B-3311 [1-5] Indian J. Anim. Res.,
AGRICULTURAL RESEARCH COMMUNICATION CENTRE
Print ISSN:0367-6722 / Online ISSN:0976-0555
www.arccjournals.com/www.ijaronline.in
Molecular detection of enterotoxigenic Staphylococcus aureus isolated from mutton marketed in retail outlets of Chennai, India S. Wilfred Ruban*, R. Narendra Babu1, J.J. Abraham Robinson1, Senthil Kumar, T.M.A.2 P. Kumarasamy3, K. Porteen4 and P. Raja2 Department of Livestock Products Technology, Veterinary College, Hassan- 573 202, Karnataka, India. Received: 21-09-2016 Accepted: 28-11-2016
DOI:10.18805/ijar.B-3311
ABSTRACT The present study was aimed at detection of enterotoxigenic S. aureus in mutton marketed in retail outlets of Chennai. A total of 120 meat samples were collected from across Chennai for isolation of S. aureus and it was observed that 66.28 per cent of the samples were contaminated with S. aureus. The S. aureus count in mutton samples ranged from 1.8 x 102 to 4.9 x 104 CFU/ g with an overall average of 1.30 x 104 CFU/ g. All the isolates presumptively identified as S. aureus biochemically, amplified 181 bp product specific for nuc gene by PCR, which is species specific marker for S. aureus. Enterotoxin gene profiles (multiplex PCR) results revealed that 70.17 percent of the isolates were enterotoxigenic carrying only six genes (seb, sed, seg, seh, sei and sej) either alone or in combination, whereas none of these isolates harbored sea, sec and see. It was clear that seb (72.5 %) was the predominant enterotoxin gene followed by seg and sei, seh, sej and sed. Six different toxin gene profiles were exhibited by different isolates and majority of the isolates (55 %) carried two or more genes as compared to only one toxin gene. Key words: Enterotoxin gene, Mutton, PCR, Retail outlets, S. aureus. INTRODUCTION Microbial safety of meat and meat products is one of the important food safety issue worldwide especially in developing countries like India where meat is being sold in open markets exposing them to various microorganisms (Ayalew et al., (2013). Contamination of meat by bacteria is inevitable due to the existing processing conditions wherein meat is exposed to contaminated working surfaces, equipment, poor personal hygiene and quality of water used for meat processing (Endale and Hailey, (2013). Food borne diseases are a common phenomenon in developing countries like Asia and Africa because of the prevailing poor handling and sanitation practices, inadequate food safety laws, weak regulatory system, lack of financial resources to invest in safety measures and lack of education for food handlers (Heileselassie et al., 2013). Among the various pathogens of food safety interest Staphylococci occupies a important position because of their ubiquity and adaptability, inhabiting the skin, skin gland and mucous membrane of humans, other mammals and birds. According to Centers for Disease Control and Prevention (CDC), S. aureus is the second most common bacterial pathogen responsible for food poisoning worldwide and
enterotoxin producing ability of these organisms is an important index of virulence (Pal, 2001). The major source of S. aureus contamination of raw meat is from human handlers and to some extent from the animals (Schelin et al., 2011). S. aureus produces heat stable enterotoxins (SEs) which are potent gastrointestinal exotoxins, which causes food borne intoxication. International Committee for Staphylococcal Superantigens Nomenclature (INCSSN), has designated staphylococcal superantigens that induce emesis as Staphylococcal Enterotoxins (SEs) and those that lack the emetic properties as staphylococcal enterotoxin-like (SEl) superantigens. Till date there are about 22 identified SEs/ SEls. (Demir et al., 2011). The genes encoding enterotoxin of S. aureus are present on regions of chromosome known as the staphylococcal pathogenicity islands (SaPIs) and also are carried in plasmids or phages. The presence of these gene encoding toxins should always be considered as an indicative of the ability of the organism to produce toxin under favorable environment (Normanno et al., 2005). Epidemiological studies on the prevalence of enterotoxigenic strains of S. aureus isolated from meat in India are lacking.
*Corresponding author’s e-mail:
[email protected] 1 Department of Livestock Products Technology (Meat Science), 2 Department of Animal Biotechnology, 3 Department of Bioinformatics and ARIS cell, 4 Department of Veterinary Public Health and Epidemiology, Madras Veterinary College, TANUVAS, Chennai- 600 007, India.
2
INDIAN JOURNAL OF ANIMAL RESEARCH
Hence, the present study was developed to detect the prevalence of enterotoxigenic S. aureus and to identify the most common enterotoxin gene type prevalent in mutton marketed in retail outlets in Chennai, India. MATERIALS AND METHODS The reference strains of S. aureus (MTCC 87) was obtained from Institute of Microbial Technology (IMTECH), Chandigarh and the reference strains of S. aureus carrying different enterotoxin gene namely Isolate No. 3139 – sea, Isolate No. 1088 – seb, Isolate No. 934 – sec, Isolate No. 1391- sed , Isolate No. 8235 – seg, Isolate No. 423 – seh, Isolate No. 1750 – sei and Isolate No. 966 – sej were provided by Department of Veterinary Microbiology, Rajiv Gandhi Institute of Veterinary Education and Research (RIVER), Pondicherry were used in this study for standardization of PCR protocols for detection of enterotoxigenic S. aureus. A total of 120 mutton samples %viz., 30 samples each marketed in different retail outlets of Chennai north, south and central zones of Tamilnadu, India were aseptically collected from June 2014 to July 2015. The samples (100 gm) were immediately transported to the Department of Livestock Products Technology (Meat Science) laboratory in an ice pack and were processed within an hour of collection. Isolation and identification of Staphylococcus aureus was done as per the standard procedure (ISO 68881: 1999). In brief, ten grams of each sample was added to 90 mL of sterile Brain Heart infusion broth supplemented with 10 % NaCl and enriched for 8-10 hours at 37°C. The enriched samples were streaked on to Baird Parker agar (Himedia, India) and suspected colonies were identified by Gram stain, catalase, mannitol fermentation, coagulase, and thermonuc-
elase tests. The S. aureus counts of the meat samples were determined as per the procedure described by Bhandare et al. (2007) Extraction of DNA was carried out using a Genomic DNA purification kit (Qiagen, Germany) according to the manufacturer’s instruction. After DNA isolation, the isolates were confirmed by PCR targeting thermonuclease (nuc) gene. The amplification of selected SEs genes (sea, seb, sec, sed, see, seg, seh, sei, and sej) was achieved using nine primer sets in the one reaction mixture and the sequences of the primers used for gene amplification are presented in Table 1. All oligonucleotide primers were obtained from a commercial source (M/s. Eurofins, Bangalore). Polymerase chain reaction (PCR) for the detection of SEs genes was performed according to the methods described by Gencay et al. (2010). Briefly, amplification reactions were performed in a 25 µL mixture containing 12.5 µL of 2X PCR master mix (Amplicon, Denmark), 50 pmol of each primers and 2 µL of DNA template and the final volume was adjusted to 25 µL by adding nuclease free water. Amplification reactions were performed using a DNA thermal cycler (Master Cycler Gradient, Eppendorf, Germany) with the following program: denaturation for 10 minutes at 95°C, followed by 30 cycles of denaturation for 1 minute at 95°C, annealing for one minute at 64°C and extension for one minute at 72°C and final extension for 10 minutes at 72°C. The PCR products were stained with 1% solution of ethidium bromide and visualized under UV light after gel electrophoresis on 2.5% agarose gel. Nuclease free water was used as the negative control.
Table 1: Primers used in this study Sequence nuc(Thermonuclease gene) F- GTGCTGGCATATGTATGGCAATTGT R- TACGCCGTTATCTGTTTGTGATGC sea(Enterotoxin A) F- GCAGGGAACAGCTTTAGGCGTTCT GTAGAAGTATGAAACACG seb(Enterotoxin B) F- ACATGTAATTTTGATATTCGCACTG R- TGCAGGCAT CATGTCATACCA sec(Enterotoxin C) F- CTTGTATGTATGGAGGAATAACAA R- TGCAGGCATCATATCATACCA sed(Enterotoxin D) F- GTGGTGAAATAGATAGGACTGC R- ATATGAAGGTGCTCTGTGG see(Enterotoxin E) F- TACCAATTAACTTGTGGATAGAC R- CTCTTTGCACCTTACCGC seg(Enterotoxin G) F- AAGTAGACATTTTTGGCGTTCC R-AGAACCATCAAACTCGTATAGC seh(Enterotoxin H) F- CAACTGCTGATTTAGCTCAG R- GTCGAATGAGTAATCTCTAGG sei(Enterotoxin I) F- CAACTCGAATTTTCAACAGGTACC R- CAGGCAGTCCATCTCCTG sej(Enterotoxin J) F- CATCAGAACTGTTGTTCCGCTAG R- CTGAATTTTACCATCAAAGGTAC
Product size 181 bp
Reference Hedge et al. ((2013))
520bp
Lovseth et al. (2004)
667bp 284bp 385bp 171bp 287bp 359bp 466bp 142bp
Monday and Bohach (1999) Omoe et al. (2002)
Vol. Issue , ()
RESULTS AND DISCUSSION In the present study it was observed that out of the 120 mutton samples screened, 106 (88.33 %) of the samples were positive for the presence of Staphylococci spp. These isolates were subjected to coagulase test and the results revealed that 86 (71.67 %) of the isolates were coagulase positive Staphylococci (CoPS) and 20 (16.67 %) isolates were coagulase negative Staphylococci (CoNS). Among the CoPS, 66.28 % (57/86) of the isolates were DNase (thermonuclease) producers and were presumptively confirmed as S. aureus. The S. aureus count in mutton samples (57) ranged from 1.8 x 102 to 4.9 x 104 CFU/ g with an overall average of 1.30 x 104 CFU/ g. All the isolates were confirmed by PCR targeting nuc gene which is species specific marker for S. aureus. It was observed that all the 57 amplified 181 bp product specific for nuc gene (Figure 1). All the 57 isolates of S. aureus isolated from mutton marketed in retail outlets in Chennai, India were subjected to multiplex PCR targeting nine enterotoxin genes. The results revealed that 70.17 per cent of the isolates (40/57) were enterotoxigenic carrying either one or more enterotoxin gene. It was evident that of the nine enterotoxin genes only six genes (seb, sed, seg, seh, sei and sej) were demonstrated either alone or in combination in 40 isolates, whereas none of these isolates harbored sea, sec and see. Among the 40 enterotoxigenic isolates, 29 isolates (72.50 %) harbored seb, 2 (5.00 %) harbored sed, 22 (55.00 %) harbored seg, 5 (12.50 %) harbored seh, 22 (55.00 %) harbored sei and 4 (10.00 %) isolates harbored sej either alone or in combination. It was clear that seb was the predominant enterotoxin gene followed by seg = sei, seh, sej and sed.
Fig-1: Agarose gel (2.5 %) picture of nuc gene (181 bp) in S. aureus isolates from mutton marketed in retail outlets of Chennai city. Lane 1 & 11: 100 bp DNA ladder, Lane 2: S. aureus (MTCC 87), Lane 3: Negative Control, Lane 4-10: S. aureus isolates from Mutton
The results of different toxin profiles (seven) exhibited by S. aureus isolates from mutton sample are presented in Table 2 and agarose gel picture of these profiles are depicted in Figure 2. Of the 40 isolates, 18 (45 %) isolates carried only seb, 9 isolates (22.50 %) carried seg + sei, 4 isolates (10.00 %) carried seb + seg + sei and two isolates (5 %) carried seg + seh+ sei. Five isolates (12.50 %) carried four enterotoxin genes of which 3 isolates carried seb + seg + seh + sei and two isolate carried seb + seg + sei + sej. Two isolates (5 %) carried five enterotoxin genes, seb +sed + seg + sei+ sej. The enterotoxin gene profile of the isolates demonstrated that the toxin profile seb was the predominant profile alone, whereas combination of seg + sei was the most predominant profile among all the isolates. Majority of the mutton isolates (55 %) carried two or more genes as compared to 45 per cent isolates that carried only one toxin gene. Table 2: Different enterotoxin gene profiles exhibited by S. aureus isolated from mutton marketed in Chennai, India Gene profiles No. of Isolates seb 18 seg + sei 9 seb + seg + sei 4 seg + seh+ sei 2 seb + seg + seh+ sei 3 seb + seg + sei+ sej 2 seb +sed + seg + sei+ sej 2 40
Fig-2: Enterotoxin gene profile of S. aureus isolates (7 profiles) from mutton marketed in retail outlets of Chennai city. Lane 1 & 10: 50 bp DNA ladder, Lane 2: Negative Control, Lane 3: M30 (only seb- 667 bp), Lane 4: M49 (seg & sei- 328 & 466 bp), Lane 5: M18 (seb, seg & sei- 667, 328 & 466 bp), Lane 6: (seg, seh &sei - 328, 359 & 466 bp), Lane 7: M3 (seb, seg, seh & sei- 667, 328, 359 & 466 bp), Lane 8: M8 (seb, seg, sei &sej- 667, 328, 466 & 142 bp), Lane 8: M22 (seb, sed, seg, sei & sej- 667, 385, 328, 466 & 142 bp).
4
INDIAN JOURNAL OF ANIMAL RESEARCH
Coagulase production, Mannitol fermentation and DNase (thermonuclease) production are the most commonly used methods for the phenotypic identification of S. aureus (Brown et al., 2005). In the present study the overall prevalence of S. aureus in mutton was 66.28 %. Similar prevalence have been reported in Hyderabad (64 %) by Ramya et al. (2015) and in Germany (66.66 %) by Gundogan et al. (2005). The above researchers have attributed the high prevalence of S. aureus to poor personal hygiene, quality of water used for processing and improper or no sanitation of the knives as well as working surfaces in the retail outlets. Hence, the high prevalence in the present study clearly indicates poor hygiene practiced during the slaughter and processing of sheep for mutton in the retail outlets of Chennai. In contrary to the findings of our study, lower prevalence of between 10-25 percent has been recorded in India by several workers (Bhandare et al., 2010;Sharma and Chattopadhay, 2015; Gayathri and Anu, 2015). The lower prevalence may be attributed to factors like different processing facilities, sampling, geographic locations, brand and collection time. Identification of S. aureus using PCR amplification of the nuc gene is considered as a gold standard method and the nuc gene encodes the thermonuclease enzyme and is most useful for rapid diagnosis of S. aureus in food samples (Hu et al., (2013). In the present study all the 57 isolates presumtively identified by biochemical test amplified 181 bp product specific for S. aureus by PCR targeting nuc gene (Hedge et al., 2013). In the present study seb was the predominant classical enterotoxin gene and non-classical enterotoxin genes seg and sei were more common among S. aureus isolates. Similarly, Hwang et al. (2007) observed that apart
from the classical SEs which were considered to be major etiological factors in staphylococcal food poisoning, newly described SE genes seg, sei, sem, and sen were more frequently observed in S. aureus isolated from meat in Korea. The reason for the occurrence of seg and sei together in majority of the isolates was attributed to their location within the same gene cluster (enterotoxin gene cluster - egc) in genomic island type II vSab (Blaiotta et al., 2004). The combination of seg and sei was reported to be frequently detected in the strains isolated from cases of food poisoning by Cha et al. (2006) in Korea, Rosec and Gigaud (2002) in France and Chiang et al. (2006) in Taiwan. The presence of enterotoxin genes in isolates from mutton marketed in retail outlets of Chennai city does not necessarily mean that the isolate can produce intact and biologically active toxin. However, it is the concentration of S. aureus in foods that determines its capability to produce food intoxication. The lowest number of S. aureus cells required to produce the minimum level of enterotoxin ranges from 104 CFU/g to 107 CFU/g (Alarcon et al., 2006). Based on the results of our study it is evident that the average S. aureus count was 1.30 x 10 4 CFU/ g. Hence, necessary precautions need to be taken at retail outlets to prevent contamination and at the same time prevent exposure of carcasses to environment which favors the growth and multiplication of these organisms resulting in food poisoning in consumers. ACKNOWLEDGMENT The authors acknowledge Tamilnadu Veterinary and Animal Sciences University and Madras Veterinary College, Chennai for providing necessary facilities for the conduct of the research. This paper is a part of the Ph.D. thesis submitted by the first author to TANUVAS.
REFERENCES Ayalew, H., Birhanu. A. and Asrade. B.(2013) Review on food safety system: Ethiopian perspective. African J Fd Sci. 7: 431-440. Bhandare, S.G., Sherikar, A.T., Paturkar, A.M., Waskar. V.S. and Zende. R.J. (2007). A comparison of microbial contamination of sheep/goat carcasses in a modern Indian abattoir and traditional meat shops. Food Control. 18: 854-868. Bhandare, S., Paturkar, A.M., Waskar. V.S. and Zende. R.J. (2010). Prevalence of microorganisms of hygienic interest in an organized abattoir in Mumbai. Indian J. Infect. Dev. Ctries. 4(7):454-458. Blaiotta, G., Ercoline, D., Pennacchia, C., Fusco, V., Casaburi, A., Pepe. O.and Villani. F. ( 2004). PCR detection of staphylococcal enterotoxin genes in Staphylococcus spp. strains isolated from meat and dairy products. Evidence for new variants of seG and seL in S. aureus AB-8802. J. Appl. Microbiol. 97:719–730. Brown, D.F.J., Edwards, D.I., Hawkey, P.M., Morrison, D., Ridgway, G.L., Towner. K.J. and Wren. M.W.D. (2005). Guidelines for the laboratory diagnosis and susceptibility testing of methicillin-resistant staphylococcus aureus (MRSA). J. Antimicro. Chemotherapy. 56(6):1000-08. Cha, J.O., Lee, J.K., Jung, Y.H., Yoo, J.I., Park, Y.K., Kim. B.S. and Y.S. Lee. (2006). Molecular analysis of Staphylococcus aureus isolates associated with staphylococcal food poisoning in South Korea. J. Appl. Microbiol. 101: 864–871. Chiang, Y.C., Chang, L.T, Lin., C.W., Yang. C.Y. and Tsen. H.Y. (2006). PCR primers for the detection of staphylococcal enterotoxins K, L, and M and survey of staphylococcal enterotoxin types in Staphylococcus aureus isolates from food poisoning cases in Taiwan. J Fd Protect..69: 1072–1079. Demir, C., Aslantas, O., Duran, N., Ocak S. and Ozer. B. (2011). Investigation of toxin genes in Staphylococcus aureus strains isolated in Mustafa Kemal University Hospital. Turk J Med Sci. 41 (2): 343-352.
Vol. Issue , () Endale, B.G. and Hailay. G. (2013). Assessment of bacteriological quality of meat contact surfaces in selected butcher shops of Mekelle city, Ethiopia. J. Environ. and Occupational Sci. 2: 61-66. Gencay, Y.E., Ayaz. A.D. and Kasýmoglu-Dogru. A. (2010). Enterotoxin gene profiles of Staphylococcus aureus and other Staphylococcal isolates from various foods and food ingredients. Erciyes Universitesi Veteriner Fakultesi Dergisi. 7(2):75–80. Gundogan, N., Citak, S., Yucel. N. and Devren. A. (2005). A note on the incidence and antibiotic resistance of Staphylococcus aureus isolated from meat and chicken samples. Meat Sci. 69 (4): 807–810. Gayathri, T. and Anu. S.A. 2015. Isolation and Characterization of Microorganisms from Raw Meat Obtained from Different Market Places in and Around Chennai. J Pharm Chem Biol Sci. 3(2): 295-301. Hedge, R., Isloor, S., Nithin Prabhu, K., Shome. B.R., Rathnamma, D., Suryanarayana, V.V.S., Yatiraj, S., Prasad, R., Krishnaveni, C., Sundareshan, N., Akhila, D.S., Gomes. A.R. and Hegde. N.R. ((2013)). Incidence of sub-clinical mastitis and prevalence of major mastitis pathogens in organized farms and unorganized sectors. Ind J. Microbiol. 53(3): 315–320. Haileselassie, M., Taddele, H.., Adhana. K. and Kalayou. S. (2013). Food safety knowledge and practices of abattoir and butchery shops and the microbial profile of meat in Mekelle City. Asian Pac. J Trop. Biomed. 3: 407-412. Hu, Y., Meng, J., Shi, C., Hervin. K., Fratamico. P.M. and Shi. X. (2013). Characterization and comparative analysis of a second thermonuclease from Staphylococcus aureus. Microbiol. Res. 168 (3): 174–182. Hwang, S.U., Kim, S.H., Jang, E.J., Kwon, N.H., Park, Y.K., Koo, H.C., Jung, W.K., Kim. J.M. and Park. Y.H. (2007). Novel multiplex PCR for the detection of the Staphylococcus aureus superantigen and its application to raw meat isolates in Korea. Int. J. Food Microbiol. 117: 99–105. ISO 6888-1: (1999). Horizontal methods for enumeration of coagulase positive Staphylococci (Stahylococcus aureus and other species). Part 1: Technique using Baird-Parker agar medium. International Organization for Standardization, Geneva, Switzerland. Lovseth, A., Loncarevic. S. and Berdal. K. (2004). Modified multiplex PCR method for detection of pyrogenic exotoxin genes in staphylococcal isolates. J. Clin. Microbiol. 42: 3869–3872. Monday, S. and Bohach. G.A. (1999). Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in staphylococcal isolates. J. Clin. Microbiol. 37: 3411–3414. Normanno, G., Firinub, A., Virgiliob, S., Mulab, G., Dambrosioa, A., Poggiub, A., Decastellic. L. and Mioni. R. (2005). Coagulasepositive Staphylococci and Staphylococcus aureus in food products marketed in Italy. Int J Food Microbiol. 98: 73– 79. Omoe, K., Ishikawa, M., Shimoda, Y., Hu, D., Ueda. S. and Shinagawa. K. (2002). Detection of seg, seh and sei genes in Staphylococcus aureus isolates and determination of the enterotoxin productivities of S. aureus isolates harbouring seg, seh or sei genes. J. Clin. Microbiol. 40: 857–862. Pal, M. 2001. Epidemiology of staphylococcal food poisoning. Beverage and Food World. 28:11-13. Ramya, P., Tirupathi Reddy, E., Vijaya Kumar A. and Krishnaiah. N. (2015). A study on microbiological analysis of raw meat. Int. J Institut Pharm Life Sci. 5(4): 1-9. Rosec, J.P. and Gigaud. O. (2002). Staphylococcal enterotoxin genes of classical and new types detected by PCR in France. Int. J. Food Microbiol. 77: 61–70. Schelin, J., Wallin-Carlquist, N., Cohn, M.T., Lindqvist, R., Barker. G.C. and. Radstrom. P (2011). The formation of S. aureus enterotoxin in food environments and advances in risk assessment. Virulence. 2: 580–592. Sharma, K.P. and U.K. Chattopadhay. 2015. Assessment of Microbial load of raw meat Samples sold in the Open Markets of city of Kolkata. IOSR J Agric Vet Sci. 8(3): 24-27.
