Molecular detection of Candida krusei ... - Wiley Online Library

Journal of Applied Microbiology 2003, 95, 13–22

Molecular detection of Candida krusei contamination in fruit juice using the citrate synthase gene cs1 and a potential role for this gene in the adaptive response to acetic acid G.D. Casey1,2 and A.D.W. Dobson1 1

Department of Microbiology, and 2National Food Biotechnology Centre, University College, Cork, Ireland

2002/435: received 6 November 2002, revised 10 February 2003 and accepted 14 February 2003

ABSTRACT G . D . C A S E Y A N D A . D . W . D O B S O N . 2003.

Aims: To develop a reverse transcription–polymerase chain reaction (RT–PCR) assay to detect viable Candida krusei contaminations and examine the potential role of the citrate synthase (cs1) gene in adaptation to acetic acid. Methods and Results: Fruit juice artificially contaminated with C. krusei cells was heat treated to inactivate the yeast cells, after which the improved ability of the RT–PCR over the PCR assay, through the amplification of the cs1 gene, to differentiate viable contaminations was shown. The sensitivity of the detection assay was 6 · 104 CFU ml)1. RT–PCR and densitometric analysis of the cs1 gene throughout the process of adaptation to acetic acid highlighted a potential role for the gene in the yeast’s adaptive response. Conclusions: The RT–PCR assay through the targeting of the cs1 gene proved to be a specific, sensitive and direct method for the identification of a C. krusei contamination in a food environment. The cs1 gene was shown to play a potential role in the adaptation of the culture to the weak-acid preservative acetic acid. Significance and Importance of the Study: The development of a direct, sensitive and specific identification assay for C. krusei from a food environment and understanding the mechanism employed in adapting to a preservative challenge, represent important tools to the food industry in attempting to limit spoilage by this important food spoilage yeast. Keywords: acetic acid adaptation, Candida krusei, cs1, RT–PCR detection.

INTRODUCTION Yeasts have been implicated in the spoilage of a diverse range of foods including fresh and processed fruits and vegetables, bakery products, alcoholic beverages, dairy products, cereals, grains, seafood products, together with fermented and acid-preserved foods (Fleet 1992; Dea´k and Beuchat 1996). The effects of yeast spoilage account for substantial financial losses, both directly through loss of the food product and indirectly through recall of the affected product, loss of consumer confidence and support, as well as

Correspondence to: A.D.W. Dobson, Department of Microbiology, University College, Cork, Ireland (e-mail: [email protected]).

ª 2003 The Society for Applied Microbiology

potential compensation and legal costs (Fleet 1992). Although yeast borne food spoilage can significantly affect the appearance and organoleptic properties of the particular food, they also possess apparent health risks; with recent reports highlighting their potential role in gastroenteritis outbreaks and in the development of allergies, thus serving to raise public awareness to the presence of yeasts in foods, spoilage or otherwise (Fleet 1992; Loureiro and Querol 1999). Measures employed to limit the threat of yeast food spoilage, such as chemical preservatives and in particular the weak organic acid type preservatives (e.g. acetic, benzoic and sorbic acid) are being undermined by legislation restricting their use and levels within particular foods (Doores 1983; Liewen and Marth 1985). In addition the existence of

14 G . D . C A S E Y A N D A . D . W . D O B S O N

certain yeast species which possess the ability not only to tolerate these preservatives, but also to adapt to concentrations above those legally permitted, presents the food industry with a major problem (Mozˇina and Raspor 1997; Brul and Coote 1999). While much of the work carried out to date in relation to preservative resistant yeasts has focused on the resistance and adaptive responses of Zygosaccharomyces bailii (Warth 1977; Thomas and Davenport 1985; Mollapour and Piper 2001), Saccharomyces cerevisiae (Piper et al. 1998, 2001) and Candida lipolytica (Battey et al. 2002), the spoilage and resistant capabilities of another yeast, Candida krusei warrants further investigations. Candida krusei possesses a range of properties enabling it to tolerate the conditions encountered in foods resulting in their subsequent spoilage. A tolerance for low pH environments and preservative concentrations has facilitated the spoilage of acid preserved food, where the fermentation of available sugars including, glucose and sucrose can result in excessive CO2 formation leading to bloating and rupturing of packaging. In addition, C. krusei spoilage is often characterized as a surface-growing film-forming yeast on foods, with a range of proteolytic and lipolytic activities making the yeast problematic to fruit concentrates, alcoholic beverages and a range of dairy products (Dea´k and Beuchat 1996; Pitt and Hocking 1997). The ability of a range of preservative resistant yeasts to overcome preservatives levels in excess of those legally permitted, has prompted the development of improved detection and identification systems (Loureiro 2000). These new systems need to be able to provide rapid and accurate identification to enable appropriate intervention measures to be taken, thereby providing insights into the source of contamination as well as limiting the potential for spoilage and associated economic or health concerns. In this respect the move toward molecular based approaches, offering greater reproducibility, sample analysis and discriminatory power, is continuing with the application of methods such as mitochondrial DNA restriction analysis (Querol et al. 1992; Esteve-Zarzoso et al. 2001), polymerase chain reaction (PCR) based methods employing specific (Ibeas et al. 1996) and random primers (Baleiras Couto et al. 1996), and PCR ribotyping (Dlauchy et al. 1999; Esteve-Zarzoso et al. 1999) in the detection and characterization of production and spoilage yeasts, proving particularly useful. In this study we employed a reverse transcription (RT)–PCR approach to monitor and differentiate between viable and non-viable contaminations by C. krusei in a contaminated fruit juice product. The identification and cloning of a specific target gene, citrate synthase (cs1) from C. krusei, which encodes an enzyme central to cellular activity facilitated the analysis. We also report on a potential role for the cs1 gene in the adaptive response of C. krusei to acetic acid.

MATERIALS AND METHODS Culture, media and culture conditions The yeast culture C. krusei ATCC 2159 was obtained from the American Type Culture Collection, (MD, USA) and grown in a 2% (w/v) malt extract broth (MEB) solution at 30C. Cultures were maintained at 4C on malt extract agar (MEA) plates, comprised of 2% MEB solidified with 2% (w/v) technical agar. All media was obtained from Difco Laboratories. Apple juice was contaminated with serial dilutions of C. krusei cells in one-quarter-strength Ringers solution with cell numbers determined by spread plating (0Æ1 ml) dilutions onto MEA and incubated at 30C overnight. Yeast cells were extracted from apple juice by washing in phosphate-buffered saline pH 7Æ4 (Sambrook et al. 1989) and centrifuged for 5 min at 2000 · g (Beckman Coulter AllegraTM 2Æ1, Bucks, UK), prior to DNA and RNA extraction. DNA preparation Total DNA was isolated from overnight C. krusei cultures by a rapid method previously described by Coakley et al. (1996). DNA was resuspended in Tris–ethylenediamine tetra acetic acid (TE) buffer (10 mmol l)1 Tris/1 mmol l)1 EDTA) and stored at )20C. The integrity of the extracted DNA was assessed by electrophoresis in a 1% agarose gel and the DNA concentration was measured spectrophotometrically at 260 and 280 nm. PCR amplification PCR amplification was preformed in the Peltier PTC-200 programmable thermal controller (M.J. Research, Watertown, MA, USA). The reactions were carried out in 20 ll volumes containing 2 ll of genomic DNA, 100 lmol l)1 (each) deoxynucleoside triphosphate (dNTP; Roche, Mannheim, Germany), 1X NH4 Taq buffer, 1Æ5 mmol l)1 MgCl2 and 1Æ25 U Taq polymerase as per the manufacturer’s instructions (Bioline, London, UK), together with 25 pmol l)1 of each citrate synthase specific primer after which reaction volumes were adjusted to the final volume with high-performance liquid chromatography grade water. PCR conditions comprised of an initial denaturation of 95C for 5 min, followed by 30 cycles of denaturation (1 min at 95C), annealing (1 min at 59C), extension (1 min at 72C), with a final extension of 72C for 10 min. A 10-ll aliquot of each of the PCR products was analysed by electrophoresis with 1Æ2% agarose gel in Tris–acetate–EDTA buffer (40 mmol l)1 Tris–acetate, 1 mmol l)1 EDTA) together with an appropriate molecular weight ladder, following which the gel was stained with ethidium bromide. All primers were designed with the aid of the PrimerSelect

ª 2003 The Society for Applied Microbiology, Journal of Applied Microbiology, 95, 13–22

C. KRUSEI DETECTION AND ADAPTATION

package (DNAStar Inc., Madison, WI, USA) and synthesized by Sigma-Genosys (Cambridge, UK). Cloning of a citrate synthase gene from Candida krusei The oligonucleotide primers CS Fwd and CS Rev (Table 1) designed to a conserved region of previously sequenced yeast citrate synthase genes were used to amplify an internal 617-bp fragment of a citrate synthase (cs1) gene from C. krusei. Upstream sequence to the ATG start site was obtained by the single-specific primer (SSP) PCR procedure described by Shyamala and Ames (1989). Briefly, C. krusei genomic DNA was digested with the restriction enzymes Hind III, which cuts within the 617-bp cs1 fragment, and BamH I which cuts outside the cs1 fragment, generating a range of differently sized fragments incorporating the cs1 fragment and additional flanking sequence. Size restricted fragments (0Æ7–3Æ0 kb) were ligated into a compatibly digested pUC18 cloning vector, and additional flanking DNA was amplified with a combination of a vector specific primer (pUCFwd2) (Table 1) and a SSP1 (Table 1) from the cs1 internal fragment. Amplified sequences were screened using a combination of internal primers SSP1 and CS Fwd (Table 1), prior to clones being sent for sequencing. Downstream sequence to the TAA stop site was obtained in a two-step PCR method for the isolation of unknown flanking DNA described by Sørensen et al. (1993). The method briefly involved the following steps: (i) PCR using a biotinylated cs1-SSP5 (Table 1) and one of four partly Table 1 Nucleotide sequence and location of primers used in the amplification of cs1 gene from Candida krusei Primer

Nucleotide sequence (5¢–3¢)

Location*

CS Fwd CS Rev SSP 1 SSP 2 SSP 4 SSP 5 PUCFwd2 FP§ 1/2/3/4

GCATATGGTGGTATGAGAGG AGCAGAAACATTACCACCTTC GGTTCACTACTACCTTCAGCCT GCGAAGGCTTATGCTGATGG GAAGGAATACTGGAAATACACT CACCCAATGGCCCAATTCTC GTTGTGTGGAATTGAGAGCGG CAGTTCAAGCTTGTCCAGGAAT TCNNNNNNN/GGCCT/GCGCT/ CCGGT/CGCGT

166–185 780–760 305–284 508–527 537–558 451–470 – –

*Location of primers within the C. krusei cs1 gene, accession no. AY126274. SSP5 primer was biotinylated at the 5¢ end. pUC18 cloning vector, accession no. L08752. §Non-degenerate form of FP in bold. FP 1/2/3/4 contained the corresponding 5 nucleotides at the extreme 3¢ end of the primer (Sørensen et al. 1993).

15

degenerate, arbitrary flanking primers (FP) (Table 1) containing a fixed 3¢ end, which will hybridize within a statistically defined range in the cellular DNA flanking the cs1 fragment; (ii) purification of the PCR products generated from the biotinylated cs1-specific primer through the use of streptavidin-coated magnetic beads; (iii) a second PCR using the purified biotinylated products from the first PCR as templates and employing a nested cs1-SSP2 together with a non-degenerate form of the FP primer (Table 1). Products were screened with the internal cs1 primers, SSP4/CS Rev (Table 1), prior to cloning into the pCR 2Æ1 TOPO vector (Invitrogen, Groningen, the Netherlands) and sequencing. Sequencing of all products was undertaken by Lark Technologies, Inc. (Essex, UK). The sequence data generated was assembled and processed using the DNASTAR software package (DNAStar Inc.). The BLAST algorithm (Altschul et al. 1990) was used to search DNA and protein databases for gene similarities. The CLUSTAL program was used for alignment of amino acid sequences. RNA preparation Total RNA was isolated from C. krusei cultures using the commercial RNeasy Minikit according to the manufacturer’s protocol (Qiagen, Hilden, Germany). Following isolation, total RNA was eluted in 50 ll RNase-free water and treated with DNaseI, RNase-free (Roche) as per the supplier’s instructions and 20 U RNasin (Promega, Madison, WI, USA), to remove any residual DNA contamination and maintain the integrity of the mRNA. The integrity of the mRNA was determined by electrophoresis in a 0Æ8% agarose gel in Tris–borate–EDTA buffer (45 mmol l)1 Tris–borate, 1 mmol l)1 EDTA) and the RNA concentration measured spectrophotometrically at 260 and 280 nm. RNA was stored at )70C until further use. Reverse transcription One microgram of total RNA was reverse transcribed with 600 ng of random hexamer primer (Roche), 0Æ5 mmol l)1 (each) dNTP, 10 mmol l)1 DTT (Sigma), 1X Expand RT buffer (Roche), 20 U RNasin (Promega) and 50 U Expand reverse transcriptase (50 U ll)1). Reactions were adjusted to 20 ll with diethylpyrocarbonate treated demineralized water and incubated at 30C for 10 min, followed by 42C for 45 min to generate first strand cDNA. For PCR amplification, a 2 ll volume of each RT reaction mixture was used as the template in a 20 ll reaction together with the primer pair CS Fwd/CS Rev (Table 1) at an annealing temperature of 59C, as previously outlined. A similar quantity of RNA (2 ll) (DNase treated) was used in a PCR amplification to serve as a control for an absence of DNA contamination.



RT–PCR differentiation of normal and heat inactivated cultures Heat inactivated cultures of C. krusei were subjected to a heat treatment of 62C for 10 min prior to nucleic acid isolation (DNA and RNA), while normal cultures remained untreated prior to nucleic acid extraction. PCR and RT–PCR analysis was carried out as previously described using the CS Fwd/CS Rev primer pair (Table 1) at an annealing temperature of 59C. Products were visualized by electrophoresis in a 1Æ5% agarose gel in Tris–acetate–EDTA buffer following ethidium bromide staining and UV illumination.

equal intensities because of reaching a plateau in amplification. Qualitative comparison of the RT–PCR products intensities was preformed by densitrometry analysis with the aid of the GelWorks 1D Intermediate analysis software (UVP Products, Cambridge, UK). Nucleotide sequence accession number The nucleotide sequence data reported in this paper has been submitted to GenBank and assigned the accession no. AY126274.

RESULTS Adaptation of C. krusei to an acetic acid preservative challenge

Isolation and analysis of a full length C. krusei citrate synthase

An overnight C. krusei culture was used to inoculate fresh broth (MEB), which was incubated at 30C to provide exponential phase cells for use in the acetic acid challenge. Triplicate samples were centrifuged (4500 · g for 6 min at 4C, Beckman Coulter AllegraTM 2Æ1), washed and re-suspended in an intermediate MEB acetic acid solution (acetic acid adaptation), containing 0Æ5% acetic acid (Merck, Darmstadt, Germany). Following a 2 h incubation period the cells were re-harvested and re-suspended in the test MEB acetic acid solution (1Æ5% acetic acid). Control cells (non-adapted) were re-suspended in MEB for a similar 2 h period prior to transfer to the test MEB acetic acid solution. Adapted and non-adapted cultures were incubated at 30C during which absorbance was monitored (Beckman DU-640 spectrophotometer, Bucks, UK) over a 6 day period and results plotted as O.D.600nm vs time (hours).

The cloning of the C. krusei citrate synthase gene cs1 involved the initial amplification of an internal fragment of 617 bp through the use of primers designed to a conserved region of previously sequenced yeast citrate synthase genes. From the cloning of the initial cs1 fragment the flanking regions were obtained in both the upstream direction to the ATG start site and downstream to the TAA stop site of the gene. Upstream sequence from the internal cs1 fragment was obtained by SSP-PCR (Shyamala and Ames 1989). A 715 bp sized product was identified by SSP-PCR and validity of the sequence confirmed by amplification of an internal 149 bp fragment prior to sequencing being undertaken. The sequence provided an additional 575 bp upstream from the CS Fwd primer site, with the ATG start site of the gene located at position 165 within this sequence. Sequence downstream from the 617 bp cs1 fragment was generated through the adaptation of the two-step PCR method for the isolation of flanking DNA as described by Sørensen et al. (1993). A 1300 bp fragment was identified, with the validity of the amplified fragment confirmed by the amplification of a 247 bp internal fragment. The sequence represented an additional 1075 bp downstream from the existing CS Rev primer site, with the TAA stop site being located at a position 591 bp within this sequence. Assembly of the nucleotide sequence from the putative ATG start site to the putative TAA stop site resulted in the identification of a 1Æ371 kbp open reading frame, which translated into a putative protein of 457 amino acids with a theoretical Mr of 50Æ8 kDa. Both the nucleotide sequence and the predicted amino acid sequence from the cs1 gene displayed a high degree of similarity to a number of other eukaryotic citrate synthase genes, with a level of similarity of between 72–53 and 76–68% being observed, respectively (Fig. 1). The highest level of similarity observed was to an organism belonging to another member of the Candida genus, namely C. tropicalis,

Expression of cs in acetic acid adaptation of C. krusei Twenty millilitre volumes of cells were taken from the different stages of the adaptation process of C. krusei cultures to the acetic acid preservative challenge: (i) the original C. krusei culture in MEB (no acetic acid); (ii) cultures which had undergone a 2 h adaptation to an intermediate noninhibitory acetic acid concentration (0Æ5%); (iii) cultures which were transferred to the test acetic acid concentration (1Æ5%) following the adaptation process; and (iv) cultures transferred to the test acetic acid concentration without prior adaptation at the intermediate acetic acid concentration [transferred directly from stages (i) to (iv)]. RNA was isolated from each of the cultures and RT–PCR analysis carried out as previously described using the CS Fwd/CS Rev primers (Table 1). The number of cycles used in the PCR amplification were varied to avoid reaching a point at which bands representing different conditions would have



17

C.k cs1 C.trop S.cer1 S.kluy S.cer2 S.cer3 A.nid Ac.aceti

C.k cs1 C.trop S.cer1 S.kluy S.cer2 S.cer3 A.nid Ac.aceti

Fig. 1 Comparison of the Candidu krusei citrate synthase (cs1) amino acid sequence with various yeast citrate synthase sequences. White letters on a dark background indicate amino acids common to the majority of the sequences. The amino acid sequences were either experimentally determined or deduced from the nucleotide sequences of C. tropicalis cs (C. trop) (Ueda et al. 1997), Saccharomyces cerevisiae cs (S. cer1) (Linder, P. Unpublished sequence in GenBank, accession no. Z23259 1993), S. kluyveri cs (S. kluy) (Langkjaer, R.B., Neilsen, M.L., Daugaard, P.R., Liu, W. and Piskur, J. Unpublished sequence in GenBank, accession no. AF193854 1999), S. cerevisiae cs (S. cer2) (Suissa et al. 1984), S. cerevisiae cit2 (S. cer3) (Rosenkrantz et al. 1986), Aspergillus nidulans citA (A. nid) (Park et al. 1997), and Acetobacter aceti aarA (Ac. aceti) (Fukaya et al. 1990)

(a) 1

2

3

(b) 4

2

3

4

603 bp

Fig. 2 Differentiation of viable and non-viable contamination by means of PCR and RT–PCR analysis of normal and heat inactivated cultures. (a) Cultures maintained under normal conditions and (b) cultures subjected to heat treatment of 62C for 10 min. Lane 2 represents PCR analysis, lane 3 RT–PCR analysis, and lane 4 PCR analysis of mRNA (control)

with similarities of 72 and 76% at the nucleotide and amino acid levels, respectively. However, comparison with a previously sequenced citrate synthase of prokaryotic origin, namely Acetobacter aceti (Fukaya et al. 1990), previously shown to play an important role in the resistance of the organism to acetic acid, was significantly lower with 25 and 20% identity at the nucleotide and amino acid level, respectively (Fig. 1).

Ability of the RT–PCR assay to differentially detect viable from non-viable yeast contamination We then decided to use the cs1 gene of C. krusei in a PCR based detection assay for the yeast. In addition, we combined this approach with an RT–PCR based assay to differentiate between viable and non-viable contamination by C. krusei, using mRNA and DNA extracted from both



live and heat inactivated yeast cells. After the initial validation of the assays in broth, the process was subsequently applied to a food system, namely fruit juice, which is prone to C. krusei spoilage. Candida krusei cells were subjected to alternative treatments prior to RT–PCR and PCR analysis, with one sample remaining untreated while, the other was subjected to the heat treatment process (62C for 10 min). In the case of the C. krusei cells which were untreated, thereby comprising live cells, isolation of mRNA and DNA resulted in the amplification of the expected 617 bp cs1 gene product following RT–PCR and PCR analysis, respectively (Fig. 2a, lanes 2 and 3). Similarly, in the second (heat treated) sample, PCR analysis of the isolated DNA resulted in the detection of the cs1 gene product (Fig. 2b, lane 2). Subsequent plating and enumeration of the yeast culture which had undergone the heat treatment process highlighted that, although a loss in the viability of these cells was observed, DNA stability was maintained and remained suitable for PCR analysis. Conversely, RT–PCR assays on mRNA from the heat inactivated cultures failed to amplify the cs1 gene product (Fig. 2b, lane 3), because of the rapid degradation of the mRNA gene transcripts associated with a loss of cell viability. Therefore the process of RT–PCR analysis proved to be useful in differentiating between viable and non-viable contaminations, in contrast to the PCR analysis alone, which proved inconclusive as to the viability of the contaminating organism. Confirmation of cs1 product amplification being solely because of the presence of viable cells and cDNA following RT–PCR and not because of the presence of contaminating DNA, was provided by the absence of a product following PCR analysis of the DNaseI treated RNA extraction (Fig. 2a,b, lane 4). The specificity of the detection system was tested by employing the cs1 primers in conjunction with DNA isolated from a number of other spoilage yeasts, including, Z. bailii, Z. rouxii and Rhodotorula glutinis, all of which failed to amplify a specific product (data not shown). Sensitivity of the RT–PCR assay To determine the sensitivity of the cs1 based RT–PCR assay system in the detection of a viable contamination within a food product; RT–PCR analysis was performed on mRNA isolated from serial dilutions of an overnight C. krusei culture artificially contaminated into fruit juice samples. Plating of samples from the overnight yeast culture and the artificially contaminated fruit juice allowed for an accurate determination of the level of contaminating cells within the fruit juice samples. Detection of the expected 617 bp cs1 gene product was evident initially in samples inoculated at a level corresponding to ca. 6 · 104 CFU ml)1 (Fig. 3, lane 3). Again, no signal was obtained following PCR analysis of

1

2

3

4

Fig. 3 Sensitivity of RT–PCR detection of viable contamination in apple juice contaminated with serial dilutions of Candida krusei cells. Lanes 1–4 represent dilutions of C. krusei cells ranging from 6 · 106 CFU ml)1 to 6 · 103 CFU ml)1, respectively. The ladder flanking the lanes 1–4 is a DNA molecular weight marker IX

the mRNA indicating that the product was solely because of RT–PCR amplification of the available mRNA transcripts (data not shown). RT–PCR analysis of cs1 gene expression during adaptation to the acetic acid preservative challenge The ability of C. krusei and other food spoilage yeasts to survive and tolerate organic acid food preservatives, such as acetic acid, is known to be greatly enhanced following their pre-exposure to an intermediate non-inhibitory preservative concentration prior to a challenge at a higher concentration. Exposure of exponential phase C. krusei cells to such an adaptation process resulted in a marked ability of these cells to overcome the higher inhibitory acetic acid challenge (1Æ5%), exhibiting continued growth on transfer to the test concentration. In contrast, cells which did not undergo the adaptation process failed to exhibit a subsequent increase in initial cell density throughout the 6 day period of monitoring, following their transfer to the test acetic acid concentration (Fig. 4). Adaptation of C. krusei to the organic acid preservative, acetic acid, was assessed by monitoring of cs1 gene expression through the various stages of the acetic acid adaptation process, by RT–PCR assays. The original C. krusei culture growing in MEB (without an acetic acid challenge) represented a basal level of cs1 gene expression (Fig. 5a, lanes 1-3). Adaptation of the C. krusei culture following exposure to the intermediate non-inhibitory preservative concentration (0Æ5% acetic acid) for a 2 h period resulted in a 60% increase in cs1 expression over basal levels (Fig. 5b, lanes 4–6). Subsequent transfer of the preadapted cultures to the test acetic acid challenge (1Æ5% acetic acid) resulted in similar levels of cs1 expression being observed (Fig. 5c, lanes 7–9), as those observed following exposure to the non-inhibitory acetic acid concentration (Fig. 5b, lanes 4–6). In contrast, cultures transferred directly from the initial MEB environment to the test



environmental conditions (low pH, low aw, preservatives and oxygen tension) together with a number of metabolic activities (carbohydrate metabolism, protein and polysaccharide hydrolysis) makes yeasts exquisitevly equipped to spoil an extensive range of different foods (Fleet 1992; Dea´k and Beuchat 1996). One of the primary defences employed to prevent yeast spoilage has been the use of chemical preservatives, which have proved both cost-effective and safe in the control of most yeast spoilage (Warth 1986). However, problems do exist in relation to preservatives in that a number of yeast species exist which are capable of tolerating and adapting to concentrations in excess of those legally permitted (Brul and Coote 1999). Therefore, if measures to control yeast food spoilage are proving inadequate, the industry must be able to rapidly and accurately detect the presence of the yeast contamination at the earliest possible stage, thereby allowing for appropriate intervention measures to be taken and, limiting potential economic and health affects. In this respect C. krusei is a species which deserves examination because of its metabolic and preservative resistant capabilities. The advent of molecular based approaches have allowed for improvements to be made in terms of the time-scale, applicability, reproducibility and discriminatory power of identification methods (Dea´k 1995; Loureiro 2000). The reliance of such methods on various aspects of DNA analysis offers an independence from gene expression and therefore less of a dependence on phenotypic characteristics, which may be environmentally influenced (Mozˇina and Raspor 1997). In developing a molecular based approach capable of discriminating viable from non-viable contaminations for the food spoilage yeast C. krusei, the choice of a suitable target gene is important. The cs1 gene encoding the enzyme citrate synthase was chosen, which plays an important role in the control of essential metabolic pathways such as the tricarboxylic acid (TCA) and glyoxylate cycle; both of which

4·8 4

O.D. 600 nm

3·2 2·4 1·6 0·8 0 0

24

48

72

96

120

144

Time (h)

Fig. 4 Growth of exponential phase Candida krusei cultures in the test acetic acid concentration (1Æ5%): (h) cultures transferred directly to the test acetic acid concentration without adaptation, (j) cultures adapted for a 2 h period at an intermediate acetic acid concentration (0Æ5%) prior to transfer to the test conditions

conditions, without exposure to the intermediate adaptation step, exhibited a 84% reduction in cs1 expression levels (Fig. 5d, lanes 10–12) on comparison with basal (Fig. 5a) and adapted (Fig. 5c) cultures, respectively. DISCUSSION An increasing importance is now being placed on the incidences of food borne yeast spoilage, primarily because of the substantial economic losses arising from the extensive range of foods spoiled and more recently in relation to increasing concerns of the associated health risks (Loureiro and Querol 1999). An ability to tolerate a diverse range of

(b)

(a) φx

1

2

3

4

5

19

(c) 6

7

8

(d) 9

10

11

12

Fig. 5 RT–PCR analysis of cs1 gene expression in Candida krusei cultures during the various stages in the adaptation to the preservative acetic acid: (a) original C. krusei culture growing in MEB (lanes 1–3); (b) cultures adapted for 2 h at an intermediate non-inhibitory acetic acid concentration (0Æ5%) (lanes 4–6); (c) cultures transferred to the test acetic acid concentration (1Æ5%) following adaptation (lanes 7–9); (d) cultures transferred directly to the test concentration without adaptation (lanes 10–12). /x represents the DNA molecular weight marker IX. Each sample was analysed in triplicate ª 2003 The Society for Applied Microbiology, Journal of Applied Microbiology, 95, 13–22


are important energy generating and anaplerotic routes within the cell and are therefore likely to provide a clear indication of cellular viability. Sequence analysis of the cs1 gene from C. krusei revealed identities of 72 and 76% to C. tropicalis at the nucleotide and amino acid level, respectively (Fig. 1). Identity to a number of Saccharomyces and other eukaryotic species was correspondingly high with over 53 and 68% similarity at the nucleotide and amino acid levels, respectively (Fig. 1) (Casey 2002). This sequence data allowed the design of cs1 primers for C. krusei the specificity of which was confirmed through their ability to amplify a specific product solely from C. krusei, and not from other food spoilage yeasts including Zygosaccharomyces and Rhodotorula species (data not shown). The application of any PCR-based approach, which places sole emphasis on DNA analysis is insufficient to provide conclusive information as to the viability of the contaminating culture, because of the potential for false positives arising from the ability of DNA molecules to survive the physical treatments (e.g. heating) to which the food may be subjected to render contaminating cultures non-viable (Loureiro and Querol 1999). In light of this fact the detection of mRNA gene transcripts, through the exploitation of a reverse transcriptase PCR assay, has gained widespread acceptance as a means of assessing the viability of organisms from a range of bacterial and fungal origins (Klein and Juneja 1997; Vaitilingom et al. 1998; Maher et al. 2000; Okeke et al. 2000, 2001; Kaiser et al. 2001). A similar link was observed in the case of the C. krusei cultures examined in this study, where RT–PCR analysis resulted in the generation of a product exclusively in the presence of viable cultures (Fig. 2a,b, lane 3), while following a loss of viability; as evident through the complete absence of growth on plating after the heat treatment, the samples continued to generate a detectable product on PCR analysis (Fig. 2b, lane 2). In the case of an intronless gene such as cs1, it is necessary to confirm that product formation is exclusively because of mRNA detection and not the presence of any contaminating DNA, because of a lack in size difference between the cDNA and the genomic DNA products. The lack of a detectable product following PCR analysis of the DNase1 treated mRNA provided confirmation in this respect (Fig. 2, lane 4). Questions, however, have been raised as to the suitability and absolute ability of mRNA to distinguish viable from non-viable cells, because of the persistence of mRNA molecules after cell death. Factors including, mRNA stability, which can vary greatly with respect to individual mRNA species, presence and activity of endogenous RNases, together with the method by which the cells are killed, all require consideration when assessing the absolute suitability of utilizing mRNA as an indicator of cellular viability (Sheridan et al. 1998; Szabo and Mackey

1999; Mitchell and Tollervey 2000). Notwithstanding this, detection of mRNA remains the best indicator of viability particularly when associated exclusively with cells detected by culturing. The ability of the RT–PCR assay to detect the cs1 gene product within fruit juice was found to require ca. 6 · 104 CFU ml)1 contaminating C. krusei cells. This level of sensitivity is similar to that previously observed in the detection of Listeria monocytogenes cultures, but has the advantage of not needing the additional time consuming steps of pre-enrichment and Southern blot hybridization of the amplified products (Klein and Juneja 1997). While the use of a multi copy number gene such as EF-1a, previously used in the detection of S. cerevisiae in milk (Vaitilingom et al. 1998), may provide a greater degree of sensitivity that the levels for C. krusei reported here; the specificity of the detection process may be undermined. Within the extensive group of food spoilage yeasts much of the focus to date has centred on those groups capable of overcoming those preservative concentrations legally permitted in foods to control yeast spoilage (Fleet 1992). Two of the yeast species which have attracted most attention to date are Z. bailii and S. cerevisiae, in relation to their preservative resistance and adaptive capabilities (Thomas and Davenport 1985; Holyoak et al. 1996) and with regard to elucidation of the mechanisms they employ in responding to the preservative challenge (Sousa et al. 1998; Tenreiro et al. 2000; Mollapour and Piper 2001; Piper et al. 2001). Our observations in respect of C. krusei suggest that this yeast is an important organism in the spoilage of low pH, weak acid-preserved foods, with the yeast displaying an ability to adapt to an acetic acid concentration of up to 1Æ5%, a level in excess of that routinely permitted to control spoilage (Fig. 4). An ability to adapt to these preservative concentrations coupled to a range of metabolic and physiological properties confirm that C. krusei has the potential to be an important spoilage organism. While work has been carried out on the mechanisms employed by both S. cerevisiae (Piper et al. 1998) and Z. bailii (Sousa et al. 1998; Mollapour and Piper 2001) to preservative adaptation, the picture is less clear for C. krusei. Our analysis of cs1 gene expression in C. krusei throughout the various stages of the adaptation process points to a key role for citrate synthase in the adaptive response, with an increase of 60% in cs1 expression being observed in cultures subjected to the pre-adaptation step and subsequently transferred to the test concentration, in comparison to the basal cs1 level. The importance of citrate synthase in the control of energy generating and anaplerotic pathways of the TCA and glyoxylate cycles, points to a potential direct role for either or both these pathways in the adaptive response of C. krusei through the assimilation of the organic acid, or indirectly through the generation of the necessary



energy, via the TCA cycle alone, to meet the high ATP demands of potential hydrogen ion and preservative anion extrusion pumps necessary to maintain pHi homeostasis and prevent the build up of preservative anion within the yeast cell. In conclusion, the identification of a specific gene, cs1, from the food spoilage yeast C. krusei, which plays a key role in essential metabolic pathways within the cell, provides a useful target for an RT–PCR based detection method for the direct, specific and sensitive identification of viable C. krusei contamination in a food environment. In addition, analysis of the cs1 gene during adaptation to acetic acid points to a potentially important role for this enzyme in this preservative-resistant yeast. ACKNOWLEDGEMENTS This work was partially funded by the Irish Department of Agriculture Food and Forestry under the Food Industry Sub-Programme of the EU Structural Funds 1994-9 and by Bioresearch Ireland. REFERENCES Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic local alignment search tool. Journal of Molecular Biology 215, 403–410. Baleiras Couto, M.M., Hartog, B.J., Huis in’t Veld, J.H.J., Hofstra, H. and van der Vossen, J.M.B.M. (1996) Identification of spoilage yeasts in a food-production chain by microsatellite polymerase chain reaction fingerprinting. Food Microbiology 13, 59–67. Battey, A.S., Duffy, S. and Schaffner, D.W. (2002) Modelling yeast spoilage of cold-filled ready-to-drink beverages with Saccharomyces cerevisiae, Zygosaccharomyces bailii and Candida lipolytica. Applied and Environmental Microbiology 68, 1901–1906. Brul, S. and Coote, P. (1999) Preservative agents in foods: mode of action and microbial resistance mechanisms. International Journal of Food Microbiology 50, 1–17. Casey, G.D. (2002) Characterization of food spoilage yeasts: analysis of preservative resistance and molecular methods of detection and identification. PhD Thesis. Cork: National University of Ireland. Coakley, M., Ross, R.P. and Donnelly, D. (1996) Application of the polymerase chain reaction to the rapid analysis of brewery yeast strains. Journal of the Institute of Brewing 102, 349–354. Dea´k, T. (1995) Methods for the detection and identification of yeasts in foods. Trends in Food Science and Technology 6, 287–292. Dea´k, T. and Beuchat, L.R. (1996) Yeasts in specific types of foods. In Handbook of Food Spoilage Yeasts ed. Dea´k, T. and Beuchat, L.R. pp. 61–95. New York: CRC Press. Dlauchy, D., Tornai-Lehoczki, J. and Pe´ter, G. (1999) Restriction enzyme analysis of PCR amplified rDNA as a taxonomic tool in yeast identification. Systematic and Applied Microbiology 22, 445–453. Doores, S. (1983) Organic acids. In Antimicrobials in Foods ed. Branen, A.L. and Davidson, P.M. pp. 75–106. New York: Marcel Dekker.

21

Esteve-Zarzoso, B., Belloch, C., Uruburu, F. and Querol, A. (1999) Identification of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers. International Journal of Systematic Bacteriology 49, 329–337. Esteve-Zarzoso, B., Peris-Torań, M.J., Garcıá-Maiquez, E., Uruburu, F. and Querol, A. (2001) Yeast population dynamics during the fermentation and biological aging of sherry wines. Applied and Environmental Microbiology 67, 2056–2061. Fleet, G. (1992) Spoilage yeasts. Critical Review in Biotechnology 12, 1–44. Fukaya, M., Takemura, H., Okumura, H., Kawamura, Y., Horinouchi, S. and Beppu, T. (1990) Cloning of genes responsible for acetic acid resistance in Acetobacter aceti. Journal of Bacteriology 172, 2096– 2104. Holyoak, C.D., Stratford, M., McMullin, Z., Cole, M.B., Crimmins, K., Brown, A.J.P. and Coote, P.J. (1996) Activity of the plasma membrane H+-ATPase and optimal glycolytic flux are required for rapid adaptation and growth of Saccharomyces cerevisiae in the presence of the weak-acid preservative sorbic acid. Applied and Environmental Microbiology 62, 3158–3164. Ibeas, J.I., Lozano, I., Perdigones, F. and Jimenez, J. (1996) Detection of Dekkera Brettanomyces strains in sherry by a nested PCR method. Applied and Environmental Microbiology 62, 998–1003. Kaiser, K., Rabodonirina, M. and Picot, S. (2001) Real time quantitative PCR and RT-PCR fro analysis of Pneumocystis carinii hominis. Journal of Microbiological Methods 45, 113–118. Klein, P.G. and Juneja, V.K. (1997) Sensitive detection of viable Listeria monocytogenes by reverse transcription-PCR. Applied and Environmental Microbiology 63, 4441–4448. Liewen, M.B. and Marth, E.H. (1985) Growth and inhibition of microorganisms in the presence of sorbic acid: A review. Journal of Food Protection 48, 364–375. Loureiro, V. (2000) Spoilage yeasts in foods and beverages: characterisation and ecology for improved diagnosis and control. Food Research International 33, 247–256. Loureiro, V. and Querol, A. (1999) The prevalence and control of spoilage yeasts in foods and beverages. Trends in Food Science and Technology 10, 356–365. Maher, N., Vermund, S., Lasbury, M., Lee, C.-H., Bartlett, M. and Unnasch, T.R. (2000) Development and evaluation of a molecular viability assay for Pneumocystis carinii. Journal of Clinical Microbiology 38, 1947–1952. Mitchell, P. and Tollervey, D. (2000) mRNA stability in eukaryotes. Current Opinions in Genetics and Development 10, 193–198. Mollapour, M. and Piper, P.W. (2001) Targeted gene deletion in Zygosaccharomyces bailii. Yeast 18, 173–186. Mozˇina, S.S. and Raspor, P. (1997) Molecular techniques for yeast identification in food processing. Food Technology and Biotechnology 35, 55–61. Okeke, C.N., Tsuboi, R., Kawai, M., Yamazaki, M., Reangchainam, S. and Ogawa, H. (2000) Reverse transcription-3¢ rapid amplification of cDNA ends-nested PCR of ACT1 and SAP2 mRNA as a means of detecting viable Candida albicans in an in vitro cutaneous candidasis model. The Journal of Investigative Dermatology 114, 95–100. Okeke, C.N., Tsuboi, R. and Ogawa, H. (2001) Quantification of Candida albicans actin mRNA by the Lightcycler system as a means



of assessing viability in a model of cutaneous candidiasis. Journal of Clinical Microbiology 39, 3491–3494. Park, B.W., Han, K.H., Lee, C.Y., Lee, C.H. and Maeng, P.J. (1997) Cloning and characterisation of the citA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans. Molecules and Cells 7, 290–295. Piper, P., Mahe´, Y., Thompson, S., Pandjaitan, R., Holyoak, C., Egner, R., Mu¨hlbauer, M., Coote, P. and Kuchler, K. (1998) The Pdr12 ABC transporter is required for the development of weak organic acid resistance in yeast. EMBO Journal 17, 4257–4265. Piper, P., Calderon, C.O., Hatzixanthis, K. and Mollapour, M. (2001) Weak acid adaptation: the stress response that confers yeasts with resistance to organic acid food preservatives. Microbiology 147, 2635– 2642. Pitt, J.I. and Hocking, A.D. (1997) Yeasts. In Fungi and Food Spoilage ed. Pitt, J.I. and Hocking, A.D. pp. 447–448. London: Blackie Academic and Professional Press. Querol, A., Barrio, E. and Ramoń, D. (1992) A comparative study of different methods of yeast strain characterisation. Systematic and Applied Microbiology 15, 439–446. Rosenkrantz, M., Alam, T.M., Kim, K-S., Clark, B.J., Srere, P.A. and Guarente, L.P. (1986) Mitochondrial and nonmitochondrial citrate synthases in Saccharomyces cerevisiae are encoded by distinct homologous genes. Journal of Molecular and Cellular Biology 6, 4509–4515. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Sheridan, G.E.C., Masters, C.I., Shallcross, J.A. and Mackey, B.M. (1998) Detection of mRNA by reverse transcription-PCR as an indicator of viability in Escherichia coli cells. Applied and Environmental Microbiology 64, 1313–1318. Shyamala, V. and Ames, G.F.-L. (1989) Genome walking by singlespecific-primer polymerase chain reaction: SSP-PCR. Gene 84, 1–8. Sousa, M.J., Rodrigues, F., Coˆrte-Real, M. and Leaõ, C. (1998) Mechanisms underlying the transport and intracellular metabolism

of acetic acid in the presence of glucose in the yeast Zygosaccharomyces bailii. Microbiology 144, 665–670. Suissa, M., Suda, K. and Schartz, G. (1984) Isolation of the nuclear yeast genes for citrate synthase and fifteen other mitochondrial proteins by a new screening method. EMBO Journal 3, 1773– 1781. Szabo, E.A. and Mackey, B.M. (1999) Detection of Salmonella enteritidis by reverse transcription-polymerase chain reaction (PCR). International Journal of Food Microbiology 51, 113–122. Sørensen, A.B., Duch, M., Jørgensen, P. and Pedersen, F.S. (1993) Amplification and sequence analysis of DNA flanking integrated proviruses by a simple two-step polymerase chain reaction method. Journal of Virology 67, 7118–7124. Tenreiro, S., Rosa, P.C., Viegas, C.A. and Sa´-Correai, I. (2000) Expression of the AZR1 gene (ORF YGR224w) encoding a plasma membrane transporter of the major facilitator superfamily, is required for adaptation to acetic acid and resistance to azoles in Saccharomyces cerevisiae. Yeast 16, 1469–1481. Thomas, D.S. and Davenport, R.R. (1985) Zygosaccharomyces bailii – a profile of characteristics and spoilage activities. Food Microbiology 2, 157–169. Ueda, M., Sanuki, S., Kawachi, H., Shimizu, K., Atomi, H. and Tanaka, A. (1997) Characterisation of the intron-containing citrate synthase gene from the alkanotrophic yeast Candida tropicalis: cloning and expression in Saccharomyces cerevisiae. Archives in Microbiology 168, 8–15. Vaitilingom, M., Gendre, F. and Brignon, P. (1998) Direct detection of viable bacteria, molds, and yeasts by reverse transcriptase PCR in contaminated samples after heat treatment. Applied and Environmental Microbiology 64, 1157–1160. Warth, A.D. (1977) Mechanism of resistance of Saccharomyces bailii to benzoic, sorbic and other weak acids used as food preservatives. Journal of Applied Bacteriology 43, 215–230. Warth, A.D. (1986) Preservative resistance of Zygosaccharomyces bailii and other yeasts. CSIRO Food Research Quarterly 46, 1–8.
