPVs were prepared similarly from infected Euxoa scandens (type 5 virus) and from Inachis io and Spodoptera exigua (type 2 and type 11 viruses, respectively) (22) and were kindly provided by C. C. Payne at the Glasshouse Crops Research Institute, Littlehampton, United Kingdom. Molecular cloning of CPV polyhedrin and SP dsRNA genes. The cDNA for the polyhedrin gene was prepared from denatured CPV dsRNA and cloned into E. coli plasmid pBR322 (at the PstI site) as described previously for human reovirus (2), human rotavirus (12), and wound tumor virus (1). E. coli clones that contained the recombinant plasmids which harbor polyhedrin cDNA were detected by colony hybridization (8) with [32P]pCp-end-labeled segment 10 dsRNA which was purified by polyacrylamide gel electro-

m7GpppAmGUAAA-----GUUAGCC

U CAUUU-----CAAUCGG

was identified for segments of the prototype CPV that infects Bombyx mori, suggesting that the conserved terminal sequence is important for viral replication (15). The polyhedrin protein is coded for by the smallest genome segment, segment 10, and its expression appears to occur most extensively in the late infection stage (21). In an effort to understand the regulation of polyhedrin gene expression and to characterize the genome structure, we cloned the segment 10 cDNA by the method which we have

phoresis. For SP gene cloning, SP dsRNA was first purified from the mixture of CPV dsRNA by polyacrylamide gel electrophoresis. After cDNA synthesis, it was cloned into pBR322 in the same way as the polyhedrin gene and the bacteria which harbored a recombinant SP cDNA-pBR322 were identified by colony hybridization with [32P]pCp-end-labeled segment 10 and SP dsRNAs.

* Corresponding author. 211

212

ARELLA ET AL.

A

B

ltx

G t.-

J. VIROL.

RESULTS n

tri to-

'_ ;,'1:' .'.a%

'

2 .z:

'M

A'InIt.aNk,

Wm

SP dsRNA

'5.

:

7-

9-

FIG. 1. Detection of small dsRNA molecules in CPV genome RNA. CPV genome RNA was prepared from purified virus, and the 3' termini were radiolabeled with [32P]pCp with RNA ligase as described before (28). The labeled CPV genome segments were separated by 5% polyacrylamide gel electrophoresis in 50 mM Tris-phosphate buffer (pH 8) containing 5 mM EDTA at approximately 5 to 7 V/cm. Electrophoresis was run for 4 h (lane B) and 18 h (lane A).

Determination of nucleotide sequence. Cloned polyhedrin and SP cDNA genes were excised from the recombinant pBR322 DNA by digestion with endonuclease PstI and their nucleotide sequences were analyzed by the Maxam-Gilbert (18) and M13 chain termination procedures (26). Sequence analysis was done for both plus and minus strands. CPV in vitro transcription. CPV mRNAs were synthesized in the in vitro transcription reaction as described before (5, 28). Purified CPV (-10 pg) was incubated at 30°C in a transcription reaction mixture (100 Rl) consisting of 10 mM Tris hydrochloride (pH 8.0), 10 mM MgCl2, 1 mM each ATP, CTP, and GTP, 0.4 mM UTP, 10 pLCi of [a-32P]UTP (specific activity, 3,000 Ci/mmol; Amersham Corp., Arlington Heights, Ill.), 1 mM S-adenosylmethionine, and 50 units of RNasin (catalog no. 121800; Promega Biotec, Madison, Wis.) per ml. After 1 h, the reaction mixture was diluted fivefold with 50 mM Tris hydrochloride buffer (pH 8.0) and centrifuged (Beckman SW60 rotor, 30,000 rpm, 60 min, 4°C) to remove virus particles. CPV mRNAs in the supernatant fraction were extracted with phenol-chloroform (2:1, vol/vol), isolated from unreacted reagents by passing through a Sephadex G-50 column (0.6 by 20 cm), and precipitated with 2.5 volumes of cold ethanol.

Presence in B. mori CPV of small polyhedrin-related genome segment. A mixture of genome dsRNA segments of B. mori CPV (BmCPV) extracted from purified virus were

resolved into nine discrete bands by polyacrylamide gel electrophoresis (Fig. 1A). Recently, we found an extra, small genomic dsRNA segment in a CPV genome RNA preparation (Fig. 1B). This small segment had been overlooked before, since it ran off the gel under the normal electrophoresis conditions, which were intended to resolve high-molecular-weight segments. A preliminary 3'-terminal analysis of the [32P]pCp-end-labeled small RNA indicated that it contained 3'-ACU-OH and 3'-GCC-OH, the common 3'-terminal sequences for CPV genome dsRNA segments (data not shown). When the [32P]pCp-3'-end-labeled small RNA was isolated from gels and used for hybridization to the other individual genome dsRNA segments, which were denatured and fixed on a nitrocellulose filter, it hybridized to genome segment 10 and segments 1 to 3 (Fig. 2A). The labeled segment 10 also hybridized specifically with this small RNA (Fig. 2B). Molecular cloning of polyhedrin and its related SP genome RNAs. A mixture of duplex cDNA of CPV genome dsRNAs was prepared as described before (6) except that the 3' tailing of the template dsRNAs was done by polyadenylation with E. coli poly(A) polymerase as described by Cashdollar et al. (2). The cDNAs were then poly(dC) tailed with E. coli terminal deoxytransferase, annealed to poly(dG)-tailed pBR322 plasmid DNA, and cloned into E. coli RR1 cells. Clones that contained the recombinant plasmids harboring the polyhedrin cDNA gene were isolated after colony hybridization with 3 '-[132P]pCp-labeled polyhedrin gene (genome segment 10) as a probe. The CPV polyhedrin cDNA was excised with PstI as a single band which migrated slightly slower than genome segment 10 (Fig. 3). For cloning of SP dsRNA, the mixture of CPV genome RNA was first resolved by polyacrylamide gel electrophoresis and the SP dsRNA was extracted from the gel to avoid contamination of the polyhedrin gene. A small amount (approximately 100 ng) of purified SP dsRNA was 3' polyadenylated, and the cDNA was prepared as the polyhedrin gene was. Clones containing the SP cDNA gene were detected with [32P]pCp-labeled polyhedrin and SP RNAs. Several cDNA clones that contained the full length were obtained for SP RNA genes as determined by agarose gel

GENOME SEGmE\TS 1

A B

2 3

4

6

5

7

9

a

*.

C

* .

.

.

0,

-

.

FIG. 2. Characterization of small dsRNA by dot-blot hybridization. CPV genome segments were resolved by polyacrylamide gel electrophoresis into nine discrete bands and an SP RNA as shown in Fig. 1. Each RNA segment (about 10 ng) was extracted from the gel, converted to single-stranded form by heat denaturation (100°C, 5 min), and fixed on a nitrocellulose filter as described by Thomas (30). Genome segment 10 and SP RNA were [32P]pCp end labeled and used as probes for hybridization. (A) Labeled SP RNA was used as the probe; (B) labeled segment 10 RNA was used as the probe.

CYTOPLASMIC POLYHEDROSIS VIRUS POLYHEDRIN

VOL. 62, 1988

.. ,

Ii-..

..

,

r..- .

I

t

i

4

*,,.

"a

t1

%m

9

;. ...

,_ v.

\

r

FIG. 3. Characterization of polyhedrin cDNA cloned in pBR322. Polyhedrin cDNA was cloned in the PstI site of pBR322. It was excised by Pstl and analyzed by 1% agarose gel electrophoresis. Lanes: A, molecular size markers; B, recombinant pBR322 DNA digested with endonuclease PstI; C, CPV genome dsRNAs.

electrophoresis after digestion of the individual recombinant plasmid with PstI (Fig. 4). The complete nucleotide sequences of both the polyhedrin and SP genes were determined by the Maxam-Gilbert (18) and Sanger et al. M13 (26) methods. CPV polyhedrin gene and predicted amino acid sequence of polyhedrin. The polyhedrin gene consists of 942 nucleotides with a long open reading frame that starts with a possible initiator AUG triplet at residues 42 through 44 and terminates with a single terminator UGA at residues 786 through 788 (Fig. 5). The polyhedrin gene thus encodes a polypeptide of 248 amino acids. This initiation codon has the sequence AXXATGG, characteristic of a strong initiator in eucaryotic protein synthesis systems (14). The second in-phase AUG triplet is present at residues 411 through 413, but it is unlikely that this AUG is used as an initiator, based on its limited coding capacity (125 amino acids) that does not account for the apparent molecular weight of 28,000 estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (21). The predicted amino acid sequence indicated that the CPV polyhedrin is a tyrosine-rich (9%) polypeptide with a molecular weight of 28,456. As expected from its cytosolic existence in virus-infected cells, the polyhedrin does not contain a transmembrane signal peptide. There are four potential N-linked glycosylation sites of the Asn-X-Ser/Thr type at amino acid residues 27 to 29, 77 to 79, 86 to 88, and 237 to 239. The amino acid sequences of several other polyhedrins

213

from different insect viruses have also been established (24). These include polyhedrins from B. mori nuclear polyhedrosis virus (NPV) (11), Autographa californica NPV (9), and Orgyia pseudotsugata NPV (16). The amino acid compositions of these polyhedrins were compared to see whether there was any common feature among various polyhedrins which form a unique crystalline occlusion body (Table 1). There was no noticeable common feature to the four polyhedrins except that they all consist of 245 to 248 amino acids, a very narrow range in the number of composite amino acid residues. There is no apparent amino acid sequence homology between CPV polyhedrin and the NPV polyhedrins (data not shown), while the three NPV polyhedrins are closely related (24). It is apparent from Table 1 that CPV polyhedrin and, to a lesser extent, NPV polyhedrins are rich in tyrosine. An involvement of tyrosine residues in the alkali-sensitive nature of the polyhedra was previously implicated for 0. pseudotsugata NPV polyhedrin (25). The secondary structure analysis by Hopp and Wood (10) indicated that CPV polyhedrin as well as BmNPV polyhedrin are hydrophilic polypeptides (Fig. 6) and rich in ,-sheet and turn structures as expected from an ability to aggregate into a polyhedron complex. These two polyhedrins, however, are dissimilar in details of their secondary structure. CPV SP RNA. Our preliminary hybridization experiments showed that the SP RNA relates to the polyhedrin gene. Indeed, the nucleotide sequence analysis revealed that CPV SP RNA consists of two identical subset regions of the polyhedrin gene. Namely, the 5'-terminal 121 bases and the 3'-terminal 200 bases of the SP gene were identical to the respective areas of the polyhedrin gene. These regions are shown in Fig. 5 in bold face. This small RNA is apparently formed from the polyhedrin gene by deletion of the internal 621 bases. At present, the mechanism for the formation of the SP gene is unclear; however, the 5' and 3' halves of SP gene were apparently linked at the overlapping two ATs at residues 120 to 121 and 742 to 743 by losing one base, NA

_r

*~~~~~~~~~~~

.

A

FIG. 4. Characterization of cloned cDNAs of SP RNA. cDNAs prepared from the isolated SP RNA were cloned into the PstI site of pBR322. Three SP cDNA clones which hybridized with the 32Plabeled polyhedrin RNA probe were digested with PstI, and the length of inserts was analyzed by 1% agarose gel electrophoresis. cDNA clone 12 was chosen for extensive analysis of the nucleotide sequence.

214

J. VIROL.

ARELLA ET AL. cap site I

50

AGTAAAAGTCAGTATCTTACCGGCATAATACGTAAAGGATC ATG 6CA GAC GTA GCA GGA ACA AGT ARC Met Ala Asp Val Ala Gly Thr Ser Asn

100 CGA GAC m CGC GGA CGC GA CAR AGA CTA TTC ART AGC GA CAR TAC ARC TAT AAC AAC Arg Asp Phe Arg Gly Arg Glu Gln Arg Leu Phe Asn Ser Glu Gln Tyr Asn Tyr Asn Asn 150 AGC TTG AAC GGA GM GTG AGC GTG TGG GTA TAC GCA TAC TAC TCA GAC GGG TCT GTA CTC Ser Leu Asn Gly Glu Val Ser Val Trp Val Tyr Ala Tyr Tyr Ser Asp Gly Ser Val Leu

200 GTA ATC AAC AAG AAC TCG CAA TAC AAG GTT GGC ATT TCA GAG ACA TTC AAG GCA CTT AAG Val Ile Asn Lys Asn Ser Gln Tyr Lys Val Gly Ile Ser Glu Thr Phe Lys Ala Leu Lys 300 250 GM TAT CGC GAG GGA CAA CAC MC GAC TCT TAC GAT GAG TAT GM GTG MT CAG AGC ATC His Ser Glu Glu Gln Asn Glu Val Glu Tyr Arg Asn Gln Ser Ile Gly Asp Tyr Asp Tyr 350 TAC TAT CCT AAC GGC GGT GAC GCT CGC AM TTC CAT TCA AAT GCT AM CCA CGC GCG ATC Tyr Tyr Pro Asn Gly Gly Asp Ala Arg Lys Phe His Ser Asn Ala Lys Pro Arg Ala Ile

400 CAG ATC ATC TTC AGT CCT AGT GTG AAT GTG CGT ACT ATC AAG ATG GCT AAA GGC AAC GCG Gln Ile Ile Phe Ser Pro Ser Val Asn Val Arg Thr Ile Lys Met Ala Lys Gly Asn Ala

450 GTA TCC GTG CCC GAT GAG TAC CTA CAG CGA TCT CAC CCA TGG GAA GCG ACC GGA ATC MG Val Ser Val Pro Asp Glu Tyr Leu Gln Arg Ser His Pro Trp Glu Ala Thr Gly Ile Lys 500 TAC CGC AAG ATT AAG AGA GAC GGG GAA ATC GTT GGT TAC AGC CAT TAC TTT GAA CTA CCC Tyr Arg Lys Ile Lys Arg Asp Gly Glu Ile Val Gly Tyr Ser His Tyr Phe Glu Leu Pro

550 600 CAT GAA TAC AAC TCC ATC TCC CTA GCG GTA AGT GGT GTA CAT MG MC CCA TCA TCA TAC His Glu Tyr Asn Ser Ile Ser Leu Ala Val Ser Gly Val His Lys Asn Pro Ser Ser Tyr 650 AAT GTC GGA TCA GCA CAT AAC GTA ATG GAC GTC TTC CAA TCA TGC GAC TTG GCT CTC AGA Asn Val Gly Ser Ala His Asn Val Met Asp Val Phe Gln Ser Cys Asp Leu Ala Leu Arg 700 TTC TGC AAC CGC TAC TGG GCC GAA CTC GAA TTG GTG AAC CAC TAC ATT TCG CCG MC GCC Phe Cys Asn Arg Tyr Trp Ala Glu Leu Glu Leu Val Asn His Tyr Ile Ser Pro Asn Ala 750 TAC CCA TAC CTC GAT ATT AC ART CAT AGC TAT 66A GTA GCT CTG AGT ARC CGT CAG TGA Tyr Pro Tyr Leu Asp Ile Asn Asn His Ser Tyr Gly Val Ala Leu Ser Asn Arg Gln

800

850

TTGCTCGTGTARCTTGGATACCGGARCACATGACGCTGTGATGMATACGCGCCCGGTCTTCGGATAGGGTGACGCTCT 900

ACCTGCGCCAACAGGATATCGAAAAATTATACCGGATCCCGATGCTGACGGGATGCGGTACTGACTGACCGTTAGCC FIG. 5. Nucleotide sequence of CPV polyhedrin gene and the predicted amino acid sequence of polyhedrin polypeptide. Sequences shown in bold face are those present in SP RNA. Two ATs at regions 120 to 121 and 742 to 743 overlap upon ligation. The underlines indicate possible N-linked glycosylation sites. (This sequence was presented in the poster session of the 6th International Congress of Virology, September 1984. For convenience, uracil residues in the RNA sequence are represented by T.)

either A or T. The neighboring sequences are rich in A and AA-pyrimidine. The 5'-half donor fragment contains GAACAATACAACTATAACAAC, and the 3'-half acceptor fragment contains GATATTAACAAT. Interestingly, the junction of the two fragments does not cause a change in the coding frame for the remainder of the original coding region of polyhedrin. Therefore, the transcripts of SP dsRNA can code for a small polypeptide of 41 amino acid residues whose N-terminal 27 amino acids and C-terminal 14 amino acids are identical to those of mature polyhedrin. A schematic representation for the generation of the deletion mutant gene is presented in Fig. 7. A similar observation has recently been reported by Nuss and Summers (19) for wound tumor virus genome segment 12. CPVs are classified into 12 types in which BmCPV is designated type 1 (1). CPV genome RNAs extracted from purified type 2, 5, and 11 viruses were analyzed for the

presence of small subgenomic RNA by agarose gel electrophoresis (Fig. 8). However, there were no small subgenomic dsRNA species present, at least in CPV type 2 and 11 genome RNAs, that could be detected by ethidium bromide

staining. Transcription of CPV SP gene by virus-associated transcriptase. To examine whether the CPV SP gene is transcribed by a virus-associated RNA polymerase, we performed the in vitro transcription as described before (28). The purified CPV was incubated in a transcription reaction mixture that contained [o-32P]UTP. Viral mRNAs synthesized and released from virus particles were resolved by 8% polyacrylamide gel electrophoresis in the presence of 7 M urea. A distinct RNA band of low molecular weight comigrated with the heat-denatured SP RNA, in addition to mRNAs of high molecular weight which correspond to genomic segments 1 to 10 (Fig. 8). These results demonstrated that subgenomic

CYTOPLASMIC POLYHEDROSIS VIRUS POLYHEDRIN

VOL. 62, 1988

215

TABLE 1. Amino acid composition (%) of polyhedrin proteins of insect viruses Amino acid

BmCPVU

BmCPVb

A. californica NPV

BmNPV

0. pseudotsugata NPV

Glycine Alanine Valine Leucine Isoleucine Methionine Phenylalanine Tryptophan Proline Serine Threonine Asparagine Glutamine Cysteine Aspartic acid Glutamic acid Lysine Histidine Arginine Tyrosine

6.0 6.5 8.1 5.2 5.2 1.2 3.2 1.2 3.6 10.5 1.6 9.7 3.6 0.8 4.4 6.0 4.8 3.6 5.6 8.9

2.9 4.8 8.7 7.3 6.3 1.4 6.1 2.2 3.1 7.4 2.4

4.9 4.9 8.2 6.9 5.7 2.4 5.7 1.6 6.9 3.7 4.5 5.7 1.6 1.2 6.1 8.6 7.8 2.0 5.3 6.1

4.9 4.1 7.3 7.3 6.5 2.9 4.9 2.0 6.1 4.1 4.1 7.3 2.0 0.8 4.9 9.0 8.6 2.0 4.5 6.5

4.5 4.9 7.7 7.7 5.3 2.4 5.3 1.2 6.5 4.5 4.1 6.5 1.6 1.2 4.5 9.8 6.9 2.8 6.1 6.5

Total residues

248

245

245

246

0.7 12.6c

1O.9d 5.7 2.3 5.8 9.2

Amino acid composition predicted from cloned polyhedrin cDNA described in this study. Data from Kawase (13). ' Value represents the sum of aspartic acid and asparagine. d Value represents the sum of glutamic acid and glutamine.

a

b

SP dsRNAs are transcribed by a virus-associated RNA polymerase. DISCUSSION Several polyhedrin genes of DNA containing NPV have previously been cloned and characterized (9, 11, 16, 24). The CPV polyhedrin gene, on the other hand, has not been elucidated at the molecular level, perhaps because of the difficulty in handling its dsRNA genomes by recombinant DNA technology. Successful approaches in the conversion of dsRNA to dscDNA shown for human reovirus (2) and rotavirus (12) made the analysis of the CPV polyhedrin gene possible at the DNA level. In this report, we showed the entire nucleotide sequence of the CPV polyhedrin gene after the cDNA was cloned in E. coli plasmid pBR322. The 5'-terminal 23-mer and 3'-terminal 20-mer of genome dsRNA segment 10 that had previously been determined by the limited RNA sequencing procedure (15) are identical to the present sequence established by DNA sequencing. The predicted amino acid sequence is consistent with the amino acid composition data obtained previously by Kawase (13) from purified BmCPV polyhedrin (Table 1). The molecular weight of polyhedrin (28,500) predicted from the cloned cDNA sequence is in agreement with that estimated by the electrophoretic mobility in sodium dodecyl sulfate-polyacrylamide gels (21). The glycosylation of CPV polyhedrin has previously been suggested, based on positive color reactions with periodic acid-Schiff reagent (20). The predicted polyhedrin sequence contains four possible N-linked glycosylation sites (Fig. 5). However, it is not likely that these sites are used for glycosylation since there is no apparent transmembrane signal peptide present in the polyhedrin sequence and the apparent molecular weight (28,000) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis is virtually the same as that of nonglycosylated polyhedrin (28,500) predicted here from the defined nucleotide sequence. Moreover, we have recently produced

the polyhedrin polypeptide in E. coli cells by transfection of an expression plasmid containing the polyhedrin gene. The nonglycosylated polyhedrin molecules synthesized in E. coli cells (which do not have a glycosylation capacity) comigrated in the sodium dodecyl sulfate-polyacrylamide gels with the authentic polyhedrin prepared from virus-infected B. mori cells (C. Lavallee and Y. Furuichi, unpublished

data). Conservation of amino acid sequences is found among NPV polyhedrins (24), perhaps because NPV strains which infect various insects are genetically related. No homology, however, was found between CPV polyhedrin and NPV polyhedrins, although polyhedrins of both viruses consist of 3

2

1, 0 -1-

1I y

d r 0

p

a

t h

-2-

-3 -4 3 2B

0 -1-

-2 -3 -4

50

100 150 Residue Number

200

250

FIG. 6. Comparison of secondary structure of polyhedrins of BmCPV and BmNPV. The hydropathy profiles of BmCPV (A) and BmNPV (B) determined by Hopp and Wood (10) were compared.

216

ARELLA ET AL.

J. VIROL.

Polyhedrin RNA

AACAATACAAC A ACAAC----------TTAC

I

TTAACAAT

SP RNA A

AAACAACTT TTAACAAT.

FIG. 7. Schematic representation of the generation of SP RNA from the polyhedrin gene. The two ATs in boxes in polyhedrin RNA indicate the deletion breakpoints. It is not known which AT (or which A or T) survives the deletion event and is present in SP RNA. The lines over the polyhedrin sequence show the AA-pyrimidine repeated in this particular region. For simplicity, only the strands of positive polarity (same as mRNA strand) are illustrated.

a polypeptide of similar molecular weight (28,000) and form a morphologically similar crystalline structure. During our studies, we found that BmCPV contains a small polyhedrin-related genome dsRNA. Nucleotide sequence analysis revealed that the small dsRNA is a deletion Molecular

CPV types

Marker

11

5

2

1

Molecular size (bp)

23222028-

mutant, or remnant RNA, derived from the polyhedrin gene. The two deletion breakpoints are located about 120 bases from the 5' terminal and 200 bases from the 3' terminal of the polyhedrin gene. The regions including these sites are rich in A and AA-pyrimidine residues. To examine whether these two regions can form a base-paired configuration that could permit viral RNA polymerase (or replicase) to skip the intervening coding sequence during replication, we performed a dyad symmetry search with the Intelligenetics computer program. No significant array of base pairings, however, was found between the two regions. The mechanism of genomic replication of CPV has not been well studied, but it is believed to be similar to that involved for human reovirus, the prototype of the Reoviridae. The replication of genomic dsRNA includes the synthesis of single-stranded RNAs with positive polarity from a dsRNA template. This process is catalyzed by a virusassociated RNA polymerase often referred to as transcriptase. These single-stranded RNAs are then converted to

1057-

770-

612495392-

343294-

210-

FIG. 8. Absence of small subgenomic RNA in the genome RNAs from other types of CPV. Genome RNAs extracted from type 2, 5, and 11 CPVs were analyzed for the presence of small subgenomic RNA by 1% agarose gel electrophoresis. As controls, molecular markers (lanes 1 and 2) and genome RNA of type 1 CPV (right-end lane) were run in parallel. The gel was stained with ethidium bromide. The amounts of RNA loaded onto the gel for CPV type 2 and 11 are high enough to detect small subgenomic RNA, although the amount of CPV type 5 RNA is apparently too low to assess the presence of small RNA. An arrow indicates the migration position of SP RNA of type 1 CPV.

FIG. 9. Analysis by gel electrophoresis of CPV mRNA synthesized in vitro by virus-associated transcriptase. The in vitro CPV transcription was done as described in Materials and Methods, arnd the [32P]UMP-labeled transcripts were resolved on a 10% polyacrylamide sequencing gel. The 3'-[3PIpCp-1abe1ed dsRNA was heat denatured and run in parallel as a reference (lane B). The arrow indicates a faint, but discrete, RNA transcript synthesized by CPV-associated RNA polymerase.

CYTOPLASMIC POLYHEDROSIS VIRUS POLYHEDRIN

VOL. 62, 1988

dsRNAs by a RNA-dependent RNA polymerase, the replicase. The mechanism responsible for the generation of deletion mutant dsRNA is not clear at present; however, it most likely proceeds by a deletion caused by a copy-choice mechanism involving the intramolecular or intermolecular "jumping" of the viral transcriptase-replicase. There is no evidence of splicing events for genome dsRNAs or their transcripts. The generation of terminally conserved mutant dsRNA gene by internal deletion events has been previously reported for Saccharomyces cerevisiae virus (29) and wound tumor virus genome RNA (19). Additionally, terminal sequences are conserved in the formation of defective interfering RNA genomes of Sendai virus (23), Sindbis virus (17), and influenza virus (3). In all these systems, the internal deletion yielded genomic RNAs that were functional with respect to transcription, replication, and packaging. Indeed, the CPV SP RNA gene is apparently viable in replication and packaging into virus particles since it is present in the purified virus. In addition, the SP RNA gene can be transcribed by virus-associated RNA polymerase (Fig. 9). These observations indicate that the conserved terminal sequence of 321 bases present in CPV SP RNA contain all the recognition signals required for virus genome replication and packaging into virus particles. Apart from SP RNA, there seem to be small deletion mutants generated from other genomic segments, since the labeled small RNA fraction could hybridize also with CPV segments 1, 2, and 3 (Fig. 2A). The results suggest that the SP RNA is a mixture of deletion mutants in which the polyhedrin-related gene is, for some unknown reason, most abundant. It will be important to determine and compare the minimal sequence requirements of these deletion mutants to understand the molecular mechanism of CPV genome replication and packaging. ACKNOWLEDGMENT We thank Mariko Shida for excellent assistance in preparation of the manuscript. LITERATURE CITED 1. Asamizu, T., D. Summers, M. B. Motika, J. V. Anzola, and D. L. Nuss. 1985. Molecular cloning and characterization of the genome of wound tumor virus: a tumor-inducing plant reovirus. Virology 144:398-407. 2. Cashdollar, L. M., J. Espoza, G. R. Hudson, R. Chmelo, P. N. K. Lee, and W. K. Joklik. 1982. Cloning the doublestranded RNA genes of reovirus: sequence of the cloned S2 gene. Proc. Natl. Acad. Sci. USA 79:7644-7648. 3. Davis, A., A. L. Hiti, and D. P. Nayak. 1980. Influenza defective interfering viral RNA is formed by internal deletion of genomic RNA. Proc. Natl. Acad. Sci. USA 77:215-219. 4. Fujii-Kawata, I., K.-I. Miura, and M. Fuke. 1979. Segments of genomes of viruses containing double-stranded ribonucleic acid. J. Mol. Biol. 51:247-253. 5. Furuichi, Y. 1974. "Methylation-coupled" transcription by virus-associated transcriptase of cytoplasmic polyhedrosis virus containing double-stranded RNA. Nucleic Acids Res. 1: 809-822. 6. Furuichi, Y., and K.-I. Miura. 1973. Identity of the 3'-terminal sequences in ten genome segments of silkworm cytoplasmic polyhedrosis virus. Virology 55:418-425. 7. Furuichi, Y., and K.-I. Miura. 1975. A blocked structure at the 5'-terminus of mRNA of cytoplasmic polyhedrosis virus. Nature (London) 253:374-375. 8. Grunstein, M., and D. Hogness. 1975. Colony hybridization: a method for the isolation of cloned DNAs that contain a specific

217

gene. Proc. Natl. Acad. Sci. USA 72:3961-3965. 9. Hooft van Iddekinge, B. J. L., G. E. Smith, and M. D. Summers. 1983. Nucleotide sequence of the polyhedrin gene of Autographa californica nuclear polyhedrosis virus. Virology 131: 561-565. 10. Hopp, T. P., and K. R. Wood. 1981. Prediction of protein antigenic determinants from amino acid sequences. Proc. Natl. Acad. Sci. USA 78:3824-3828. 11. Iatrou, K., K. Ito, and H. Witkiewicz. 1985. Polyhedrin gene of Bombyx mori nuclear polyhedrosis virus. J. Virol. 54:436445. 12. Imai, M., M. A. Richardson, N. Ikegami, A. J. Shatkin, and Y. Furuichi. 1983. Molecular cloning of double-stranded RNA viral genomes. Proc. Natl. Acad. Sci. USA 80:373-377. 13. Kawase, S. 1964. The amino acid composition of viruses and their polyhedron proteins of the polyhedroses of the silkworm, Bombyx mori (Linnaeus). J. Insect Pathol. 6:156-163. 14. Kozak, M. 1981. Possible role of flanking nucleotides in recognition of the AUG initiator codon by eukaryotic ribosomes. Nucleic Acids Res. 9:1111-1121. 15. Kuchino, Y., S. Nishimura, R. E. Smith, and Y. Furuichi. 1982. Homologous terminal sequences in the double-stranded RNA genome segments of cytoplasmic polyhedrosis virus of the silkworm Bombyx mori. J. Virol. 44:538-543. 16. Leisy, D., M. Nesson, M. Pearson, G. Rohrmann, and G. Beaudreau. 1986. Location and nucleotide sequence of the

Orgyia pseudotsugata single nucleocapsid nuclear polyhedrosis virus polyhedrin gene. J. Gen. Virol. 67:1073-1079. 17. Levis, R., B. G. Weiss, M. Tsiang, H. Huang, and S. Schlesinger. 1986. Deletion mapping of Sindbis virus DI RNAs derived from cDNAs defines the sequences essential for replication and packaging. Cell 44:137-145. 18. Maxam, A. M., and W. Gilbert. 1977. A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74:560-564. 19. Nuss, D. L., and D. Summers. 1984. Variant dsRNAs associated with transmission-defective isolates of wound tumor virus represent terminally conserved remnants of genome segments. Virology 133:276-288.

20. Payne, C. C., and J. Kalmakoff. 1974. Biochemical properties of polyhedra and virus particles of cytoplasmic polyhedrosis virus of Bombyx mori. Intervirology 4:354-364. 21. Payne, C. C., and P. P. C. Mertens. 1983. Cytoplasmic polyhedrosis viruses, p. 425-504. In W. K. Joklik (ed.), The reoviridae. Plenum Publishing Corp., New York. 22. Payne, C. C., and C. F. Rivers. 1976. A provisional classification of cytoplasmic polyhedrosis viruses based on the sizes of the RNA genome segments. J. Gen. Virol. 33:71-81. 23. Re, G. G., E. M. Morgan, and D. W. Kingsbury. 1985. Nucleotide sequences responsible for generation of internally deleted Sendai virus defective interfering genomes. Virology 146:27-37. 24. Rohrmann, G. F. 1986. Review article: polyhedrin structure. J. Gen. Virol. 67:1499-1513. 25. Rohrmann, G. F., T. J. Bailey, B. Brimhall, R. R. Becker, and G. S. Beaudreau. 1979. Tryptic peptide analysis and NH2terminal amino acid sequences of polyhedrins of two baculoviruses from Orgyia pseudotsugata. Proc. Natl. Acad. Sci. USA 76:4976-4980. 26. Sanger, F., S. Nicklen, and A. F. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 27. Smith, R. E., and Y. Furuichi. 1980. Gene mapping of cytoplasmic polyhedrosis virus of silkworm by the full-length mRNA prepared under optimized conditions of transcription in vitro.

Virology 103:279-290.

28. Smith, R. E., M. A. Morgan, and Y. Furuichi. 1981. Separation of the plus and minus strands of cytoplasmic polyhedrosis virus and human reovirus double-stranded genome RNAs by gel electrophoresis. Nucleic Acids Res. 9:5269-5286. 29. Thiele, D. J., E. M. Hannig, and M. J. Leibowitz. 1984. Genome structure and expression of a defective interfering mutant of the killer virus of yeast. Virology 137:20-31. 30. Thomas, P. S. 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77:5201-5205.