regulating the expression of interleukin 4 (IL-4) may shed light on the differentiation of ... induced activity of the IL-4 promoter region in the thymoma cell line EL4.
Proc. Natl. Acad. Sci. USA Vol. 90, pp. 9707-9711, October 1993 Immunology
Molecular dissection of the mouse interleukin-4 promoter (lymphokine/transcription factors/gene/T lymphocytes)
KEVIN W. BRUHN, KEATS NELMS, JEAN-LOUIS BOULAY, WILLIAM E. PAUL, AND MICHAEL J. LENARDO* Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892
Contributed by William E. Paul, July 13, 1993
that succumb to Leishmania major infection produce mostly IL-4, while T cells from mouse strains that mount a successful immune response that eliminates the parasite produce mostly IFN-y (13, 14). Predominance of a THO response has also been suggested to play a role in the control of infections of humans with human immunodeficiency virus (17) and other pathogens. Thus, understanding the molecular mechanisms that control the lymphokine profiles of CD4+ T cells may elucidate fundamental aspects of the immune response in specific disease states. Although the difference in IL gene expression in THO and TH2 cells has been well documented, the underlying molecular mechanisms have yet to be determined. One mechanism that could contribute to the differential expression of lymphokine genes in CD4+ T cells would be TH subclass-specific function of cis-acting elements in lymphokine gene promoters. The cloning and characterization of the mouse and human genes encoding IL-4 have facilitated analysis of the promoter regions (18, 19). Recent studies have provided evidence for possible control elements within the human IL-4 promoter (20, 21). In this report we dissect the mouse IL-4 promoter and define two elements that are important for its expression in T cells. One of these elements, termed consensus sequence 1 (CS1), was found to be critical to the function of the mouse IL-4 promoter in activated T cells; it also interacts with an inducible nuclear factor. We also demonstrated a restricted activation of the murine IL-2 and IL-4 promoters in TH1 and TH2 cells, respectively. Interestingly, the CS1 element had inducible activity in a TH2 T-cell clone but not in a THO T-cell clone, raising the possibility that this DNA sequence and the factors that bind to it directly participate in differential expression of the IL-4 promoter in CD4+ T cells with different lymphokineproducing phenotypes.
ABSTRACT Understanding the molecular mechanisms regulating the expression of interleukin 4 (IL-4) may shed light on the differentiation of lymphokine-producing phenotypes of CD4+ T cells. We have identified two DNA segments that are necessary for full phorbol 12-myristate 13-acetate (PMA)induced activity of the IL-4 promoter region in the thymoma cell line EL4. Through deletion and mutation analyses, one of these segments (-57 through -47) was shown to be indispensable for promoter function. We designated this sequence consensus sequence 1 (CS1), as it shares homology with a sequence (ATTTTCCNNTG) that appears five times in the proximal 302-base-pair (bp) region 5' of the gene. We examined CS1 in further detail, as well as a second consensus sequence, CS2, located at nucleotides -75 through -65; both are within a minimal 83-bp construct that expresses full promoter activity. CS1- and CS2-spanning oligonucleotides bound apparently distinct PMA-inducible, sequence-specific factors in mobility-shift assays. Multimer constructs linking CS1- or CS2-spanning oligonucleotides to a heterologous promoter revealed that the CS1 construct had the greater enhancer activity in EL4 cells. Mutating the CS1 sequence within the context of the 302-bp promoter abolished all activity of the promoter, while mutating the CS2 sequence alone had little effect. Furthermore, a CS1 multimer could drive a heterologous promoter in an IL-4-producing [helper T-cell type 2 (TH2-type)] T-cell clone but not in a non-IL-4-producing (THl-type) clone, suggesting a mechanism by which IL-4 production could be differentially regulated in TH subsets.
Interleukin 4 (IL-4) mediates a wide array of biological effects in the immune system including the regulation of B- and T-cell growth and development (1-3). It is produced both by a subset of CD4+ T cells and by mast cells and basophils (3-5). Naive CD4+ T cells produce little IL-4 but may differentiate into IL-4 producers depending on the conditions of priming. The most important factor in determining whether naive T cells develop into IL-4 producers is IL-4 itself (6-9). In its absence, CD4+ T cells differentiate mainly into cells that produce 'yinterferon (IFN- y) but not IL-4 (7). Long-term clones of CD4+ T cells retain these distinct phenotypes and have been termed helper T cell types 1 and 2 (TH1 and TH2 cells) (10-12). THi cells are typified by IL-2, IFN-y, and lymphotoxin production, while TH2 cells characteristically produce IL-4 as well as IL-5, IL-6, and IL-10 (10-12). The specific functions of the different CD4+ T-cell subsets reflect the distinct patterns of lymphokine produced by these cells. IL-4-producing (TH2) cells are excellent helper cells for antibody responses, whereas IFN-y-producing (TH1) cells mediate cellular immune responses. The array of lymphokines produced by CD4+ T cells in a specific immune response can be crucial to the effectiveness of the response and is often characterized by a dominance of IFN- yor IL-4 production (13-16). T cells from strains of mice
MATERIALS AND METHODS Plasmid Construction and Mutations. Plasmids pIL-4-776, pIL-4-440, and pIL-4-302 were constructed by cloning fragments of a PCR product of the 5' upstream region of the mouse IL-4 gene into the Xba I site of pCAT-Basic (Promega), in which CAT is the chloramphenicol acetyltransferase gene. Deletions were generated by exonuclease III/ mung bean nuclease treatment of pIL-4-302 (Exo III/mung bean deletion kit, Stratagene). Synthetic oligonucleotides we call "[79:56]" and "[60:35]" (see Fig. 3A) were cloned in multiple copies into the Sal I site of pBLCAT2 (22). Mutation constructs pIL-4mt(83-77) (from -83 to -77), pIL4mt(CS1), and pIL-4mt(CS2) were made by a PCR-based method of "gene SOEing" (23). Nucleotides -83 through -78 were mutated to 5'-AGATCT-3' in pIL-4mt(83-77); CS1 and CS2 were each replaced by 5'-TCTAGA-3' in pILAbbreviations: IL, interleukin; PMA, phorbol 12-myristate 13acetate; CAT, chloramphenicol acetyltransferase; TK, thymidine kinase; CS, consensus sequence; TH cell, helper T cell; IFN, interferon; TCRa, T-cell receptor a chain; EMSA, electrophoretic mobility shift assay. *To whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
9707
9708
4mt(CS1) and pIL-4mt(CS2), respectively. All constructions were verified by DNA sequencing. The plasmid pIL-2-0.3kb was made by cloning a Fok I-Pst I fragment of the IL-2 promoter (24) into the HindIII/Pst I site of pBLCAT3 (22). TCRa-CAT is a T-cell receptor a-chain enhancer-c-fos promoter-CAT fusion gene (25). Cell Lines and Transfections. D.10, A.E7, and F1.A.2 cell lines (26-28) were cultured in EHAA medium (Biofluids, Rockville, MD) with 10% (vol/vol) fetal bovine serum, 2 mM glutamine, 100 units of penicillin per ml, 100 pg of streptomycin per ml, and 60,uM 2-mercaptoethanol. EL4 is a murine thymoma cell line and was cultured in RPMI 1640 medium similarly supplemented. Cells were transfected by electroporation with an Electro Cell Manipulator 600 (BTX, San Diego) under the following conditions: 250 V, 2000 ,uF, and 186 Qi for EL4, A.E7, and F1.A.2; and 250 V, 2850 ,uF, and 72 fl for D.10. 5-10 x 106 (EL4) or 20 x 106 (D.10, A.E7, F1.A.2) cells in 250 ,ul of culture medium containing 20% fetal bovine serum were incubated on ice for 10 min in 0.4-cm cuvettes prior to and after electroporation. Cells were incubated at 37°C in 8 ml of medium, stimulated for 48 hr before harvesting (unless otherwise noted), and then lysed by three freeze/thaw cycles. Total protein amounts were measured by a Bio-Rad protein assay, and equivalent amounts of protein from each sample were assayed for CAT enzyme activity (29) or total CAT enzyme present (CAT ELISA kit, Boehringer Mannheim). Autoradiograms of thin-layer chromatographic CAT assays were quantitated by using a computing densitometer (Molecular Dynamics). Nuclear Extracts and Electrophoretic Mobility Shift Assays (EMSAs). Nuclear extracts were prepared from untreated or phorbol 12-myristate 13-acetate (PMA)-stimulated (10 ng/ml, for 8 hr) EL4 cells by the method of Dignam et al. (30). Mobility shifts were performed as described (31) with 10 ug of nuclear extract, 0.2 pg of poly[dI-dC] as a nonspecific competitor, and 20,000 cpm of labeled double-stranded oligonucleotide probe. DNA-protein complexes were resolved on 4.5% Tris/glycine/EDTA polyacrylamide gels as described (31). Sequences of probes used in EMSA are as follows: [79:56] (CS2),5'-TAAAATTTTCCAATGTAAACTCAT (upper strand) and 5'-ATGAGTTTACATTGGAAAATTTTA (lower strand); and [68:35] (CS1), 5'-AATGTAAACTCATTTTCCCTTGGTTTCAGCAA (upper strand) and 5'TTGCTGAAACCAAGGGAAAATGAGTTTACATT (lower strand). The double-stranded 4RMUT oligonucleotide was used as a nonspecific competitor and has the sequence 5'GCAGTGAAGCAGGGTGCCGCCCAAGATCCTGGG (upper strand) and 5'-CCCAGGATCTTGGGCGGCACCCTGCTTCACTGC (lower strand).
L= * pIL-4 -302
I L
IT
pIL-4
pIL-4 -776
-440
tt
TCR a p-CAT CAT
FIG. 1. Activity of various lengths of the 5' upstream promoter of the mouse IL-4 gene. Autoradiogram of a thin-layer chromatographic analysis of CAT activity of various IL-4-CAT fusion genes transfected into EL4 cells. IL-4 promoter regions extending 302, 440, and 776 bp upstream of the transcription initiation site were linked to the CAT reporter gene. TCRa-CAT served as a positive control; p-CAT is a promoterless CAT gene. Lanes: -, no stimulation; +, stimulation with 10 ng of PMA per ml starting 2 hr after electroporation for 2 days. Ten-microgram aliquots of protein extracts were assayed.
Deletion Analysis of the 302-bp Region Upstream of the IL-4 Gene Reveals Two Sequences Important for Inducible Activity. We analyzed plasmids containing progressively larger deletions from the 5' end of the 302-bp promoter region (Fig. 2A). No significant differences in PMA-inducibility in EL4 cells were observed among constructs containing deletions upstream of position -83 (data not shown). Removing nucleotides -83 through -78 caused partial loss of both basal and inducible activity (Fig. 2B). Removal of nucleotides -77 through -59 caused little, if any, further change in activity, but deleting nucleotides -58 through -53 abolished all inducibility of the promoter. Homologous Sequences Within the Region Downstream of Nucleotide -83 Function Differentially. Inspection of the region downstream of nucleotide -83 revealed two sequences that fit the consensus sequence ATTTTCCNNTG (Fig. 3A). A similar sequence has recently been shown to be A
302
-286
JHL40 -2~30 7/2/14 7-32~ -13 11
B -83
58
AT
-
vm
-77
RESULTS The 302-Base-Pair (bp) Region Upstream of the 1L-4 Gene Is Sufficient to Confer Inducibility. To determine the critical elements of the IL-4 promoter, we tested three constructs containing the bacterial CAT gene under the control of different lengths of IL-4 promoter sequence beginning at the transcription initiation site. PMA has been shown to be sufficient to induce IL-4 production in the mouse lymphoma cell line EL4 (1). EL4 cells transiently transfected with the 302-, 440-, and 776-bp constructs showed modest levels of constitutive CAT activity (Fig. 1). PMA treatment induced CAT activity to an essentially equivalent degree with each construct (Fig. 1). A positive control construct containing the CAT gene under control of the TCR a-chain promoter displayed substantial constitutive activity that was further induced by PMA (Fig. 1). These results indicate that the 302-bp region upstream of the transcription start site of the IL-4 promoter is sufficient for the promoter to function as a PMA-inducible cis-acting element.
~ CAT
Proc. Natl. Acad. Sci. USA 90 (1993)
Immunology: Bruhn et al.
E unstimulated U +PMA
-52
CAT 0
10 20 30 40 50 picograms of CAT enzyme
FIG. 2. Deletion analysis of the 302-bp upstream region of the mouse IL-4 gene. (A) Deletion schematic of the 302-bp IL-4 promoter region. The endpoints of various deletions are shown relative to the transcription initiation site (18). (B) Transfection of EL4 cells comparing selected deletion constructs. Transfections were done in triplicate by electroporation; values shown are the arithmetic means with the standard deviation. Unstimulated and stimulated pairs were split from one cuvette; stimulated cells received 10 ng of PMA per ml starting 24 hr after electroporation and continuing for 2 days. The amount of CAT enzyme per 25 ,Mg of total protein was measured by a CAT ELISA kit (Boehringer Mannheim). Similar results were also obtained in an independent experiment using a conventional CAT assay (data not shown).
Immunology: Bruhn et al. A 87-83 TG
ATTTTlCCNNTG
consensus sequence:
-77 TAA AT
X
CT
tctagaa mtCS2
agatct mt(83-77)
5C512CS32
58
CS
Proc. Natl. Acad. Sci. USA 90 (1993)
G TT
tctaga mtCS1 60
CTMA:E7flccci:C
TTTCAGCAACT
oligo [60:35]
-79 -56 TAAA IATrCCAATG AAACTCAT oligo [79:56]
B
pBLCAT2
73.0 *2.8
El
unstimulated * +PMA
]1.9
11.8 J2.5
p[79:56]2
_1 2.0
(CS2)
]2.0
8.4
18.3
p[60:35]2
57.9.7
(CSi)
51.1
10
0
20 30 40 % transacetylation
60
50
C plL-4 -302
jIIH 2.5
pIL-4
0.7
mt(83-77)
pIL-4 mt(CS2) pIL-4 mt(CS1)
17.
8.1 2.1 I=:________________________16.6
} 0-4 1.0
0
1E unstimulated
10
basal activity and enhancing PMA inducibility 7- to 8-fold over the basal level. We mutated both consensus sequences as well as the region from base pair -83 to -77 that was implicated as important by our deletion analysis, in the context of the 302-bp IL-4 promoter. Mutating base pairs -83 to -77 decreased both basal and PMA-induced levels of CAT activity by s50%, whereas mutating the CS2 site had no effect (Fig. 3C). Mutating CS1 alone abrogated virtually all activity of the 302-bp promoter. Inducible Function of the CS1 and CS2 Elements Correlates with Specific DNA-Protein Interactions. The inducible function of oligonucleotides containing the CS1 and CS2 elements suggested strongly that these sequences interact with nuclear transcription factors in EL4 cells after activation with PMA. Using EMSA and nuclear extracts prepared from unstimulated and PMA-stimulated EL4 cells, the interaction of nuclear proteins with double-stranded oligonucleotide probes encompassing sequences -68 through -35 [68:35] containing CS1 and -79 through -56 [79:56] containing CS2 were tested. Inducible DNA-protein interactions were detected with both the [68:35] and [79:56] probes in PMAtreated but not untreated EL4 nuclear extracts (Fig. 4, arrowheads). The binding to each oligonucleotide was specific because the interaction could be blocked by competition with the same oligonucleotide but not with an oligonucleotide of unrelated sequence, 4RMUT (Fig. 4, lanes 7 and 8 and 15 and 16). Oligonucleotides [68:35] and [79:56] with specific mutations in the CS1 and CS2 sequences (see Fig. 3A), respectively, were also unable to competitively block nucleoprotein binding to the wild-type probes, suggesting that the CS1 and CS2 sequences themselves are important for binding (data not shown). Surprisingly, the [79:56] and [68:35] oligo-
A
* +PMA
FIG. 3. Identification and characterization of two homologous sites important for mouse IL-4 gene activity. (A) Boxes identify two homologous sequences within the region downstream of nucleotide -83, CS1 and CS2. Numbers above the sequence indicate deletion points analyzed in Fig. 2. The oligonucleotides used to construct multimer plasmids are shown and identified by their respective endpoints. Each consensus sequence was separately replaced within the 302-bp promoter with the six-nucleotide sequence 5'TCTAGA-3' to form two mutant plasmids, mtCS1 and mtCS2, respectively. An additional mutant plasmid, mt(83-77), was made in which nucleotides -83 through -78 were replaced with the sixnucleotide sequence 5'-AGATCT-3'. (B) Transfection of EL4 cells comparing multimer constructs fused to a heterologous thymidine kinase (TK) promoter. Transfections shown in duplicate are TK promoter alone (pBLCAT2) and TK promoter linked to two copies of the oligonucleotide containing CS2 (p[79:56k2) or CS1 (p[60:3512)(C) A transfection of EL4 cells comparing constructs with specific mutated sites. Triplicates shown are the 302-bp wild-type plasmid (pIL-4-302) and mutant plasmids containing the 302-bp promoter with six-nucleotide substitutions that replace the following regions, respectively -83 to -77, CS2, and CS1. Stimulations were as described in the legend to Fig. 2.
important in the function of other lymphokine gene promoters (32). We linked oligonucleotides -60 through -35 [60:35] containing CS1 and -79 through -56 [79:56] containing CS2 to a minimal TK gene promoter to determine whether these sequences could function as enhancer units capable of driving a heterologous promoter. Two copies of the [79:56] oligonucleotide containing CS2 increased PMA-inducible levels of CAT activity over the TK promoter alone by ==4-fold (Fig. 3B). A 2-mer of oligonucleotide [60:35] containing CS1 had significantly greater effect, causing 2- to 3-fold increased
B
Competitor
20
% transacetylation
9709
=10-
Z 2
[79:561 [68:35] (CS2) (CS1) 4RMUT x
U)
C\U
x
0
U)
x
U) CU
x
x
10 LN CM Lo
Competitor [68:351 [79:561
(CS1) (CS2) 4RMUT _ (0< x x Lx x x) x
x
Z D
2
.
1D cm
0 U)
0 CY 1U
N
Q
2
1 2
3 4
5
6 7
oligo[79:56] (CS2)
8
9 10 11 12 13 14 15 16
oligo[68:351 (CSI)
FIG. 4. Inducible binding of nuclear factors to the CS1 and CS2 regions of the mouse IL-4 promoter. EMSAs and competition assays were performed with unstimulated (lanes 1 and 9) or PMA-stimulated (10 ng/ml for 8 hr; lanes 2-8 and 10-16) EL-4 nuclear extracts with oligonucleotides [68:35] and [79:56] containing CS1 and CS2, respectively (defined in text). (A) EMSA using oligonucleotide [79:56] as probe. (B) EMSA using oligonucleotide [68:35] as probe. Arrows indicate specific, inducible DNA-protein complexes. Asterisks in A indicate nonspecific complexes. 1 and 2 in B indicate specific constitutive complexes. Cold competitor oligonucleotides were added in 25-fold or 50-fold molar excess. 4RMUT is a nonspecific competitor that does not contain the IL-4 promoter sequence. Faint faster migrating complexes were not seen in repeated extracts and may be degradation products.
Proc. Natl. Acad. Sci. USA 90 (1993)
Immunology: Bruhn et al.
9710
nucleotides cross-competed only very weakly (Fig. 4A, lanes 5 and 6; and Fig. 4B, lanes 13 and 14). Together with a subtle difference in migration of the two inducible complexes, the lack of cross-competition suggested that each site bound a distinct nucleoprotein complex. A time-course experiment revealed that the nucleoprotein complexes reached maximal induction in EL4 cells at 6-8 hr, a time when significant IL-4 mRNA can be detected (data not shown). Faster migrating complexes were observed at variable levels in different extracts and were not specific with the [79:56] oligonucleotide but did appear specific with the [68:35] sequence (Fig. 4B, complexes 1 and 2). In some unstimulated extract preparations, detectable but diminished binding activity was observed that was similar in mobility to the inducible activity in PMA-treated extracts, suggesting that a low level of the inducible factors may be present in unstimulated EL4 cells (data not shown). Untreated and PMA-treated extracts were of equal integrity and concentration as indicated by the level of the constitutive nuclear factor Oct-1 in control EMSAs (data not shown). TH2-SpCcifilC Inducibility of the IL-4 Promoter Can Be Localized to the CS1 Element. We next tested =300-bp versions of both the IL-2 and IL-4 promoters in TH1 and TH2 clones. In the TH1 clone F1.A.2, the IL-2 promoter was strongly inducible by PMA and ionomycin, while the IL-4 promoter had little apparent function above background, reflecting the selective expression of the endogenous IL-2 gene in these cells (Fig. 5). By contrast, the IL-4 promoter showed moderate inducibility in the TH2 clone D.10, which produces IL-4 and not IL-2. These results strongly suggest that both 300-bp upstream regions were sufficient to mediate the transcriptional specificity of the IL-2 and IL-4 genes in the TH1 and TH2 lymphocyte subtypes. Constructs of 83 bp and shorter were also tested in D.10 cells. We observed slight decreases in inducible activity corresponding with deletions through nucleotide -78 and through -59, but basal activity was unchanged. After removal of nucleotides through -53 the promoter lost some basal activity and all of its inherent inducibility (Table 1, experiment A). These results are similar to those obtained in EL4 cells with regard to the critical role of the CS1 element but suggest a functional role for sequences immediately upstream of it. In transfections of the multimer constructs of both CS1- and CS2-spanning oligonucleotides, we found that, in contrast to EL4 cells, a construct containing two copies of TH2
TH1 I-
I-
i
L-
+ I-
pCATBasic pIL-2 0.3kb
+
pIL-4 -302
-
+1 1-
+
pCATBasic pIL-2 0.3kb
1-
+1
plL-4 -302
FIG. 5. Inducible function of the IL-2 and IL-4 promoters are specific to TH1 and TH2 clones, respectively. F1.A.2 TH1 cells and D.10 TH2 cells were transfected with CAT expression vectors containing the 300-bp mouse IL-2 promoter (pIL-2-0.3kb) or the 302-bp IL-4 promoter (pIL-4-302). pCAT-Basic does not contain any promoter sequences. Results are representative of three experiments.
Table 1. The CS1 site is necessary for promoter activity and can drive a heterologous promoter in a TH2-specific manner CAT activity, % transacetylation A.E7 (TH1) D.10 (TH2) Unstim. +PMA/iono. Unstim. +PMA/iono. Construct Exp. A: promoter deletion analysis ND 2.9 3.4 pCAT-Basic ND 22.4 6.1 -83 ND 7.0 18.8 -77 ND 15.2 6.2 -58 ND 3.1 3.8 -52 Exp. B: function of promoter elements 7.9 11.1 7.1 8.8 pBLCAT2 7.5 5.5 6.0 5.3 p[79:56h2(CS2) 5.4 5.2 6.5 45.8 p[60:35b3(CS1) 28.3 48.3 9.6 14.3 TCRa-CAT In experiment A, D. 10 TH2 cells were transfected with a series of IL4 promoter deletion constructs. Results are representative of two experiments. In experiment B, D. 10 TH2 cells or A.E7 TH1 cells were transfected with constructs containing CS1- or CS2-containing oligonucleotides (defined in text) cloned upstream to a minimal TK promoter. Results are representative of three experiments. Unstim., unstimulated; +PMA/iono., stimulation with PMA and ionomycin; ND, not determined.
the CS2-spanning oligonucleotide [79:56] failed to drive the TK promoter in either THO or TH2 clones (Table 1, experiment B). By contrast, a multimer of the CS1-spanning oligonucleotide [60:35] enhanced PMA/ionomycin-stimulated CAT activity -7-fold in the TH2 clone but not in the THO clone. A TCRa-CAT gene had strong inducible activity in both clones, demonstrating that comparable transfection was achieved. Thus, the CS1-spanning region [60:35] contains an element that may be sufficient to cause specific activation in TH2 cells but not THO cells.
DISCUSSION Very little is known about the molecular mechanisms by which a naive CD4+ T lymphocyte becomes committed to a TH2 phenotype. One of the hallmarks of TH2 cells is the production of IL-4, which serves as an autocrine growth factor for T cells and a growth and differentiation factor for B cells (1-3). We carried out a molecular dissection of the IL-4 promoter to explore the possibility that differential expression of factors regulating promoter function might determine acquisition of the TH2 phenotype. Serial deletions showed that sequences upstream of nucleotide -83 were dispensable for basal and inducible promoter function in both EL4 lymphoma cells and the TH2 clone D.10. We identified a short sequence between -83 and -77 that contributed to basal and induced promoter function. We also identified two sequences, CS1 and CS2, that fit the consensus ATTTTCCNNTG. Oligonucleotides containing either sequence could act as PMA-inducible enhancer elements in EL4 cells, and each bound a distinct PMA-inducible nuclear factor. However, deletions or mutations of CS2 had little effect on the activity of the 302-bp promoter construct, suggesting that this element is not critical for promoter function in EL4 cells. By contrast, deletion or mutation of CS1 abolished IL-4 promoter function completely, suggesting that it is a necessary element. The CS1 site also had TH2-specific function when tested in nontransformed THO and TH2 T lymphocyte clones. This is the first indication that a specific cis-acting element is critical to the differential expression of IL-4 in THO and TH2 cells. Therefore, it will be interesting to determine how trans-acting factors achieve this specificity. The very distinct characteristics of the two versions of the ATTTTCCNNTG consensus sequence were intriguing,
Immunology: Bruhn et al. given their homology. Variants of the consensus are found five times throughout the 302-bp IL-4 promoter and in other TH2-specific lymphokine promoters but not in the IL-2 promoter (data not shown). This strengthens the notion that specific versions of the consensus, such as CS1, differentially activate genes in TH2 cells. The fact that only CS1 but not CS2 appears critical for the inducibility of the IL-4 promoter also suggests that microheterogeneity within the consensus sequence or within the surrounding DNA sequences is critical to their function. The inability of the CS2-spanning oligonucleotide to compete effectively for the CS1 nucleoprotein complex in binding assays (and vice versa) clearly illustrates that sequence differences in these oligonucleotides dictate binding specificity. Interestingly, a short sequence downstream of CS1 (at nucleotides -43 to -36) was recently reported to be ionomycin-responsive and indispensable for promoter activity in D.10 cells (33). While deletion and mutation data presented here indicate that this sequence alone is not sufficient to confer PMA-inducibility, its presence within the (60:35] oligonucleotide that has enhancer activity is consistent with its making a contribution to specific function. Previous studies of the human IL-4 promoter have described regulatory elements distinct from those outlined here. Two negative regulatory elements (NRE-I and NRE-II) have been described in the human IL-4 promoter within the sequence -311 to -288 (21). These NREs were described as suppressing a positive regulatory region located -45 bp downstream of them, a region that contains one of the five consensus sequences. We detected no measurable differences in activity in any of our deletions of these regions, casting doubt as to their function in the mouse promoter. Another enhancer sequence defined in the human IL-4 promoter, the P sequence, was defined as nucleotides -79 to -69 and overlaps much of the CS2 sequence defined here (20). Our study agrees with the previous finding that this element is capable of driving a heterologous promoter and binds a specific complex. Nonetheless, our data suggest that the sequence directly upstream of CS2, between -83 and -77, is perhaps more important in the context of the 302-bp promoter. Intriguingly, the sequence encompassing the -83 to -77 region and CS2 bears some resemblance to a previously identified element in the IL-4, IL-5, and GM-CSF (granulocyte/macrophage colony-stimulating factor) gene promoters. This element, termed CLEO, has been demonstrated to be important for GM-CSF promoter function (32). Further work will be necessary to determine if it is a discrete transcription element in the IL-4 promoter, but our results are consistent with this possibility. Recent studies of IL-4 promoter function in mast cell lines have indicated the existence of an enhancer element found in the second intron of the IL-4 gene. Enhancer activity was observed in both transformed and in ionomycin-stimulated nontransformed mast cell lines. However, no evidence for the action of this element in PMA-stimulated EL-4 cells was observed, strongly suggesting tissue-specific differences in enhancer/promoter activity (34). Understanding the molecular mechanisms that lead to the expression of IL-4 in CD4+ T cells may elucidate fundamental aspects of the immune response. In this regard, specific lymphokines have already been shown to play key roles in the regulation of the development of the distinct CD4+ T-cell subsets (6-9, 35, 36). Interestingly, development of IL-4producing CD4+ T cells in vitro and in vivo appears to require IL-4, suggesting that IL-4 is a critical modulator of the ability of T cells to express its own gene (6-9). We speculate that the differentiation process leading to IL-4 production in CD4+ T cells results from the activation or synthesis of transcription factors that mediate the function of the CS1 element and possibly other elements in the IL-4 promoter. Thus, further
Proc. Natl. Acad. Sci. USA 90 (1993)
9711
characterization of the intracellular factors that mediate the expression of the IL-4 gene in developing TH2 cells may well provide important insights into the functional specialization of CD4+ T lymphocytes during an immune response. We thank Sang-Mo Kang and Jane Hu-Li for technical assistance and Louis Staudt and Juan Carlos Zdiiiga-Pflucker for reading of the manuscript. M.J.L. is a recipient of a Cancer Research Institute Investigator Award. 1. Howard, M., Farrar, J., Hilfiker, M., Johnson, B., Takatsu, K., Hamaoka, T. & Paul, W. E. (1982) J. Exp. Med. 155, 914-923. 2. Yokota, T., Arai, N., de Vries, J., Spits, H., Banchereau, J., Zlotnik, A., Rennick, D., Howard, M., Takebe, Y., Miyataka, S., Lee, F. & Arai, K. (1988) Immunol. Rev. 102, 137-187. 3. Paul, W. E. (1989) Cell 57, 521-524. 4. Brown, M. A., Pierce, J. H., Watson, C. J., Falco, J., Ihle, J. N. & Paul, W. E. (1987) Cell 50, 809-818. 5. Plaut, M., Pierce, J. H., Watson, C. J., Henley-Hyde, J., Nordon, R. P. & Paul, W. E. (1989) Nature (London) 339, 64-67. 6. Le Gros, G., Ben-Sasson, S. Z., Seder, R., Finkelman, F. D. & Paul, W. E. (1990) J. Exp. Med. 172, 921-929. 7. Seder, R. A., Paul, W. E., Davis, M. M. & Fazekas de St. Groth, 8.
9. 10. 11.
12. 13. 14. 15.
16. 17.
18. 19.
20. 21. 22. 23. 24.
25. 26. 27. 28.
29. 30. 31.
32. 33. 34. 35. 36.
B. (1992) J. Exp. Med. 176, 1091-1098. Swain, S. L., Weinberg, A. D., English, M. & Huston, G. (1990) J. Immunol. 145, 3796-3806. Betz, M. & Fox, B. S. (1990) J. Immunol. 145, 1046-1052. Mosmann, T. R. & Coffman, R. L. (1989) Annu. Rev. Immunol. 7, 145-173. Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A. & Coffman, R. L. (1986) J. Immunol. 136, 2348-2357. Cherwinski, H. M., Schumacher, J. H., Brown, K. D. & Mosmann, T. R. (1987) J. Exp. Med. 166, 1229-1244. Scott, P., Natovitz, P., Coffman, R. L., Pearce, E. & Sher, A. (1988) J. Exp. Med. 168, 1675-1684. Heinzel, F. P., Sadick, M. D., Holaday, B. J., Coffman, R. L. & Locksley, R. M. (1989) J. Exp. Med. 169, 59-72. Pearce, E. J., Caspar, P., Grzych, J.-M., Lewis, F. A. & Sher, A. (1991) J. Exp. Med. 173, 159-166. Salgame, P., Abrams, J. S., Clayberger, C., Goldstein, H., Convit, J., Modlin, R. L. & Bloom, B. R. (1991) Science 254, 279-282. Sher, A., Gazzinelli, R., Oswald, I. P., Clerici, M., Kullberg, M., Pearce, E. J., Berzofsky, J. A., Mosmann, T. R., James, S. L. & Morse, H. C. (1992) Immunol. Rev. 127, 183-204. Otsuka, T., Villaret, D., Yokota, T., Takebe, Y., Lee, F., Arai, N. & Arai, K. (1987) Nucleic Acids Res. 15, 333-344. Arai, N., Nomura, D., Villaret, D., Malefijt, R. D., Seiki, M., Yoshida, M., Minoshima, S., Fukuyama, R., Maekawa, M., Kudoh, J., Shimizu, N., Yokota, K., Abe, E., Yokota, T., Takebe, Y. & Arai, K. (1989) J. Immunol. 142, 274-282. Abe, E., Malefyt, R. D., Matsuda, I., Arai, K. & Arai, N. (1992) Proc. Natl. Acad. Sci. USA 89, 2864-2868. Li-Weber, M., Eder, A., Krafft-Czepa, H. & Krammer, P. H. (1992) J. Immunol. 148, 1913-1918. Luckow, B. & Schutz, G. (1987) Nucleic Acids Res. 15, 5490. Horton, R. M., Cai, Z., Ho, S. N. & Pease, L. R. (1990) BioTechniques 8, 528-535. Novak, T. J., White, P. M. & Rothenberg, E. V. (1990) Nucleic Acids Res. 18, 4523-4533. Winoto, A. & Baltimore, D. (1989) EMBO J. 8, 729-733. Kaye, J., Porcelli, S., Tite, J., Jones, B. & Janeway, C. A. (1983) J. Exp. Med. 158, 836-856. Hecht, T. T., Longo, D. L. & Matis, L. A. (1983) J. Immunol. 131, 1049-1055. Ashwell, J. D., Fox, B. S. & Schwartz, R. H. (1986) J. Immunol. 136, 757-768. Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-1051. Dignam, J. D., Lebovitz, R. M. & Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489. Nelms, K., Hromas, R. & Van Ness, B. (1990) Nucleic Acids Res. 18, 1037-1043. Miyatake, S., Shlomai, J., Arai, K. & Arai, N. (1991) Mol. Cell. Biol. 11, 5894-5901. Todd, M. D., Grusby, M. J., Lederer, J. A., Lacy, E., Lichtman, A. H. & Glimcher, L. H. (1993) J. Exp. Med. 177, 1663-1674. Henkel, G., Weiss, D. L., McCoy, R., Deloughery, T., Tara, D. & Brown, M. A. (1992) J. Immunol. 149, 3239-3246. Hsieh, C.-S., Macatonia, S. E., Tripp, C. S., Wolf, S. F., O'Garra, A. & Murphy, K. M. (1993) Science 260, 547-549. Heinzel, F. P., Schoenhaut, D. S., Rerko, R. M., Rosser, L. E. & Gately, M. K. (1993) J. Exp. Med. 177, 1505-1509.
