Journal of Medical Microbiology (2005), 54, 93–96
Case Report
DOI 10.1099/jmm.0.45845-0
Molecular detection of Treponema denticola and Porphyromonas gingivalis in carotid and aortic atheromatous plaques by FISH: report of two cases Francesca Cavrini,1,5 Vittorio Sambri,1 Annette Moter,2 Dora Servidio,3 Antonella Marangoni,1 Lucio Montebugnoli,3 Federico Foschi,1,3 Carlo Prati,3 Roberto Di Bartolomeo4 and Roberto Cevenini1
Correspondence
1
Section of Microbiology, DMCSS, University of Bologna, Bologna, Italy
Vittorio Sambri
2
Institut fu¨r Mikrobiologie und Hygiene, Charite` Universita¨tsmedizin, Berlin, Germany
3
Department of Oral Sciences, University of Bologna, Bologna, Italy
4
Department of Surgical Sciences, Anaesthesiology and Transplants, University of Bologna, Bologna, Italy
5
Centro Regionale di Riferimento per le Emergenze Microbiologiche, Bologna, Italy
[email protected]
Received 29 July 2004 Accepted 1 October 2004
Treponema denticola and Porphyromonas gingivalis have been identified in atheromatous plaques of two patients suffering from atherosclerosis by PCR and fluorescence in situ hybridization (FISH). The use of the FISH technique suggested that these periodontopathic micro-organisms might be metabolically active within the wall of arteries, under the atherosclerotic lesion.
Case reports Case 1. The patient was a 73-year-old caucasian Italian male
with a 12 year history of atherosclerosis and systemic hypertension. The patient also had a previous history of smoking and dislipidemia. He underwent percutaneous transluminal coronary angioplasty (PTCA) of the left coronary artery in 1991, and 2 years later he underwent coronary artery by-pass grafting (CABG). In 2003 an ecotomodoppler study of his carotid arteries showed a bilateral stenosis (70 % in the right vessel and 50 % in the left vessel). Consequently a computerized tomography (CT) scan was performed, which revealed the presence of partially calcified atheromatous plaques located at the carotid bulbs. The patient was then scheduled to undergo an endarterectomy to remove the plaque in the right bulb followed by the application of a dacron patch. Clinical and radiological examinations of the patient immediately before surgery showed a very poor periodontal situation, as indicated by a high value (103) of CPSS (clinical periodontal sum score: the sum of the number of sites with probing pocket depths of 4 mm or greater, the number of gingival sites with bleeding after probing or visible suppuration on probing, and the number of furcation lesions exceeding grade 1), which was the system used to evaluate the periodontal situation (Mattila et al., 2000). Abbreviations: CABG, coronary artery by-pass grafting; FISH, fluorescence in situ hybridization; PTCA, percutaneous transluminal coronary angioplasty.
45845 & 2005 SGM Printed in Great Britain
The crevicular fluid was sampled by using a paper cone inserted into the periodontal pockets and stored at 80 8C until it was processed for DNA extraction. During surgery, a section of the arterial wall including the atheromatous plaque was removed and longitudinally cut into two sections that were used for PCR and FISH testing. The PCR protocol has previously been reported (Donati et al., 1997) and was performed as described by Ma¨tto¨ et al. (1998) and by Siqueira et al. (2000) for the detection of Porphyromonas gingivalis and Treponema denticola, respectively. DNA extracted from in vitro grown P. gingivalis (ATCC 33277) and T. denticola (ATCC 35405) was used as a positive control; DNA extracted from Treponema pallidum (Nichols strain) (Sambri et al., 2001) was used as a negative control in each PCR reaction set. DNA was extracted from the vessel biopsy as follows: the tissue was treated with a mechanical homogenizer and then 700 mg was incubated with buffer K [10 mM Tris (pH 8.3), 50 mM KCl, 1.75 mM MgCl2 , 0.01 % (w/v) bovine serum albumin, 0.45 % (v/v) Tween 20, 0.45 % (v/v) Nonidet P-40 and 100 ìg ml 1 Proteinase K) at 56 8C for 7 h. After incubation the sample was extracted with phenol/chloroform, precipitated with 0.3 M sodium acetate and 2-propanol, and resuspended in 200 ìl of TE buffer. The PCR analysis of the DNA extracted from the crevicular fluid showed the presence of T. denticola 16S rRNA gene sequence in the sample studied, but showed a negative result for P. gingivalis. The T. denticola 16S rRNA gene sequence 93
F. Cavrini and others
(target 316 bp) was also identified in the atheromatous plaque by PCR. This last sample gave a negative result for the presence of P. gingivalis. The PCR product was sequenced to ensure the identity of the amplified genes: a BLAST (BLAST software is available at http://www.ncbi.nlm.nih.gov/blast) analysis showed the highest homology (99.2 % over 270 bp) with T. denticola (strain 35405) 16S rRNA gene, confirming the identity of the bacterium identified. In addition, the carotid plaque was also investigated for the presence of T. denticola-related oral treponemes using FISH performed with the bacterial probe TRE II, specific for treponemes of phylogenetic group II, including T. denticola, according to Choi et al. (1994), and eubacterial-specific probe EUB 338. Probe TRE II was 100 % homologous to the target site of the sequenced PCR product from the patient’s sample. Details of the molecular probes used are reported in Table 1; the sequences are deposited in ProbeBase (http://www. microbial-ecology.de/probebase/index.html) and were all targeted at the small subunit of the ribosome. These oligonucleotides were commercially synthesized and labelled at the 59 end either with fluorescein isothiocyanate (FITC), to give a green fluorescence, or with the Cy3 fluorochrome (indocarbocyanine, Thermo Hybaid Interactiva), giving a bright orange signal. Slides with selected strains of oral treponemes [T. denticola ATCC 35405, Treponema vincentii ATCC 33580 (member of group I), Treponema maltophilum ATCC 51939 (group IV)] were used as positive or negative controls. The FISH method was performed as described by Sunde et al. (2003), with minor modifications. Thirty different tissue sections were examined. This technique revealed, at multiple sites, the presence of T. denticola in the intimate layer underlining the atherosclerotic lesion, as shown in Fig 1a. Case 2. The second patient was a 65-year-old caucasian
Italian male who had suffered from systemic hypertension and dyslipidemia for 6 years. In the history of this patient it is noteworthy that in 2000 he had a cerebral stroke caused by a bilateral diffuse thickening of the wall of the carotids. In 2002 he suffered from a diffuse and acute abdominal pain that was caused by an aneurysm of the aortic artery as diagnosed by ultrasound tomography. Later in the same year an angiographic study revealed the stenosis of the coronary arteries (60 % in the proximal descendant anterior branch and 75 % in the interventricular posterior branch). He then underwent CABG for myocardial revascularization. In 2003 he underwent surgical substitution of the thoracic and abdominal tracts (from the thoracic descendant tract down to the abdominal segment below the renal artery) of the aorta with
a prosthetic tube for an aneurysm. The macroscopic and histological examination of the removed tract of the aorta revealed the presence of a diffuse atheromatous plaque. The dental examination before this last surgery was not carried out. However, the patient had been completely edentulous for 10 years. DNA extraction from the vessel wall and PCR analysis were performed as reported above in case 1, and showed the presence of a 404 bp amplification product when evaluated for P. gingivalis. No reaction was detected for T. denticola. The oligonucleotide sequence of this amplicon revealed a 95 % homology over 400 bp with the 16S rRNA gene of P. gingivalis (ATCC 33277), and showed no higher homology with any published DNA sequence. However, the target sequence of the P. gingivalis probe (POGI) used for FISH was not included in the sequenced 16S rRNA gene fragment. The atheromatous plaque was also evaluated for the presence of P. gingivalis with the probes POGI and EUB 338 using FISH. This technique was performed as reported above with minor modifications. Control slides prepared with the following bacteria were used: Tannerella forsythensis (ATCC 43037), Prevotella intermedia (ATCC 25611) Actinobacillus actinomycetemcomitans (ATCC 43718). The FISH showed the presence of bright yellow-green fluorescent microcolonies compatible with P. gingivalis within the aortic wall underlying the atherosclerotic plaque as shown in Fig. 1b.
Discussion The relationship between periodontopathogenic bacteria and the development of atherosclerosis has been under investigation for many years providing increasing evidence that the chronic inflammation in periodontal disease may act as an additional factor for atherogenesis (Mattila et al., 2000). In the case of the patient described in the first report we confirmed by PCR the simultaneous presence of T. denticola in the crevicular fluid obtained from periodontal pockets and in the wall of the artery. In the case of the second patient this was not possible since this subject was completely edentulous. It should nevertheless be underlined that periodontal disease is among the major causes of tooth loss and that this chronic infection leads to edentulia within some decades after its appearance (Papapanou, 1993). Several authors have described the identification, by PCR, immunofluorescence assay and electron microscopy, of T. denticola and P. gingivalis in dental lesions (Asai et al., 2002; Ishihara et al., 2004; Ma¨tto¨ et al., 1998) and in
Table 1. Oligonucleotide probes used for the FISH technique Probe TRE II POGI EUB 338
94
Sequence (59-39)
Target species
Reference
Label
GCTCCTTTCCTCATTTACCTTTAT CAATACTCGTATCGCCCGTTATTC GCTGCCTCCCGTAGGAGT
Group II treponemes (including T. denticola) P. gingivalis Eubacteria
Moter et al. (1998) Sunde et al. (2003) Amann et al. (1990)
Cy3 Cy3 FITC
Journal of Medical Microbiology 54
Periodontopathic bacteria in atherosclerotic lesions
Fig. 1. FISH on tissue sections of the carotid wall from patient described in case 1 (a) and of the aneurysmatic aortic wall from case 2 (b). The hybridization was performed simultaneously with the eubacteria-specific probe EUB 338 labelled with FITC and with species-specific Cy3labelled probes TRE II for T. denticola (a) and POGI for P. gingivalis (b). Observation was made by using the narrow band filter set HQ-F41-001. The presence at several sites of T. denticola within the wall of the aorta is indicated by the black arrows in (a), showing an orange-yellow fluorescence. Microcolonies of P. gingivalis are indicated by the black arrow in (b), showing a yellow-green fluorescence.
atherosclerotic plaques (Haraszthy et al., 2000; Okuda et al., 2001) or in artery cells (Deshpande et al., 1998; Dorn et al., 1999), but these data did not support the presence of living bacteria in the vascular tissues. The use of the FISH technique allowed the detection of metabolically active bacteria (Moter & Go¨bel, 2000): in particular this method identified the presence of 16S rRNA, which is present only in cells that are actively synthesizing proteins. Although positive FISH results have been reported from starving cells (Oda et al., 2000), this fact allows us to assume that the bacteria identified within the wall of atherosclerotic vessel were living microorganisms with the typical spirochaetes morphology in case 1 and with the shape of microcolonies in case 2. The specificity of the FISH technique is very high, especially when performed with two different probes contemporarily, as in this study. The first oligonucleotide probe (EUB 338) detected the 16S rRNAs from most eubacteria (Amann et al., 1990) and was labelled with FITC, the second one was specific for the individual species (TRE II for T. denticola-related organisms and POGI for P. gingivalis) and was labelled with the Cy3 fluorochrome. In this way, the microscopic observation of tissue sections, with narrow band filter sets (HQ-F41001; AHF, Analysentechnik) to visualize the FITC and Cy3 signals, gave an orange-yellow fluorescence in contrast with the green autofluorescence of the artery wall in the image overlays.
probes with flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 56, 1919–1925.
The use of the FISH technique supports the hypothesis that actively metabolizing periodontal pathogens might be located within the atherosclerotic artery wall and this is the first report describing the presence of living T. denticola and P. gingivalis in the intimate layer underlying the atheromatous plaque. However, the small number of cases studied do not allow any conclusion about the correlation between periodontal disease and the appearance of atherosclerosis. Further work is in progress to extend the study of the arterial biopsies from periodontopathic or edentulous patients suffering from atherosclerosis, by PCR and FISH, to investigate the presence of T. denticola and P. gingivalis.
Ma¨tto¨, J., Saarela, M., Alaluusua, S., Oja, V., Jousimies-Somer, H. & Asikainen, S. (1998). Detection of Porphyromonas gingivalis from saliva
Asai, Y., Jinno, T., Igarashi, H., Ohyama, Y. & Ogawa, T. (2002).
Detection and quantification of oral treponemes in subgingival plaque by real-time PCR. J Clin Microbiol 40, 3334–3340. Choi, B. K., Paster, B. J., Dewhirst, F. E. & Go¨bel, U. B. (1994). Diversity
of cultivable and uncultivable oral spirochetes from a patient with severe destructive periodontitis. Infect Immun 62, 1889–1895. Deshpande, R. G., Khan, M. B. & Genco, C. A. (1998). Invasion of aortic
and heart endothelial cells by Porphyromonas gingivalis. Infect Immun 66, 5337–5343. Donati, M., Moreno, S., Storni, E. & 7 other authors (1997). Detection of
serum antibodies to CagA and VacA and of serum neutralizing activity for vacuolating cytotoxin in patients with Helicobacter pylori-induced gastritis. Clin Diagn Lab Immunol 4, 478–482. Dorn, B. R., Dunn, W. A. Jr & Progulske-Fox, A. (1999). Invasion of
human coronary artery cells by periodontal pathogens. Infect Immun 67, 5792–5798. Haraszthy, V. I., Zambon, J. J., Trevisan, M., Zeid, M. & Genco, R. J. (2000). Identification of periodontal pathogens in atheromatous
plaques. J Periodontol 71, 1554–1560. Ishihara, K., Nabuchi, A., Ito, R., Miyachi, K., Kuramitsu, H. K. & Okuda, K. (2004). Correlation between detection rates of periodontopathic
bacterial DNA in carotid coronary stenotic artery plaque and in dental plaque samples. J Clin Microbiol 42, 1313–1315. Mattila, K. J., Asikainen, S., Wolf, J., Jousimies-Somer, H., Valtonen, V. V. & Nieminen, M. (2000). Age, dental infections and coronary heart
disease. J Dent Res 79, 756–760.
by PCR by using a simple sample-processing method. J Clin Microbiol 36, 157–160. Moter, A. & Go¨bel, U. B. (2000). Fluorescence in situ hybridization
(FISH) for direct visualization of microorganisms. J Microbiol Methods 41, 85–112. Moter, A., Leist, G., Rudolph, R., Schrank, K., Choi, B. K., Wagner, M. & Go¨bel, U. B. (1998). Fluorescence in situ hybridization shows spatial
distribution of as yet uncultured treponemes in biopsies from digital dermatitis lesions. Microbiology 144, 2459–2467. Oda, Y., Slagman, S. J., Meijer, W. G., Forney, L. J. & Gottschal, J. C. (2000). Influence of growth rate and starvation on fluorescent in situ
hybridization of Rhodopseudomonas palustris. FEMS Microbiol Ecol 32, 205–213.
References
Okuda, K., Ishihara, K., Nakagawa, T., Hirayama, A., Inayama, Y. & Okuda, K. (2001). Detection of Treponema denticola in atherosclerotic
Amann, R. I., Binder, B. J., Olson, R. J., Chisholm, S. W., Devereux, R. & Stahl, D. A. (1990). Combination of 16S rRNA-targeted oligonucleotide
Papapanou, P. N. (1993). Epidemiology and natural history of perio-
http://jmm.sgmjournals.org
lesions. J Clin Microbiol 39, 1114–1117.
95
F. Cavrini and others
dontal disease. In Proceedings of the 1st European Workshop on Periodontology, pp 23–41. Edited by N. P. Lang & T. Karring. Berlin: Quintessenz Verlags. Sambri, V., Marangoni, A., Eyer, C., Reichhuber, C., Soutschek, E., Negosanti, M. D’Antuono, A. & Cevenini, R. (2001). Western immuno-
blotting with five Treponema pallidum recombinant antigens for the serologic diagnosis of syphilis. Clin Diagn Lab Immunol 8, 534–539. Siqueira, J. F. Jr, Rocas, I. N., Favieri, A. & Santos, K. R. N. (2000).
96
Detection of Treponema denticola in endodontic infections by 16S rRNA gene-directed polymerase chain reaction. Oral Microbiol Immunol 15, 335–337. Sunde, P. T., Olsen, I., Go¨bel, U. B., Theegarten, D., Winter, S., Debelian, G. J., Tronstad, L. & Moter, A. (2003). Fluorescence in situ
hybridization (FISH) for direct visualization of bacteria in periapical lesions of asymptomatic root-filled teeth. Microbiology 149, 1095–1102.
Journal of Medical Microbiology 54
