Molecular Diagnosis and Epidemiology of Rabies - Springer Link

Chapter 14

Molecular Diagnosis and Epidemiology of Rabies Rodney E. Rohde and Bonny C. Mayes

Keywords Rabies • Rabies virus variants • Rhabdoviridae • FDA • Nucleic acid amplification test • CNS viruses • Rabies virus typing • RT-PCR • Restriction digest • DNA sequencing analysis

14.1

Introduction

Rabies is a viral disease that causes acute inflammation of the brain (encephalitis) in warm-blooded animals. It is a disease, primarily transmitted by the bite of animals (zoonotic), which is almost always fatal if treatment (post-exposure prophylaxis) is not administered prior to onset of severe symptoms. The disease occurs in more than 150 countries and territories and is responsible for thousands of deaths worldwide each year. Antigenic and genetic typing (and diagnostic) methods are powerful laboratory tools that help shed light on the often difficult identification and epidemiology which surrounds a rabies case.

14.2 14.2.1

Rabies Clinical Features and Molecular Pathogenesis of Disease

At the present time, the genus Lyssavirus contains seven viral genotypes; one of these defines rabies virus genotype 1, serotype 1 (RV), and the other six represent specific rabies-related lyssaviruses. Rabies is a zoonotic disease caused by viruses of the Lyssavirus genus. The virus is a single-stranded RNA, nonsegmented, negative-sense virus [1]. Transmission of rabies occurs when saliva containing rabies virus is introduced into an opening in the skin, usually via the bite or scratch of a rabid animal. Although rare, transmission can also occur through contamination of mucous membranes or

R.E. Rohde, Ph.D., M.S., SV, SM(ASCP)CM, MBCM (*) Clinical Laboratory Science Program, HPB 361, Texas State University, 601 University Dr., San Marcos, TX 78666, USA e-mail: [email protected] B.C. Mayes, MA Zoonosis Control Branch, Texas Department of State Health Services, Austin, TX, USA P.C. Hu et al. (eds.), Modern Clinical Molecular Techniques, DOI 10.1007/978-1-4614-2170-2_14, © Springer Science+Business Media, LLC 2012

199

200

R.E. Rohde and B.C. Mayes

transplantation. RV has the highest case fatality ratio of any infectious disease when intervention is not initiated prior to symptoms. Typical treatment for RV exposure consists of wound care, passive immunization with RIG, and a series of four doses of rabies vaccine [2, 3]. A differential diagnosis of rabies should be suspected for individuals with signs or symptoms of encephalitis or myelitis. Patients with these symptoms who respond to treatment do not require rabies testing. The absence of an exposure history does not provide evidence to terminate any suspicions of a rabies diagnosis because most patients in the USA have no definitive exposure history [4]. Indeed, several recent cases of rabies in humans in the United States have been diagnosed either retrospectively or after the clinical course of the disease has progressed despite compatible clinical observations. A heightened awareness is needed among the medical community of possible rabies infections in cases where clinical signs are compatible with a diagnosis of rabies. In addition, medical personnel must be aware of appropriate methods for sample collection for antemortem diagnosis and must know how to interpret the test results.

14.2.2

Specimen Submission and Laboratory Procedures

A patient history form detailing the clinical history of the patient should accompany the specimen, complete with the name and phone number of the physician who should be contacted with the test results. Likewise, animal specimens should also be accompanied by appropriate contact information. All samples should be considered potentially infectious. Test tubes and other sample containers must be securely sealed (tape around the cap will ensure that the containers do not open during transit). If immediate shipment is not possible, all samples, except brain tissues, should be stored frozen at −4.0°F or below. Brain tissues should be refrigerated at 45–32°F. Samples should be shipped frozen on dry ice (brain tissues on wet ice or frozen gel packs) by an overnight courier in watertight primary containers and leakproof secondary containers that meet the guidelines of the International Air Transport Association. The state health department, regional reference laboratory, and/or rabies laboratory at the Centers for Disease Control and Prevention (CDC) should be telephoned at the time of shipment and given information on the mode of shipment, expected arrival time, and courier tracking number [5]. In most states, it is preferable to ship by bus or other reliable carrier; contact the entity that will be receiving the shipment for their recommendations (http://www.cdc.gov/rabies/specific_ groups/laboratories/index.html). The single most important standard diagnostic test for rabies in animals is the DFA test [6, 7]. In cases where individuals are aware of an animal exposure with a known or suspected rabid animal, rapid and accurate laboratory testing of the animal, if it is available, allows hospital physicians to begin timely postexposure prophylaxis (PEP). It is equally important to know that an animal is not rabid because one is able to eliminate the need for expensive and extended rabies prophylaxis treatment. Even in instances where a laboratory diagnosis is delayed, once a negative rabies result is obtained, the PEP can be halted, preventing any further unnecessary medical treatment and associated costs [7]. For recommendations with respect to the testing of animals suspected of rabies, individuals should consult the annual Compendium of Animal Rabies Prevention and Control [8]. Lyssavirus samples can be discriminated (typed) by both antigenic and genetic methods. Antigenic methods commonly rely on monoclonal antibodies (MAbs) to identify unique epitopes or recognition sites. The resolving power of an antigenic analysis is typically determined by a direct relationship to the number of MAbs used to type a virus. Genetic typing methods detect viral RNA mutations at the nucleotide level, and different genetic typing methods can be ranked in their discriminatory power. Nucleotide sequencing (entire RV genome is approximately 12,000 nucleotides) has the highest resolution. Following sequencing, digestion with restriction enzymes follows in resolution. Finally, this is followed by using specific oligonucleotide probes to differentiate virus populations. The focus of this chapter will be that of genetic typing methods, which are more reproducible and readily quantified [9].

14

Molecular Diagnosis and Epidemiology of Rabies

201

Fig. 14.1 Immunofluorescence (DFA) of positive rabies antigen

14.2.3

Antemortem Testing Procedures

If rabies is considered as a diagnosis, a variety of samples should be sent for antemortem study. These include nuchal skin biopsy, saliva, serum, and cerebrospinal fluid (CSF). As with any disease of unknown origin, personal protective equipment and barrier protection should be considered for the collection of these samples. This will not only protect the technologist from exposure to rabies if the patient is rabid, but it will also protect the technologist against any other potential pathogens that have yet to be identified. The following instructions should be used to collect samples only after consultation with your state health department, with regional reference laboratory or with the rabies laboratory at the CDC [5]. Skin biopsies (5–6 mm in diameter) should be taken from the posterior region of the neck at the hairline. A minimum of 10 hair follicles, biopsied at a depth to include the cutaneous nerves at the follicle base, should be contained in the specimen. The specimen should be placed on a piece of sterile gauze moistened with sterile water and placed in a sealed container. Do not add preservatives or additional fluids. Laboratory tests to be performed include reverse transcription-polymerase chain reaction (RT-PCR) of extracted nucleic acids and DFA (see Fig. 14.1) for viral antigen in frozen sections of the biopsy [5]. Saliva should be collected using a sterile eyedropper pipette and placed in a small sterile container that can be sealed securely. Preservatives or additional material should not be added. Laboratory tests to be performed include detection of rabies RNA using RT-PCR and isolation of infectious virus in cell culture. Tracheal aspirates and sputum are not suitable for rabies tests [5]. A minimum of 0.5 ml of serum or CSF should be collected; no preservatives should be added. Whole blood should not be submitted because it contains various inhibitors against nucleic acid amplification techniques. If no vaccine or rabies immune serum has been given, the presence of antibody to rabies virus in the serum is diagnostic and testing of CSF is unnecessary. Antibody to rabies virus in the CSF, regardless of the immunization history, suggests a rabies virus infection. Laboratory tests for antibody include DFA and virus neutralization [5]. The rarity of rabies and the lack of an effective treatment make the collection of a brain biopsy unwarranted; however, biopsy samples negative for herpes and other types of encephalitis should be

202


tested for evidence of rabies infection [5, 10]. The biopsy is placed in a sterile sealed container; preservatives or other fluids should not be added. Laboratory tests to be performed include RT-PCR and DFA for viral antigen in touch impressions [5]. Integrity, type, and time of collection of antemortem specimens are critical to the correct diagnosis of a rabies infection. The neurotropic nature of the virus makes it important to collect a variety of samples early and intermittently during the course of a differential diagnosis. Due to the properties of rabies pathogenesis, one can assume limited success of antemortem diagnostic tests for rabies. For example, following primary infection, the virus enters an eclipse phase in which it cannot be easily detected within the host. This phase may last for several days or months. Investigations have shown both direct entry of virus into peripheral nerves at the site of infection and indirect entry after viral replication in nonnervous tissue (i.e., muscle cells). During the eclipse phase, the host immune defenses may confer cell-mediated immunity against viral infection because rabies virus is a good antigen. The uptake of virus into peripheral nerves is important for progressive infection to occur. After uptake into peripheral nerves, rabies virus is transported to the central nervous system (CNS) via retrograde axoplasmic flow. Typically, this occurs via sensory and motor nerves at the initial site of infection. The incubation period is the time from exposure to onset of clinical signs of disease. The incubation period may vary from a few days to several years, but it is typically 1–3 months. Dissemination of virus within the CNS is rapid and includes early involvement of limbic system neurons. Active cerebral infection is followed by passive centrifugal spread of virus to peripheral nerves. The amplification of infection within the CNS occurs through cycles of viral replication and cell-to-cell transfer of progeny virus. Centrifugal spread of virus may lead to the invasion of highly innervated sites of various tissues, including the salivary glands. During this period of cerebral infection, the classic behavioral changes associated with rabies develop and any virus present in the saliva is intermittent [11].

14.2.4

Postmortem Testing Procedures

Postmortem diagnosis of rabies in humans is made by the standard test DFA staining of viral antigen in touch impressions of brain tissue. Portions of the medulla (brain stem), the cerebellum, and the hippocampus should be kept refrigerated and shipped to a public health laboratory for rabies testing [5]. Preservation of tissues by fixation in formalin is not recommended if rabies diagnosis is desired. However, if tissue has been placed in formalin, procedures have been described to analyze the specimen [5, 12]. Reference laboratories that perform rabies virus variant characterization offer several benefits to the medical story. First, a determination of the virus variant is often only obtainable from postmortem samples. This is typically due to the lack of an animal exposure history from the patient, which subsequently means an absence of animal samples to test. A reference laboratory can aid in the elucidation of the mystery that will often be associated with a rabies case. The identification of the rabies virus variant may result in a clearer understanding of the type of exposure that the patient may have had with a rabid animal [4, 13] or any foreign travel by the patient. In recent years, one of the biggest assets of rabies virus typing has been the discovery that most of the cases for which there is no bite exposure history have been attributed to bat rabies virus variants. A publication by Alan Jackson [14] illustrates the very small puncture wounds associated with a bat bite (see Fig. 14.2). The combination of these factors has led to the enhanced CDC recommendation for bat exposures in that PEP is considered in all situations in which a bat bite or direct contact with a bat may have occurred. Second, a clarification of epizootiologic patterns will augment the creation of appropriate public health information and policy for prevention and control of rabies. Third, among the recommendations of the National Working Group on Prevention and Control of Rabies in the United States are expanded resources for regional and national virus typing laboratories. Public health laboratories are facing critical issues, not

14


203

Fig. 14.2 Puncture wound of a bite from a silver-haired bat (a, arrow) and skull of silver-haired bat (b) (Reprinted with permission from Elsevier Science (The Lancet, 2001, Vol 357, pp 1714))

the least of which is the problem of accurate surveillance of all the rabies virus variants throughout the USA and other countries. A good model to follow is the successful collaborations between the CDC and the Texas Department of State Health Services (DSHS) rabies laboratory over the last 20 years, which has produced the typing data to identify rabies variants common to animal reservoirs in the southwestern USA and Mexico and mapped their geographic distribution. Appropriately used, this knowledge should allow those who survey rabies to recognize when established reservoirs enlarge or expand into new areas or when different animal species become involved in cycles of rabies virus transmission. Regional laboratories can expand and complement the flow of national surveillance data by increasing their surveillance activities to include antigenic and molecular typing of virus samples from the surrounding states [15–22].

14.3

Methodology

Antigenic (MAb) typing is a simple, inexpensive way to quickly identify rabies virus variants. However, MAb typing has several limitations: it is an indirect FA test, so interpretation can be difficult and subjective at times; very weak specimens generally have to be amplified in mice or cell culture before MAb typing; and it does not differentiate between all variants (e.g., Texas fox and domestic dog-coyote variants have the same MAb pattern but are considered distinct variants). The molecular typing methods described below can be used in cases where MAb typing results are inconclusive.

204

R.E. Rohde and B.C. Mayes Table 14.1 Lysis buffer components Component 1 M Tris HCL pH 7.5 5 M NaCl 0.5 M MgCl NP40 Molecular grade water

14.4

Volume 100 μl 333 μl 33 μl 65 μl Bring volume to 10 ml

Protocols

Specimen types: skin biopsy, saliva, brain tissue

14.4.1

Reagents

RNA Extraction Reagents • • • • • •

Lysis buffer components (see Table 14.1) TRIzol Chloroform, molecular grade Isopropanol, molecular grade Ethanol, molecular grade, 75% Molecular grade water

Reverse Transcription-Polymerase Chain Reaction Reagents • • • • • • •

RNAse inhibitor Reverse transcriptase-AMV (RT-AMV) and accompanying 5× RT buffer Molecular grade water 10 mM PCR nucleotide mix (dNTP) Forward and reverse primers AmpliTaq 1 M Tris-HCl, pH 8.3

Gel Electrophoresis Reagents • • • •

Agarose TBE buffer, 10×, molecular biology grade Ethidium bromide ΦX174 DNA-HaeIII digest

Endonuclease Restriction Digest Reagents • Restriction endonucleases Hinf I and/or Dde I with accompanying buffer H 0.5 M EDTA Nucleotide Sequencing Reagents • BigDye® Terminator v1.1 Cycle Sequencing Kit • DyeEx 2.0 Spin Kit • Hi-Di™ formamide

14


Table 14.2 Primers for rabies RT-PCR and nucleotide sequencing Primer ID Orientation Genome position Sequence Lys001 Forward 1–15 ACGCTTAACGAMAAA Forward 647–666 ATGTGYGCTAAYTGGAGYAC 550Fa 1087Sdeg Forward 1,157–1,173 GAGAARGAACTTCARGA 1066degBa Reverse 1,136–1,155 TCYCTGAAGAATCTTCTYTC 304 Reverse 1,514–1,533 TTGACGAAGATCTTGCTCAT a Reverse complement of a published primer

14.4.2

Procedure

14.4.2.1

RNA Extraction

205

Reference [24] a [24] [25] a [25] [13]

1. Aliquot 0.1 ml lysis buffer into 1.5-ml PCR tubes (one per sample plus a blank control); place tubes on ice (keep tubes on ice at all times). 2. Remove a small piece of brain material/skin biopsy (~50 mg) from an uncut area of each sample or pipette a sample of saliva (~100–200 μl); place into lysis buffer and homogenize with sterile applicator sticks. 3. Add 1 ml TRIzol to each tube and mix for approximately 30 s by shaking vigorously; vortex and centrifuge briefly. 4. Incubate mixtures at 21°C (room temp) for 5 min. 5. Add 0.2 ml chloroform to each tube and shake vigorously for 30 s. 6. Incubate mixtures at 21°C (room temp) for 2–3 min. 7. Centrifuge samples for 15 min at 4°C at 12,000 × G; add 0.5 ml isopropanol to 1.5-ml sterile screw cap conical tubes (one per sample plus one blank). 8. After centrifugation, remove top aqueous layer containing RNA and add to tubes containing isopropanol; shake or vortex briefly. 9. Incubate tubes for 10–15 min at room temperature. 10. Centrifuge tubes for 10 min at 4°C at 12,000 × G. 11. Gently pour off supernatant into chemical waste. 12. Add 1 ml cold 75% ethanol to each tube; vortex. 13. Centrifuge samples for 5 min at 4°C at 7,500 × G. 14. Remove samples from centrifuge, decant ethanol into chemical waste, and blot tubes on sterile gauze. 15. Rehydrate RNA pellet with 100 μl cold molecular grade water. 16. Vortex tubes on low to medium speed for 2 min. 17. Incubate samples at 56°C for 10 min in dry bath to dissolve RNA pellet. 18. Use immediately (4°C on ice) or store in −70°C freezer.

14.4.2.2

Reverse Transcription-Polymerase Chain Reaction

1. Add 2 μl forward primer (5 μM if specific; 10 μM if degenerate) to 0.2-ml PCR tubes (see Table 14.2). 2. Add 5 μl RNA to each tube and mix with primer. 3. Thaw reverse transcription reaction mix (RTRX; see Table 14.3) and prepare mixture by adding 2 μl of RT-AMV and 2 μl of RNAse inhibitor to a 5× RTRX tube (or 1 μl of each if a 2.5× tube is used). 4. Place tubes in thermal cycler; incubate tubes for 1 min at 94°C.

206

R.E. Rohde and B.C. Mayes Table 14.3 Reverse transcription reaction mix (RTRX) RTRX Molecular grade water 5X RT buffer 10 mM PCR nucleotide mix (dNTP)

Amount 407 μl 333 μl 33 μl 773 μla a Aliquot 66 μl of mix into eight 0.5-ml tubes for 5X RTRX and 33 μl into seven 0.5-ml tubes for 2.5X RTRX; store at −20°C

Table 14.4 PCR mix (volumes for 1–5 reactions) PCR mix 1 (μl) 2 (μl) 3 (μl) 4 (μl) 5 (μl) a Forward primer (20 μM ) 1.06 2.13 3.2 4.25 5.31 Reverse primer (20 μMa) 1.33 2.66 4.0 5.33 6.66 AmpliTaq 0.53 1.07 1.61 2.13 2.66 1M Tris-HCl, pH 8.3 8.55 17.1 25.6 34.2 42.75 Molecular grade water 73.6 147.2 220.8 294.4 368.0 a 40μM for degenerate primers

5. 6. 7. 8. 9. 10.

Place tubes on ice for at least 3 min. Add 14 μl of RTRX mixture to each tube; vortex and centrifuge briefly. Place tubes in thermal cycler for 90 min at 42°C. Prepare PCR mix (see Table 14.4). Add 80 μl PCR mix to each tube; vortex and centrifuge briefly. Place tubes in thermal cycler.

14.4.2.3 • • • • • •

94°C 94°C 37°C 72°C 72°C 4°C

14.4.2.4

PCR Program 1 min 30 s 30 s 90 s 7 min hold

40 cycles

Gel Electrophoresis

1. Make a 4% agarose gel by adding 2 g agarose to 50 ml TBE; microwave the mixture until clear (add additional DI water as needed); add 2.5 μl ethidium bromide to the gel; allow to cool down sufficiently and pour. 2. Place solidified gel in submarine and add TBE buffer. 3. Add 5 μl ΦX174 DNA-HaeIII digest to the first and last wells. 4. Mix 5 μl of each sample with 2 μl loading dye and add to wells. 5. Run the gel at ~125 mAmp for ~30–45 min or until the markers reach the bottom of the gel. 6. Photograph the gel; band strength will be used to determine volume required for sequencing.

14


207

Table 14.5 Sequencing reaction mix Sequencing reaction Amount (μl) BigDye Terminator v1.1 Mix 8 Primer (5 μM if specific; 10 μM if degenerate) 2 a Template 1–8 QS to 20 μl with water 2–9 a Volume depends on amount of product and genetic analyzer used (e.g., for ABI 310, add 1 μl for very strong bands and 8 μl for very weak bands)

14.4.2.5

Restriction Endonuclease Digestion

This method has been used successfully to differentiate between canine variants in Texas [16]. It may be a suitable tool for identification of variants in other areas; a comparative study would be necessary to determine if this is a viable tool. 1. Heat dry block to 37°C. 2. Label 0.2-ml PCR tubes with sample ID and enzyme used (Dde I and/or Hinf I). 3. Prepare enzyme mixture(s) for use on all specimens by adding 1 μl of either Dde I or Hinf I and 2 μl of buffer H to a tube(s). Prepare enough enzyme mixture for the number of samples plus one to ensure there is sufficient mixture for all samples (e.g., if there are three samples, prepare enough mixture for four). 4. Add 3 μl of enzyme mixture to each labeled PCR tube. 5. Add 17 μl of amplicon (PCR product) to each tube; vortex and centrifuge briefly. 6. Place samples in a 37°C dry block for 1.5–2 h. 7. Stop the reactions by placing on ice (or refrigerate for short time period prior to electrophoresis). 8. Use gel electrophoresis and a UV light box to visualize fragment patterns.

14.4.2.6

Nucleotide Sequencing

1. Add the following reagents to 0.2-ml PCR tubes (two tubes for each sample – one for the forward primer and one for the reverse primer) for sequencing reactions (see Table 14.5). 2. Vortex tubes; spin briefly and place in thermal cycler. 3. After cycle sequencing, remove dye terminators from the samples by following the manufacturer’s instructions in the DyeEx 2.0 Spin Kit. 4. Place samples in a capillary sequencer (ABI 377, 310, 3730 or other appropriate genomics analyzer).

14.4.2.7 • • • • •

96°C 96°C 50°C 60°C 4°C

Nucleotide Sequencing Program 1 min 10 s 5s 25 cycles 4 min hold

208

14.5 14.5.1


Interpretation of Results PCR

A sample is considered positive for RV if a band of the appropriate size is present in the lane for that sample (e.g., 377-bp fragment if 1087Sdeg:304 primer set is used). A band should not be present in the blank (negative) control lane; presence of a band is indicative of contamination. The amount of PCR product needed for the sequencing reaction is determined by the band thickness (strength) and genetic analyzer used (see Fig. 14.3).

14.5.2

Restriction Endonuclease Digestion

Following enzyme digestion, compare fragment patterns of samples with characteristic digest patterns (see Fig. 14.4) for specific variants [16]. A restriction digestion should be carefully confirmed with sequence analysis of rabies virus variants due to high mutation rates, especially due to bat rabies virus variants.

Fig. 14.3 Ethidium bromide–stained agarose gel electrophoresis of RV amplicons. Lanes 1, 16 = ΦX174/ HaeIII marker fragments; lane 2 = blank; lanes 3, 6, 8 = strong band, use 2 μl for sequencing; lanes 4, 5, 10 = very strong band, use 1 μl for sequencing; lane 7 = failed amplification; lane 9 = weak band, use 8 μl for sequencing; lanes 11–15 = blank. The amount of DNA for sequencing is based on CDC recommendations

14


209

Fig. 14.4 Ethidium bromide–stained agarose gel electrophoresis analysis of cDNA amplified with primers 10g:304 and digested by either Dde I (lanes 1–3) or Hinf I (lanes 5–7). Lanes 1, 5 (SD variant); lanes 2, 6 (DDC variant); lanes 3, 7 (TF variant). Lanes 4, 8 = M (ΦX174/ HaeIII marker fragments)

14.5.3

Nucleotide Sequencing

Sequencing data analysis requires software for editing and aligning sequences. BioEdit is a free program that can be downloaded from http://www.mbio.ncsu.edu/BioEdit/bioedit.html. The software will align and compare the overlapping sequences (obtained from the forward and reverse primers). Sequencing software, such as DNASTAR Lasergene, can be purchased for performing more comprehensive sequence analysis. After necessary edits are made to a sequence, the sequence needs to be compared to representative RV variant sequences. An inclusive set of such sequences is available in GenBank (http://www.ncbi.nlm.nih.gov/genbank/). Copy and paste the edited sequence into the search engine Nucleotide BLAST, select “others” for the database, and optimize for “highly similar sequences.” The best matches will generally be the sequences at the top of the table. If the host species is the same for the best matches (e.g., the top ten matches are RV sequence from Lasiurus cinereus bats), there is a high probability that the sequence being analyzed represents the variant associated with that host species. Spillover of RV variants does occur, so these results must be interpreted with great care; consider collectively the host species or suspected source of virus, MAb typing results,

210


BLAST results, and phylogenetic tree analysis [17, 21, 23, 24]. While unnecessary, it is useful to generate a phylogenetic tree from the sample and known RV variants for comparison with geographical host range of RV variants.

14.6

Summary

The DFA assay is the test most frequently used to diagnose rabies in animals. Tissue from the animal is required in suspected rabies cases and can only be performed postmortem. This test has been thoroughly evaluated for over four decades and is recognized as the most rapid and reliable of all the tests available for routine use. All rabies laboratories in the USA perform this test on suspect rabies cases. Other tests for diagnosis and research, such as electron microscopy, histologic examination, immunohistochemistry, RT-PCR, and isolation in cell culture, are useful tools for studying the virus structure, histopathology, molecular typing, and virulence of rabies viruses [24, 25]. Likewise, rabies testing in humans can be performed postmortem on brain tissue by DFA. Antemortem testing should only be performed by highly trained professionals that understand the neurotropic nature of rabies virus in samples such as saliva or hair follicles. The CDC, along with individual state health laboratories and the patient’s physician, should always be consulted for specialized molecular testing of rabies samples. For instance, it has become increasingly important to understand human rabies cases where the bite of a bat has gone unnoticed by the physician or individual does not remember an animal exposure. In the USA, most human mortality from rabies over the past decade were the result of unsubstantiated bat bites. For those laboratories without genetic typing capability, antigenic analysis with MAbs offers a rapid, simple, and inexpensive means of typing RV for epidemiologic surveys. MAb typing can be a useful screening test to differentiate the main terrestrial RV variant from bat rabies viruses [21]. Further, a restriction enzyme analysis can help with more precise differentiation between antigenic strains that are too closely related for MAb typing to separate RV variants. For instance, in Texas, the Texas fox and domestic dog-coyote RV have identical MAb panels, and a restriction digest can usually differentiate between the two. This is typically not the case with bat RV variants [16, 17, 19, 21]. On the other hand, genetic typing, especially nucleotide sequencing, offers the most precise analysis and virus type explanation in regard to diagnosis and epidemiology of the individual case [5, 25].

References 1. Bourhy H, Kissi B, Tordo N. Molecular diversity of the Lyssavirus genus. Virol. 1993;194:70–81. 2. Manning SE, Rupprecht CE, Fishbein D, et al. Human rabies prevention—United States, 2008: recommendations of the Advisory Committee on Immunization Practices. MMWR Recomm Rep. 2008;57(RR-3):1–28. 3. Rupprecht CE, Briggs D, Brown CM, et al. Use of a reduced (4-dose) vaccine schedule for postexposure prophylaxis to prevent human rabies. MMWR Recomm Rep. 2010;59(RR-2):1–9. 4. Noah DL, Drenzek CL, Smith JS, et al. Epidemiology of human rabies in the United States, 1980–1996. Ann Intern Med. 1998;128:922–30. 5. Rohde RE, Wilson PJ, Mayes BC, Oertli E, Smith JS. Rabies: methods and guidelines for assessing a clinical rarity. American Society for Clinical Pathology, 2004 Microbiology No. MB-4 Tech Sample; 2004. p. 21–9. 6. Dean DJ, Abelseth MK, Atanasui P. The fluorescent antibody test. In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies. 4th ed. World Health Organization: Geneva; 1996. p. 88–95. 7. Hanlon CA, Smith JS, Anderson GR, et al. Special series-recommendations of a national working group on prevention and control of rabies in the United States. Article II: Laboratory diagnosis of rabies. JAVMA. 1999;215(19): 1444–6. 8. CDC. Compendium of animal rabies prevention and control. MMWR. 2008;57(RR02):1–9.

14


211

9. Smith JS. Molecular epidemiology. In: Jackson AC, Wunner WH, editors. Rabies. San Diego: Academic Press/ Elsevier Science; 2002. p. 79–111. 10. Smith JS. Rabies virus. In: Murray PR, Baron EJ, Pfaller MA, et al., editors. Manual of clinical microbiology. 7th ed. Washington, DC: American Society for Microbiology; 1999. p. 1099–106. 11. Baer GM, editor. The natural history of rabies. Boca Raton: CRC Press; 1991. 12. Whitfield SG, Fekadu M, Shaddock JH, Niezgoda M, et al. A comparative study of the fluorescent antibody test for rabies diagnosis in fresh and formalin-fixed brain tissue specimens. J Virol Meth. 2001;95:145–51. 13. Smith JS, Orciari LA, Yager PA. Molecular epidemiology of rabies in the United States. Semin Virol. 1995; 6:387–400. 14. Jackson AC, Fenton MB. Human rabies and bat bites. Lancet. 2001;357(9269):1714. 15. Rohde RE, Neill SU, Fearneyhough MG, et al. Establishing a regional reference laboratory for rabies virus typing at the Texas Department of Health: a work in progress. http://www.dshs.state.tx.us/idcu/disease/rabies/testing/lab/ reference/abstract. Accessed 26 May 2011. 16. Rohde RE, Neill SU, Clark KA, et al. Molecular epidemiology of rabies epizootics in Texas. J Clin Virol. 1997; 8:209–17. 17. Leslie MJ, Messenger S, Rohde RE, Smith JS, Cheshier R, Hanlon C, et al. Bat-associated rabies virus in skunks. Emerg Infect Dis [serial on the Internet]. 2006 Aug [date cited]. Available from http://www.cdc.gov/ncidod/EID/ vol12no08/05–1526.htm. 18. Oertli EH, Wilson PJ, Hunt PR, Sidwa TJ, Rohde RE. Rabies in Skunks in Texas. JAVMA. 2009;234(5):1–5. 19. Rohde RE. Controlling rabies at its source: the Texas experience – oral rabies vaccination program. ASCLS Today. 2008;22(5):14–5. 20. Sidwa TJ, Wilson PJ, Moore G, Oertli E, Hicks B, Rohde RE, Johnston D. Evaluation of oral rabies vaccination programs for control of rabies epizootics in coyotes and gray foxes: 1995–2003. JAVMA. 2005;227(5):785–92. 21. Rohde RE, Mayes BC, Smith JS, Neill SU. Bat rabies, Texas, 1996–2000. Emerg Infect Dis [serial online]. 2004 May [date cited]. Available from: http://www.cdc.gov/ncidod/EID/vol10no5/03–0719. 22. Sabouraud A, Smith JS, Orciari LA, de Mattos C, de Mattos C, Rohde RE. Typing of rabies virus isolates by DNA enzyme immunoassay. J Clin Virol. 1999;12:9–19. 23. Markotter W, Kuzmin I, Rupprecht CE, Randles J, Sabeta CT, Wandeler AI, Nel LH. Isolation of Lagos bat virus from water mongoose. Emerg Infect Dis 2006;12(12):1913–8. Available from: http://www.cdc.gov/ncidod/eid/ vol12no12/06–0514. 24. How is rabies diagnosed? http://www.cdc.gov/rabies/diagnosis/index.html. Accessed 19 December, 2011. 25. Orciari LA, Rupprecht CE. Rabies virus. In: Murray PR, Jorgensen JH, Baron EJ, Landry ML, Pfaller MA, editors. Manual of clinical microbiology. Washington: ASM Press; 2007. p. 1470–7.