Molecular diagnosis of Salmonella

Molecular Diagnosis of salmonellosis Dr. B.R. Singh National Salmonella Centre (Vety), Division of Bacteriology & Mycology IVRI, Izatnagar – 243 122 Salmonella is the only major genus of bacteria named after a Veterinarian. It was identified more than a century ago but its pathogenicity and virulence mechanism is till ill understood. Despite extensive research efforts using molecular techniques, disease is still hyperendemic in many parts of the world and entering into many virgin fields affecting man and animal both. Its epidemiology is complicated by wide host range, numerous serovars and spread by vectors, carriers and food. The simple epidemiological methods often fail to elucidate the extent of disease thus molecular epidemiology is must to be developed. Over 2400 different Salmonella have been identified but only few predominate in an animal population of a defined area or country at any time. There is global pandemic of S. Enteritidis but predominant phagetypes vary in different countries. Although S. Enteritidis is primarily associated with poultry, very little is known about factors resulting in to pandemic due to lack of proper epidemiological understanding. In India, S. Typhi is still predominant serotype followed by S. Typhimurium and emergent strains of S. Weltevreden, while S. Paratyphi C. in human beings and S. Pullorum in poultry birds are almost vanished in last two decades, why it has happened, little is understood and needs lot of investigations. On the basis of available methods like antibiograms and phage typing it is further confusing, as strains with similar antibiogram and phage types are prevalent in remotely connected areas thus to elucidate the epidemiology, molecular techniques are much more needed to launch effective control measures. Salmonella are wide spread in environment and their persistence has been shown in environment of human beings, calves, poultry units and other susceptible populations. Problem is further aggravated by survival of these in insects/pests, wild animals (not only mammalians but also in animals of lower orders) and on plants and plant products. Routine cleansing and disinfection techniques often fail to eliminate Salmonella due to emerging drug resistance and sometimes help the pathogen to survive much better by killing the competing commonsal flora. Role of biofilms (made of organic polymers) in survival of Salmonella and other pathogens and affording protection to bacteria against chemical disinfectants is quite understood but other mechanisms have also been shown important and molecular epidemiology become essentially to explore further factors in complex environment and spread of Salmonella through food, feed and water. Before going in to details, one must understand that there are 3 major types of Salmonella named as, humon adapted strains of S. Typhi, S. Paratyphi A, B and C; animal host adapted strains of S. Choleraesuis of pigs; S. Dublin of cattle, caprine and ovine, S. Pullorum and S. Gallinarum in poultry and other birds, S. Abortus ovis of rd ovines, S. Abortus-equi of equines and rest of the Salmonella fall into the 3 group of wide host range type. It is still not understood what are the factors responsible for host specificity and what are the factors for adaptation of a host restricted strain to other animals and researchers are engaged to resolve this important aspect of epidemiology of Salmonella using in vivo expression technology (IVET) and signature tagged mutagenesis (STM) besides conventional in vitro techniques like studies of bacterial responses in different tissue culture assays for adhesions, invasion, cytotoxicity and cytokine release etc. Studies of bacterial behaviors to changes in pH, temperature, iron levels, different host cells and macrophages have been used. Recently GAMBIT (Genetic analysis and mapping by in vitro transposition) has emerged as new tool to identify essential genes for the purpose. In IVET, promoter trap strategies are designs to identify promoters that are specifically activated in host and permits positive detection for such promoters. In STM, technique relies on comparative hybridization to identify mutants unable to survive in the host. In GAMBIT, a specific region of the chromosome in amplified by PCR (extended length PCR) and product is subjected to in vitro transposon mutagenesis and transformants are made to grow under specific conditions. Then PCR is performed on post selection pool using a transposon specific primer and a primer from known location in chromosome for determining the gene required for survival. This analysis is named as “genetic foot printing” (Chiang et al. 1999). In India, 1990 onward salmonellosis cases not responding to chloramphanicol, ampicillin or TMP-SMX, mushroomed in different parts. At some places patients kept on dying due to failure to recognise the emergence of multi drug resistance in Salmonella and it became a mysterious problem.

PDF created with pdfFactory Pro trial version www.pdffactory.com

Through epidemiological investigation it was revealed that multi drug resistant Salmonella (MDRS) emerged in south China. MDRS were Ist recognised in Calcutta, in India, in an outbreak of enteric fever in 1989 and thereafter it was isolated all over India. Epidemic due to this started in early 1992 and lasted 2 years in Vellore. Similar outbreaks in Madras, Dindigal, Pondicherry, Trichur, Calicut, Manipal, Bangalore, Gulbarga, Rohtak, Ludhiana and Chandigarh were identified. Property of multidrug resistance is mediated through transferable plasmid, which can infect any Salmonella and disease is flourishing in India in hyperendemic form now (John et al. 1996). It is still not clear how MDRS spread so quickly all over Worlds and what strategies should be planned for prevention of occurrence of further epidemics due to other serovars. Besides understanding the pathogenic attributes and distribution of disease, the diagnosis of disease is the most important tool of an epidemiologist. Quick and reliable diagnosis of salmonellosis is still considered farfetched goal. Two approaches has been attempted for diagnosis of salmonellosis one is antigen identification and other is antibody characterization, while Ist approach is more important for prospective epidemiology, retrospective epidemiologist mainly depend a serological diagnosis for investigation of outbreaks as loss of antigen in serum and other tissues is common during treatment with antibiotics and common preservatives. For antigen identification two lines have been adopted, one is to identify the strain as Salmonella, and others are aimed to differentiate between two or more strain of Salmonella. As food is the commonest vehicle for salmonellosis spread, food processors are not allowed to sell food products containing Salmonella, most of the work has been done toward identification of Salmonella in food/feed and drinks. However, epidemiologists has to deal with population so he/she can not apply the techniques for food on living beings in a population. For diagnosis and to study epidemiology of salmonellosis, techniques are almost same and can be modified according to need. Important techniques has been summarized below : Traditional (Conventional) Techniques : A : B :

Antigen identification-by isolation, biotyping, serotyping, phage typing, antibiogram, colicin typing etc. Antibody identification in serum and other body fluids e.g. widal test for human salmonellosis, whole blood agglutination test for salmonellosis in birds.

Rapid plate agglutination test (RPAT), standard tube agglutination test (STAT), passive haemogglutination test (PHAT), antiglobulin test (AGT) and enzyme immunoassays. (Narayan Swamy and Trishnappa 1997) are same other tests. Among the recently developed immunoglobulin based tests, enzyme immunoassay (EIA), radioimmunoassay (RIA), counter immunoelectrophoresis (CIE) and ELISA are important. Many commercially available diagnostic kits and Salmonella identification kits are in market of different countries and utilizes antibodies raised either specific multivalent or some common antigens. Some of them are listed hereunder : TEK-ELISA (Organon Teknika, Cambridge UK) IFR-ELISA (Wyatt et al. 1995) Report-EIA & TECRA Salmonella Visual A (Wilson et al. 1990) Dulcitol-1-phosphate dehydrogenase (DPD) mab based kit (Tian et al. 1996) Cytotoxin-1-antibodies based Salmonella detection protocol (Singh et al. 2000) Chekit-S-enteritidis (ELISA) kit (Baumgartner et al. 1993) Polymyxin cloth enzyme immunoassay (Blais et al. 1997) 1-2 Test (Bio-control, Bothel, USA) Single step Salmonella (SSS) by Ampcor, Camden USA ® Iso-Grid of Dynal, Oslo Vi-TEK & Vi ELISA (Sharma et al. 1997) Meat Juice ELISA kit (Steinbach et al. 1999) Most of antibody based methods are designed to identify Salmonella (antigen) isolated in labs or in clinical or food samples but many of them can be used to identify antibodies in serum of suspected patients. Most of the tests are based on ‘O’ or ‘H’ antigens of Salmonella and have many chances to fail if Salmonella is of rare serovar, a few, as DPD based and cytotoxin I based ELISA are real broad range and exploit common product specific to Salmonella genus. While DNA methods for detection and identification of pathogens have been commonly used in many research laboratories, majority of the methods have never been applied in routine diagnostic labs. It is mainly due to dependence of most methods on traditional culture techniques and hence are not truly rapid methods.


Furthermore, detection of pathogens directly from clinical samples/food samples is theoretically possible with these methods but rarely 100% successful. Major problems are the detection of dead cells, the presence of enzyme inhibitors and in accessibility of the target organisms in clinical samples. Still, PCR and DNA based methods for detection of pathogens have many advantages over classical techniques as these methods are quite more sensitive and specific and rapidity can be obtained by including some modifications as complimenting with direct chemical extraction of nucleic acids or immuno magnetic separation of bacteria or short cultivation of pathogens from food and clinical samples. The best use of DNA and PCR based techniques has been made in characterization of strains isolated and purified by traditional methods e.g. for demonstration of toxin genes, virulence associated gene and differentiating between closely related strains of almost every type of pathogen including Salmonella. The important DNA techniques for Salmonella identification and epidemiology are : PCR : By this method a target DNA fragments are amplified using a cyclic 3 step process namely denaturation of target DNA at high temperature, anealing of two synthetic oligonucleotides named primers and polymerization with heat stable Taq DNA polymerase. There are many types of PCR, many methods to increase their specificity e.g. combining two PCR methods (nested PCR), here two sets of primers are used. Although PCR reaction is capable to detect DNA of single bacteria, volume 3 of sample (5-10 µl) required for reaction restrict its detection limit at about 10 cells per ml. PCR techniques for diagnosis of Salmonellosis are in use since 1983 and probes have been developed from either randomly cloned chromosomal fragments (Cryptic DNA fragments) or specific genes either an plasmids or in chromosomes. Probes have been designed for identifying number Salmonella ginus as well as for Salmonella of different species, serogroups and serotypes too. Common PCR primers (5’ – 3’ orientation) for Salmonella genus 1. Product 163bp P1 : TTATTAGGATCGCGCCAGGC P2 : AAAGAATAACCGTTGTTCAC (Widjojoatmodjo et al. 1991) 2. inv product 284 bp 139 : GTGAAATTATCGCCACGTTCGGGCAA 141 : TCATCGCACCGTCAAAGGAACC (Rahn et al. 1992) 3. Random genomic product 429 bp ST 11: AGCCAACCATTGCTAAATTGGCGCA ST 15 : GGTAGAAATTCCCAGCGGGTACT (Aabo et al. 1993) 4. Hin H2 flagellin gene (236 bp) Hin 1750 L : CTAGTGCAAATTGTGACCGCA Hin 1750 R : CCCCATCGCGCTACTGGTATC ctagtgcaaattgtgaccgca 5. H-li flagellin gene (173 bp) H-li 1788 : AGCCTCGGCTACTGGTCTTG H-li1789 R : CCGCAGCAAGAGTCACCTCA (Way et al., 1993) agcctcggctactggtcttg 6. GVV PQ fimbriae agf product (261 bp TAF 3 : TCCGGCCCGGACTCAACG TAF 4 : CAGCGCGGCGTTATACCG (Doran et al. 1993) Tccggcccggactcaacg 7. inv A and inv gene (457 bp) S1 : TGCTACAAGCATGAAATGG S2 : AAACTGGACCACGGTGACAA (Stone et al. 1994) Tgctacaagcatgaaatgg tgctacaagcatgaaatggcaga 8. Spv A gene based 450 bp. 382 : CAGACCACCAGTCCGGCAC 383 : CAGTCAATGCTCTCTCGCTG (Lampel et al. 1996) cag acc accagtccggcac ccg atc accagtccggcac cgaacggttg 9. hisJ gene (Cohen et al. 1994)


Product size:496 bp Cohen 1, 5’ ACT GGC GTT ATC CCT TTC TCT GGT G 3’ Cohen 2, 5’ ATC TTG TCC TGC CCC TGG TAA GAG A 3’ actggcgttatccctttctctggtg Specific PCR MAMA-PCR : (Mismatch amplification mutation assay (MAMA) developed to identify infrequent mutation, uses primers designed to have a single mismatch with mutated allele and a double mismatch with wild type thus permitting amplification of mutated but not the wild type DNA templet. Using this technique S. enteritidis specifc primers based on sequence of spvA (Lampel et al. 1996) have been developed. 597 598

5’ GCAGACATTATCAGTCTTCAGG 5’ TCAGGTTCGTGCCATTGTCAA

3’ 3’

Product size is 351 bp. Specificity is based on change at 272 position of spv A gene. Serogroup specific PCR : Important diagnostic tool particularly in identification of rough strains (Hoorfar et al. 1999). Serogroup B C1 C2-C3 A&D

B1 : B2 : C1 : C2 : C21 : C31 : D1 : D2 :

Primers (5’-3’) AGAATATGTAATTGTCAG TAACCGTTTCAGTAGTTC GGTTCCATAAGTATATCT CTGGATACGAACCCGTAT ATGCTTGATGTGAATAAG CTAATCGAGTCAAGAAAG TCACGACTTACATCCTAC CTGCTATATCAGCACAAC

Amplicon size bps 882 471 820

720

Oligos used for Salmonella detection by hybridization method Target gene, Oligoseqeunce (5’-3’) Random chromosomal fragemnt TS11 : GTCACGGAAGAAGAGAAATCCGTACG TS21 : TACATCGTAAAGCACCATCGCAATA TS31 : AGACCACTGACCCAGCCTAATCAA Random chromosomal fragment ST15 rev : GAGTACCCGCTGGGAATTTCTAC InvA gene S3 : CTGGTTGATTTCCTGATCGC

Tsen et al. 1991

Olsen et al. 1995 Stone et al. 1994

IS200 is not present in S. Agona, S. Arizonae, S. Dar-es-Salam, S. Panama, S. infantis, S. Virchow 3-4 and S. I.9, 12 : Z . Detection limit for S. typhi is 10 (Fu/ml). In IS 200 a tandem repeat of 0.3 kb I used for cross hybridization (Gilbert et al. 1990). Colorimetric single phase hybridization assay (CdorDNAH) can detect Salmonella by use of 16S and 23 S rRNA based probes but it can not detect S. subspp. V. and gave 7% false positive due to cross reaction with Citrobacter freundii (Curiale et al. 8 9 1990) and detection limit is 10 -10 cfu/ml. It is produced by Genetrack (earlier used radiolabelled probe but now enzyme labelled probes are used) AOAC approved (Flowors et al., 1987). Specificity and sensitivity of non-radioactive rRNA based oligonucleotide probs are comparable with culture method and results are given usually in 48 hr. AD-PCR (Arbitrarily primed PCR) or randomly like (UP-unprimed) PCR or RAPD-PCR: A random amplified polymorphic DNA finger printing method was developed to differentiate isolates of Salmonella serotypes. In this method a small oligonucleotide is used as primer and anealing temperature is kept low to allow lot of non-specific binding. This method has an inharent variability even in the hands of same person attempting at different time.


Commonly used primers for Salmonella, are : 5 5 1254-5 640-5 650-5

TGAGCATAGACCTCA GGGGGGGGG CCGCAGCCAA CGTGGGGCCT AGTATGCAG

3 3 3 3 3

(Fadl et al. 1995, Bakshi et al. 2000) (Singh, unpublished data) (Akopyanz et al. 1992, Hiltan et al.1996) (Burr et al. 1998)

Multiplex – PCR : (MP-PCR) This is similar to normal PCR but here more than one set of primers are used to amplify specific product like a genus specific set and another group specific set of primers. This type of PCR technique is quite common but one has to compromise to sensitivity and specificity as has to select a PCR cycle for both set of primers. Nested PCR : It is quite similar to multiplex PCR but here different primer sets are added at different nd time, Ist few PCR cycles are set according to one set of primer and then 2 set of primers is added and PCR cycle is set accordingly. It is quite more sensitive and specific in comparison to MP-PCR. ERIC-PCR (Enterobacterial repetitive intergenic consensus PCR ) : Recently a family of repetitive elements called enterobacterial repetitive intergenic consensus (ERIC) or intergenic repeat untis (IRUs) has been defined using E. coli and Salmonella Typhimurium genome. These 126 bp elements contain a highly conserved central inverted repeats are located in extragenic regions and are unrelated to REP consensus sequences. Inter ERIC distance and pattern is specific for bacterial species and strains of different origin. This specificity can be employed to differentiate between closely related different bacterial strains using single set of primers commonly used ERIC primers are ERIC-1 5 ERIC-2 5

ATGTAAGCTCCTGGGGATTCAC AAGTAAGTGACTGGGCTGAGCG

3 3 (Versalovic et al. 1991, Burr et al. 1998)

ERIC elements can be used as radiolabeled probe for slot blot or southern blot hybridization. Common probe is 5 GTGAATCCCCAGGAGCTTACATAAGTAAGTGACTGGGGTGAGCG 3 REP-PCR : Similar to ERIC elements of enterobacteria and Alu repeats of mammalions prokaryotic genomes also has some noncodong repetitive DNA. Repetitive extragenic palindromic (REP) elements also known as palindromic units (PU) are 38 bp consensus sequence containing six totally degenerate positions including a 5 bp variable loop between each side of the conserved stem of the palindrome. Multiple functions have been thought of for these elements including role in transcription termination, mRNA stability and chromosomal domain organization in vivo. The distribution of REP is diverse in prokaryotic genomes and can be examined with PCR or by slot blot hybridization with radiolabelled.Consensum probes (Versalovic et al. 1991) Primers REP 1R-I-5 RER 2-I-5

IIIICGICGICATCIGGC ICGICTTATCIGGCCTAC

3 3

REP ALL-I has been used as radiolabeled probe. REPALL-I 5 GCCIGATGICGICGIIIIIIIICGICTTATCIGGCCTAC

3

These primers and probes are not only useful to type Salmonella but can be used to for typing of stains of any bacteria (Jersek et al. 1996, Bruijn, 1992). Ligase chain reaction: a new DNA detection method that uses thermostable ligase to discriminate exquisitely and amplify single base changes in the genes of interest. The enzyme specifically links two adjacent oligo nucleotides when hybridized to a complementary target only. Single base mismatch prevents ligation and amplification, thus this technique can distinguish closely related but distinct strains, not possible to be differentiated by other techniques. (Zebala and Barany, 1993). Although very useful technique and exploited a lot with strains of Neisserio, Listeria, Erwinia and Chlamydia etc.,


technique has not been exploited for Salmonella. The subject is beautifully reviewed by Pfeffer et al. (1995). Amplified fragment length polymorphism (AFLP): This technique has successfully been applied for molecular epidemiological typing of many gram negative and gram positive bacteria (Gibson et al. 1998). This method involves the digestion of total purified bacterial DNA using a restriction enzyme followed by the ligation of the resulting fragments to a double stranded oligonucleotide adapter which is complementary to the base sequence of the restriction site. The adapters are designed such that the original restriction sites are not restored after ligation thus preventing further restriction digestion. Since, the adaptors are not phosphorylated, adapter to adapter ligation is prevented. Selective PCR amplification of these fragments is achieved using primers corresponding to the contiguous base here sequences in the adapter, restriction site plus one or more nucleotides in the original target DNA. Resulting DNA fragments amplified by PCR and then analysed by gel electrophoresis. For Hind III based AFLP the adapters and primers are : Hind III digestion: AGCTT A A TTCGA Adapter

ADHI 5 ADH2 3

Selective primer HI-x5

ACGGTATGCGACAG GAGTGCCATACGCTGTCTCGA

3 5

GGTATGCGACAGAGCTTX

3

X-indicates the selective base inserted into the primers, number of Xs may also vary and Xmay be either A, C, G or T (Janssen et al., 1996). Pulsed field Gele electrophoresis (PFGE) : This is a very strong technique for epidemiological purpose and in Europian Union (EU) countries Enter-net group is formed to make database using reference strains of Salmonello serovars through a standard method described hereunder : o

From overnight cultures grown at 37 C, 1ml aliquots are centrifuged (13000 rpm, 5 min) to o pellet cells, cells are washed and resuspended in NSS (0.85% NaCl) then heated to 40 C and mixed with equal volume of 2% molten agarose and dispensed into moulds (150-200 ul/well). When cooled o plugs are gently removed and lysed over 2 nights at 56 C in 1ml lysis buffer (pH 9.5, 0.5 M EDTA, 1% N-lauroylsarcosine containing 500 ug/ml proteinase K) then washed 5 times in TE buffer (pH 7.5, o 10mM Tris, 10mM EDTA) at room temperature and can be stored in TE for months together at 4 C. o Each agarose plug is digested overnight at 37 C with X baI, 30 units. PFGE is performed with (HEF o DRIT system (BIORAD) in 0.5 X TBE buffer (50 mM Tris, 45 mM Boric acid, 0.5 mM EDTA) at 14 C on a resolving 1% agarose gels with a low molecular weight PFG ladder ( DNA ladder) at 4.5 volts/cm (150 volts) for 48 hr. Pulse times ramps from 5 seconds to 60 seconds during the run. Gel are stained with ethidum bromide and visualized under UV light (Threlfall, Personal communication). RFLP : Restriction fragment length polymorphism, it is a southern blot & PCR based techniques. In this technique target genes, usually 16S or 23S rRNA genes are amplified by using specific primers through PCR and PCR product is digested with one or more restriction enzyme to produce a restriction profile. This profile is specific to strains of different species and origin. It is a valuable tool in hands of epidemiologists to apply for investigations. rRNA spacer region polymorphism (PCR-Ribotyping). The distance variation between conserved regions of 16S and 23S rRNA is specific according to genus, species and serovars and this specificity has been exploited for differentiation as well as identification of many bacteria including salmonella. PCR ribotyping has been used for S. Enteritids (Landeras and Mendazo 1998) and S. enterica serogroup G (Martin et al. 1997). Aversions of this technique, a mapped restriction site polymorphism (MRSP) have been successfully employed to subgroup strains of a species (Rafph et al. 1993). Commonly used primers for MRSP are : For 16S rRNA 5 5

TCAAGGAGGTGATCCAGC CGTTTGATCCTGGCTCAG

3 3

For 23S rRNA 5 5

TATGAACCTGCTTCCCATCGACTAC 3 ATTCCGTCAGTAGCGGTGAGCGAA 3


On 5 end any restriction site for cloning purposes can be inserted. Of the above techniques a few are mainly directed towards diagnosis while PFGE, RAPD-APPCR, REP-PCR, ERIC-PCR, AFLP, RFLP and PCR-ribotyping are important for strain differentiation and have been used as important tools for molecular typing in epidemiology of Salmonella targeted towards investigation of outbreaks. Other methods which have also been exploited for epidemiological typing are: Bacteriocin typing Bacteriophage typing Plasmid analysis – plasmid profiling Pyrolysis mass spectrometry profiles Ribotyping and Proteomics-Protein profile, etc. Common Salmonella serovars of Animals in India. (compiled from reports of NSC (vet) and NSCKasauli (1958-2000). Serovars are written in order of descending frequency of occurrence. Poultry birds : Gallinarum, Typhimurium, Anatum, Virhow, Enteritidis, Weltevreden Indiana and >31 other serovars. Other birds :

Typhimurium, Virchow, Gallinanem, Bareilly and Enteritidis.

Pigs :

Virchow, Choleraesuis, Typhimurium, Weltevreden, Anatum, Stanley, Saintpaul and Newport.

Cattle

Dublin, Anatum, Newport, Typhimurium, Enteritidis, Chester and Paratyphi B.

Buffalo

Dublin, Gallinorum, Rostock, Typhimurim and Weltev redum.

Sheep

Anatum, Typhimurim, Reading, Bareilly and Saintpaul

Goat

Typhimurim, weltevreden, Virchow, Enteritidis, Bareilly, Saintpaul, New port, Infantis, Anatum and Give.

Horse

Abortus-equi, Rough, Newington, Typhimurium, Gallinarum, Rostock, Saintpaul and Bovis morbificans.

Camel

Typhi, Typhimurum, Saintpaul, Adelaide and Limete.

Fish

Typhimurium, paratuphi B, Javiana, Saintpaul, kentudy.

Wild Animals

Typhimurium, Enteritidis, Agona, Reading, London, Derby and Rough strains.

Reptides and Amphibians

Weltevreden, Goverdhan, Typhimurium, Bareilly, Newport, Enteritidis and Schwarzengrund.

Most common serovars from animals having zoonotic significance : Typhimurium, Enteritidis, Weltevreden, Newport, Sainpaul, Bareilly, Stanley, Anatum and Reading.

Selected bibliography : Tian, H.; Miyamoto, T.; Okabe, T., Kuramitsu, Y., Honjoh, K. and Bato, S. (1996). J. Food Prot. 59 : 1158-1163.


Blais, B.W., Chan, P.L., Phillippe, L.M., Brook, B.W. Hayashi, S. and Yamazaki, H. (1997). Int. J. Food Microbiol. 37 : 183-188. Afflu, L. and Gyles, C.L. (1997). Int. J. Food Microbiol., 37 : 241-244. John, T.J. (1996). Indian J. Med. Res. 103 : 4-18. Pfeffer, M., Weldmann, M. and Butt, C.a. (1995). Vet. Res. Commun. 19 : 375-407. Shimer, G.H., Jr. and Backmor, K.C. (1995). Method Mol. Biol. 46 : 269-278. Parry, C.M., Hoa, N.T.T., Diep, T.S. et al. (1999). J. Clin. Microbiol. 37 : 2882-2886. Stone, G.G., Oberst, R.D., Hays, M.P., McVey, S. and Chengappa, M.M. (1994). J. Clin. Microbiol., 32 : 1742-49. Olsen, J.E., Aabo, S., Hill, W., Noterman, S.S. et al. (1995). Int. J. Food Microbiol. 28 : 1-78. Chaudhari, P., Singh, V.P., Sharma, B. (1997). Indian J. Exp. Biol. 35: 668-669. Lin, J.J., Kuo, J. and Mo, J. (1996). Nucleic Acid Res. 24 : 3649-`3650. Money, T., Reader, S. Qu, L.J., Dunford, R.P. and Moore, G. (1996). Nucleic Acid Res. 24 : 26162617.

PCR For enterotoxin stn gene Stn-1 5’ TTG TGT CGC TAT, CAC TGG CAA CC 3’ STN-2 5’ ATT CGT AAC CCG CTC TCG TCC 3’ PRODUCT SIZE 617 BP Rahman H. (1999) Indian J Med Res. 110:47
