© Med Sci Monit, 2007; 13(4): BR89-94 PMID: 17392641
WWW. M ED S CI M ONIT .COM
Basic Research
Received: 2006.05.09 Accepted: 2006.10.02 Published: 2007.03.30
Molecular epidemiology and characterization of resistance mechanisms to various antimicrobial agents in Acinetobacter baumannii isolated in Mérida, Venezuela
Authors’ Contribution: A Study Design B Data Collection C Statistical Analysis D Data Interpretation E Manuscript Preparation F Literature Search G Funds Collection
Elsa Zuleima Salazar De Vegas1,2 ABDEFG, Beatriz Nieves2 AE, Marc Ruiz3 AF, Joaquim Ruíz4 DEF, Jordi Vila3 ADEF, Araque María2 B, Velázco Elsa2 B 1
Department of Bioanalysis, Bacteriology Laboratory, University of Oriente, Sucre Campus, Venezuela Department of Bacteriology and Parasitology, Dr. Roberto Gabaldón Bacteriology Laboratory, School of Pharmacy and Bioanalysis, University of Los Andes, Mérida, Venezuela 3 Microbiology Service, Biomedical Diagnostics Center, Clinical Hospital, IDIBAPS, School of Medicine, University of Barcelona, Villarroel, Barcelona, Spain 4 Internacional Health Center, IDIBAPS, Clinical Hospital, Villarroel, Barcelona, Spain 2
Source of support: This work was supported by: Science, Technology, and Innovation Center of Venezuela, FONACIT (Grants: S1 2001001159 and F: 2000001633); Center for Sanitary Research (FIS 02/0353), and Spanish Network for Research on Infectious Pathology (REIPI C03/14), Ministry of Health, Spain, and the Department of Universities, Research, and Information Society of the Generality of Catalonia, Spain (2002 SGR00121, to J.V.). MR has a fellowship from REIPI and JR one from RICET, the Centers for Tropical Disease Research Network, Spain
Summary Background:
Material/Methods: Results:
Conclusions:
A. baumannii outbreaks are difficult to control because of the relative ease with which this microorganism spreads and persists in hospital settings. Successive papers reported increased resistance in clinical isolates of A. baumannii, currently resistant to most antibiotics. The purpose of this study was to characterize the epidemiological relationship and the mechanisms of resistance to several antimicrobial agents of a collection of A. baumannii strains. Twenty A. baumannii isolated from two intensive care units (ICUs) at the Instituto Autónomo Universitario de Los Andes, Mérida, Venezuela, were analyzed by PFGE. Characterization of resistance determinants to various antimicrobial agents was also carried out. PFGE typing revealed five different patterns. Pattern 1, susceptible to ciprofloxacin and cefepime, was found to be spread among the patients of both ICUs and was also cultured from a humidifier in the neonatal ICU. All the strains were resistant to gentamicin and tetracycline, 90% to amikacin and cefotaxime, and 85% to ciprofloxacin. The resistance of the strains to ceftazidime, cefepime, and imipenem was 40, 50, and 10%, respectively. All the strains showed b-lactamases with Ips equal to 5.4 (TEM-1) and greater than 9. Furthermore, two of them, both exhibiting resistance to imipenem, presented a b-lactamase with an Ip of 7.2 (OXA-58). Three of seven amikacin-resistant A. baumannii strains (PFGE-2) carried the gene encoding the APH(3’)-VIa enzyme and two strains (PFGE-5) had the TET(B) determinant. This study shows the dissemination of A. baumannii clinical isolates, a humidifier being the source of the strain.
key words:
Acinetobacter • resistance • PFGE • OXA-58
Full-text PDF:
http://www.medscimonit.com/fulltxt.php?IDMAN=9147
Word count: Tables: Figures: References: Author’s address:
1944 2 1 39 Elsa Zuleima Salazar De Vegas, Parcelamiento Miranda. Sector “F”, Nº 11, Tabasca Street, Elsa Residence, Cumaná, state of Sucre. Venezuela. Postal Code 6101, e-mail:
[email protected]
Current Contents/Clinical Medicine • SCI Expanded • ISI Alerting System • Index Medicus/MEDLINE • EMBASE/Excerpta Medica • Chemical Abstracts • Index Copernicus
BR89
BR
Basic Research
BACKGROUND Nosocomial infections by Acinetobacter spp. have increased in recent years, mainly affecting immunocompromised patients. This has been partly related to the increase in invasive and therapeutic diagnostic procedures in intensive care units for the past 20 years [1–5]. A. baumannii is the genomic species most widely involved in nosocomial infections. A. baumannii outbreaks are difficult to control because of the relative ease with which this microorganism spreads and persists in hospital settings. Successive papers have reported increased resistance in clinical isolates of A. baumannii, currently resistant to most antibiotics [2,6]. Although several resistance mechanisms to different antimicrobial agents in A. baumannii have been studied, some reports have not taken into account that in order to differentiate Acinetobacter species, it is necessary to use genetic methods, since phenotypic differentiation cannot distinguish between the species belonging to the A. calcoaceticusA. baumannii complex. The main purpose of this study was to characterize the epidemiological relationship and the mechanisms of resistance to several antimicrobial agents of a collection of A. baumannii strains isolated from patients in two different intensive care units and from the environment.
MATERIAL AND METHODS Bacterial strains All the A. baumannii isolates (a total of 20) recovered at the Instituto Autónomo Hospital Universitario de Los Andes (IAHULA), in Merida, Venezuela, from January 1998 to April 1999 were included in this study. Fifteen of these strains were taken from clinical samples obtained from patients hospitalized in the intensive care unit for adults (ICU-A), four were collected from neonatal patients, and one was cultured from a humidifier in the high-risk neonatal unit (NICU). Identification and characterization of A. baumannii The strains were identified as A. baumannii by biochemical testing [7], API 20NE strips, and amplified 16S rDNA restriction analysis (ARDRA). The identification was confirmed by further 16S rDNA gene sequence analysis following previously described procedures [8]. The A. baumannii strains were typed by Pulse Field Gel Electrophoresis (PFGE) following previously referenced methodology [8]. The PFGEpatterns were interpreted following the criteria of Tenover et al. [9]. Antimicrobial susceptibility The susceptibility to antimicrobial agents was determined by E-test following the manufacturer’s guidelines (AB Biodisk, Sölna, Sweden). The breakpoint values used were those recommended for non-fermenting Gram-negative bacteria by the CLSI [10]. The antimicrobial agents used were cefotaxime, ceftazidime, cefepime, imipenem, amikacin, gentamicin, ciprofloxacin, and tetracycline. The strains used as controls were Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853.
BR90
Med Sci Monit, 2007; 13(4): BR89-94
Determination of resistance determinants to b-lactam, aminoglycosides, and tetracyclines The production of b-lactamases was detected by means of the nitrocefin slide test (Oxoid Group, Basingstoke, UK) and double disk potentiation [11]. For the determination of the isoelectric point (Ip), crude extracts were prepared from b-lactamases as previously described [12] and tested in IEF 3-9 Phastgel by Phastsystem electrophoresis (Amersham Pharmacia, Upsala, Sweden). The gels were developed with nitrocefin and the Ips were determined by using b-lactamase extracts with known Ips. The presence of TEM, CARB, SHV, IMP, and several OXA-like b-lactamases was determined by PCR with previously described primers and conditions [13–16]. Detection of the aac(6’)-1b, aac(6’)-1h, aph(3’)-V1a genes, as well as that of tetA, tetB, tetG, and tetM genes was performed by PCR following previously described methodology [17–20]. The PCR products were recovered from the agarose gel and purified by means of the commercial purification system Wizard® SVG Clean Up (Promega Corporation) in accordance with the instructions of the supplier. The samples were sequenced using the V 3.1 BigDye® Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and analyzed in an automated DNA sequencer (Abi Prism 377, Perkin Elmer, Emeryville, CA, USA). The primers used for the amplification and sequencing are described in Table 1. Detection of type 1 integrons The amplification of integrons was performed according to the previously described conditions [21].
RESULTS The 20 strains used in this study were identified as A. baumannii by API 20 NE and ARDRA as well as by 16S rDNA sequencing (data not shown). The 20 A. baumannii isolates typed by PFGE revealed five different patterns. Pattern 1 was constituted by nine isolates, eight from patients (four from the ICU-A and four from the NICU) and one from a humidifier in the neonatal unit. Patterns 2, 3, and 4 had three strains each and pattern 5, two strains (Figure 1, Table 2). All the strains were resistant to gentamicin and tetracycline, 90% were resistant to amikacin and cefotaxime, and 85% were resistant to ciprofloxacin. The resistance of the strains to ceftazidime, cefepime, and imipenem was 40, 50, and 10%, respectively. Seven different antibiograms were obtained, antibiogram A, characterized by resistance to all antimicrobial agents tested except imipenem, being the most frequently found. (Table 2). All the strains showed b-lactamase activity and presented b-lactamases with Ips equal to 5.4 and greater than 9. In all strains, a TEM-type b-lactamase gene was amplified. The comparison of the 1080-bp sequence with the sequences in the Genebank showed that this sequence corresponded to a TEM-1-type b-lactamase. Only the two strains presenting resistance to imipenem (PIN 404 and PIN 544B),
Salazar De Vegas EZ et al – Resistance mechanism in A. baumannii
Med Sci Monit, 2007; 13(4): BR89-94
BR
Table 1. Primers designed in this study for Polymerase Chain Reaction. Gene (Enzyme)
Primers
Amplicon (bp)
imp-like
Imp1: 5’-CATTTICATAGCGACAGCAC-3’ Imp2: 5’-CTTCTAIATTTGCGTCACCC-3’
oxa-24, 25, 26, 33, 40, 72
Oxa24-26u: 5’-ATGAAAAAATTTATACTTCCT-3’ Oxa24-26L: 5’-TTAAATGATTCCAAGATT-3’
oxa- 5, 7, 10, 11, 13, 13-1, 14, 16, 17, 19, 28, 35
OXA 5-7U: 5’-TATATTCCAGCATCAACATT-3’ OXA 5-7L: 5’-ATGATGCCCTCACTTGCCAT-3’
601
oxa-58
OXA-58U 5’-AGTATTGGGGCTTGTGCT-3’ OXA-58L 5’-AACTTCCGTGCCTATTTG-3’
453
tem-like
Tem-AMP 1: 5’-ATAAAATTCTTGAAGACGAAA-3’ Tem-AMP 2: 5’-GACAGTTACCAATGCTTAATCA-3’
1080
shv-like
Bla-SHV-1: ATGCGTTATATTCGCCTGTG Bla-SHV-2: TTAGCGTTGCCAGTGCTCG
841
284 825/828
tive for two strains (Table 2). Type 1 integrons were also not detected.
DISCUSSION
Figure 1. Chromosomal analysis by PFGE. Digestion of the DNA of A. baumannii with ApaI. Line M, Molecular weight marker, phage λ. Each line shows the results of the different patterns. Line 1, pattern 1. Line 2, pattern 2. Line 3, pattern 3. Lines 4, 5, and 6 patterns 4, 41, and 42, respectively. Line 7, pattern 5. both belonging to the same pulsotype (PFGE-2), presented a b-lactamase with an Ip 7.2 that was identified by PCR and sequencing as an OXA-58. There was no amplification of genes encoding the b-lactamases type IMP, CARB, or SHV (Table 2). The gene that encodes for the aph(3’)-VIa enzyme was detected in three strains of A. baumannii. There was no amplification for the aac(6’)-Ib or aac(6’)-Ih genes in any of the strains. Genes encoding for tetA, tetG, and tetM were not detected; however, PCR for the tet(B) gene yielded posi-
The determination of the relationship among bacterial isolates involved in nosocomial infections is a prerequisite for epidemiological research. PFGE is a very useful tool in epidemiological analysis, strain differentiation, and in the monitoring of bacterial dissemination. The epidemiological molecular characterization of 20 resistant strains of A. baumannii isolated from two intensive care units by PFGE and their antibiotic susceptibility yielded two different scenarios. Pulsotype 1 was present in both intensive care units, but there was a high heterogeneity of clones in the adult one. It is worth nothing that antibiogram A, characterized for its high resistance to all the antimicrobial agents tested except imipenem, was the profile most frequently found among the strains. It is also important to point out that the A. baumannii strain isolated from the humidifier was susceptible to ciprofloxacin and cefepime, while those isolated from the clinical specimens and belonging to the same clone (PFGE-1) were resistant to these antibiotics (antibiogram A). This finding suggests that the humidifier was possibly the source of this strain, and that the selective pressure exerted by the antimicrobial agents used in these patients could explain the difference in antibiogram between the clinical and the environmental strains [22]. Nowadays, A. baumannii is considered one of the nosocomial microorganisms with the most extended pattern of resistance [23]. In our study it was found that all the strains presenting a b-lactamase TEM-1 were resistant to ampicillin. In addition, 10% of them, two epidemiologically related isolates belonging to pulsotype B and possessing an additional OXA-58, a b-lactamase that has been associated with either decreased susceptibility or resistance to carbapenems [24,25], were resistant to imipenem. Interestingly, isolate PIN 341-B, presenting the same pulsotype B as the OXA-58-carrying strains, did not present this b-lactamase and was susceptible to imipenem. This fact suggests either the possible recent acquisition of this
BR91
Basic Research
Med Sci Monit, 2007; 13(4): BR89-94
Table 2. Characteristics of the Acinetobacter baumannii strains. Strain Source PFGE RP CTX1 CAZ1 FEP1 IPM1 AK1 GEN1 CIP1 PIN 082-C1 ICU-A
1
A
128 32
2
PIN 085-B1 ICU-A
1
A
128 64
PIN 341-B ICU-A
2
A
PIN 390-2 ICU-A
1
PIN 404
ICU-A
Ip
TEM OXA CARB SHV
aph- aac(6’) (3’)-VIa -Ib Ih
tet ABGM
4 >256 >256 >32 5.4, >9
+
–
–
–
–
––
––––
24
4
48 >256 >32 5.4, >9
+
–
–
–
–
––
––––
256 48
24
1.5 128 >256 >32 5.4, >9
+
–
–
–
+
––
––––
A2
128 16
24
3 128 >256 >32 5.4, >9
+
–
–
–
–
––
––––
2
B
256 16
24
32 >256 >256 >32 5.4, 7.2, >9 +
+
–
–
+
––
––––
PIN 434-B2 ICU-A
1
A1
128 24
16
4
+
–
–
–
–
––
––––
PIN 538-A ICU-A
3
C
64 12
+
–
–
–
–
––
––––
PIN 544-B ICU-A
2
B
256 16
96 >32 >256 >256 >32 5.4, 7.2, >9 +
+
–
–
+
––
––––
PIN 544-C ICU-A
3
D
32
6
6 0.50 24
64
8
5.4, >9
+
–
–
–
–
––
––––
PIN 550-B ICU-A
3
D
64
8
8 0.50 24
64
12
5.4, >9
+
–
–
–
–
––
––––
PIN 562
4
A
256 64
64 0.75 64 >256 >32 5.4, >9
+
–
–
–
–
––
––––
PIN 596-D2 ICU-A 41
A2
256 12
24 0.75 192 >256 >32 5.4, >9
+
–
–
–
–
––
––––
PIN 597-1 ICU-A 42
E
256 16
21 >32 5.4, >9
+
–
–
–
–
––
––––
PIN 653-A ICU-A
5
F
16
3 1.50
24 256 0.19 5.4, >9
+
–
–
–
–
––
–+––
PIN 653-B1 ICU-A
5
F
16
4 1.50 0.50 32
48 0.19 5.4, >9
+
–
–
–
–
––
–+––
PIN 274-2 NICU
1
A1
256 24
48 >256 >32 5.4, >9
+
–
–
–
–
––
––––
PIN 296-2 NICU
1
E
256 12
5.4, >9
+
–
–
–
–
––
––––
PIN 428-B1 NICU
1
A
256 32
24 0.75 32 >256 >32 5.4, >9
+
–
–
–
–
––
––––
PIN 682
1
A
256 32
64
+
–
–
–
–
––
––––
Humid1 ifier
G
256 16
+
–
–
–
–
––
––––
PIN 7-HU
ICU-A
NICU
12 0.75
128>256 >32 5.4,.>9 64 64
4 0.75 12
16
1 3
6
8 0.50 16 >256 24 4
5.4, >9
96 >256 >32 5.4, >9
3 0.75 32
96 0.64 5.4, >9
ICU-A – Intensive Care Unit for Adults; NICU – High Risk Neonatal Unit; PFGE – Pulse Field Gel Electrophoresis Pattern; RP – Resistance Pattern; CTX – cefotaxime; CAZ – ceftazidime; FEP – cefepime; IMP – imipenem; AK – amikacin; GEN – gentamicin; CIP – ciprofloxacin; Ip – isoelectric point; 1 All MICs in mg/L b-lactamase in the other related strains or the loss of the OXA-58 in that strain. TEM-1 has been extensively described in different plasmids, whether conjugative or not [23], while OXA-58 has been described in a series of imipenem-resistant strains of A. baumannii, among them six epidemiologically related clinical isolates that caused an outbreak in a hospital burnunit, and an unrelated environmental isolate [25]. In all cases it was located in a class 1 integron within a non-conjugative 30-kb plasmid. Quite recently, OXA-58-carrying strains have been described in A. baumannii and other related microorganisms such as A. junii in Australia, Austria, Argentina, Greece, Romania, Spain, Turkey, and the United Kingdom, among others [26-30]. In those cases they were also located in differently sized plasmids, and conjugation assays performed on them repeatedly failed, suggesting their non-conjugative nature. To our knowledge, this is the first report of the presence of OXA-58 in Venezuela. This report, in addition to those re-
BR92
cently published, shows the great ability of resistance genes (or isolates) to spread geographically. The easy and swift intercontinental spread of resistant bacteria and genes thanks to modern forms of transportation has been well documented in previous studies [31]. Aminoglycosides, particularly gentamicin and amikacin, are widely used in the treatment of nosocomial infections caused by Gram-negative bacteria. Up until a short time ago, amikacin continued to be the most active aminoglycoside in the treatment of infections caused by Acinetobacter. In this study, all the strains were resistant to gentamicin and 90% were resistant to amikacin. The aph(3’)-VIa gene was detected in three strains, all of them belonging to pulsotype B, the same that carries the OXA-58 gene, while none of the mechanisms assayed for aminoglycoside-resistant aac(6’)-Ib and aac(6’)-Ih genes were detected in any strain. Different explanations may be proposed, two being the possible presence of other amikacin-resistance encoding genes, or the overexpression of an efflux pump, such as adeABC, which affects aminoglycosides [32].
Med Sci Monit, 2007; 13(4): BR89-94
The genes encoding resistance to b-lactamics and aminoglycosides, among others, may be located in transposons, integrons, and/or plasmids [16,23,33–36]. However, although 95% of the strains analyzed, including those resistant to imipenem, presented plasmids ranging from two to over 10 kb, there was no transference of genes encoding resistance against these antimicrobial agents from the A. baumannii strains to the strain of E. coli J53 (data not shown). According to Towner [37], most cases of transferable resistance in Acinetobacter spp. are possibly associated with plasmids belonging to incompatibility groups in which the transposons and the integrons probably play an important role by incorporating themselves into a gene pool and, thus, onto carrying plasmids [36,38]. The presence of gene cassettes encoding aminoglycoside-modifying enzymes has been demonstrated within class 1 integrons, which are incorporated into the bacterial genome [36]. On the other hand, previous studies [16,33,34] have found integrons carrying genes which confer resistance to b-lactam antibiotics in A. baumannii; however, no class 1 integrons were found in the strains included in this study. The absence of integrons in these strains constitutes a difference that has been extensively described. In fact, it has been shown that multiresistant A. baumannii strains usually carry integrons. A previous study by Ribera et al. [34] found that around 28% of the clinical isolates of A. baumannii present type 1 integrons. Although other researchers have found strains of A. baumannii that carry tetA, tetB, and/or tetM [19,20,39], among the determinants of resistance to tetracycline assayed in this study, the tet(B) encoding gene was found in only two of the 20 strains of A. baumannii. The strains bearing the tet(B) gene (653-A and 653-B) presented the same antibiogram (F) and PFGE pattern [5] and were isolated from different samples cultured from the same patient.
CONCLUSIONS In summary, a high heterogeneity of clones in an adult intensive care unit in a short period of time is defined. In addition, a predominant clone, likely originating in a humidifier in a neonatal intensive care unit, acquiring resistance to cefepime and quinolones and, thereafter disseminating to both an adult and a neonatal intensive care units, has been characterized. The presence of OXA-58 in two isolates and other enzymes as also described herein makes it necessary that a continuous surveillance of resistance levels and mechanisms be carried out.
REFERENCES: 1. Bergogne-Bérézin E, Towner K: Acinetobacter spp as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Res, 1996; 9: 148–65 2. Bou G, Cervero G, Dominguez MA et al: Characterization of a nosocomial outbreak caused by a multiresistant Acinetobacter baumannii strain with a carbapenem-hydrolyzing enzyme: high-level carbapenem resistance in A. baumannii is not due solely to the presence of b-Lactamases. J Clin Microbiol, 2000; 38: 3299–305 3. Nuñez ML, Martinez-Toldos MC, Bru M et al: Appearance of resistance to meropenem during the treatment of a patient with meningitis by Acinetobacter. Scand J Dis, 1998; 30: 421–23 4. Pandey A, Kapil A, Sood S et al: In vitro activities of ampicilin-sulbactam and amoxicilin-clavulanic acid against Acinetobacter baumannii. J Clin Microbiol, 1998; 36: 3415–16
Salazar De Vegas EZ et al – Resistance mechanism in A. baumannii 5. Spence RP, Towner KJ, Henwood CJ et al: Population structure and antibiotic resistance of Acinetobacter DNA group 2 and 13TU isolates from hospitals in the UK. J Med Microbiol, 2002; 51: 1107–12 6. Vila J, Ribera A, Marco F et al: Activity of clinafloxacin, compared with other four quinolones, against Acinetobacter baumannii clinical isolates with known mechanisms of quinolone resistance. J Antimicrob Chemother, 2002; 49: 471–77 7. Bouvet P, Grimont P: Taxonomy of the Genus Acinetobacter with the Recognition of Acinetobacter baumannii sp. nov, Acinetobacter haemolyticus sp. nov. Acinetobacter johnsonii sp. nov. and Acinetobacter junii sp. nov. and Emended Descriptions of Acinetobacter calcoaceticus and Acinetobacter lwoffii. Int J Syst Bacteriol, 1986; 36: 228–40 8. Salazar de Vegas EZ, Nieves B, Araque M et al: Outbreak of Infection With Acinetobacter Strain RUH 1139 in an Intensive Care Unit. Infect Control Hosp Epidemiol, 2006; 27: 397–403 9. Tenover FC, Arbeit RD, Goering RV et al: Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol, 1995; 33: 2233–39 10. National Committee for Clinical Laboratory Standards (NCCLS): Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically, 6th ed. Approved Standards M7-A6, Villanova. PA, USA. 2003 11. Jarlier V, Nicolas M, Fournier G, Philippon A: Extended broad-spectrum b-lactamases conferring transferable resistance to newer b-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev Infect Dis, 1988; 10: 867–77 12. Mathew A, Harris AM, Marshall MJ, Ross GW: The use of analytical isoelectric focusing for detection and identification of b-lactamases. J Gen Microbiol, 1975; 88: 169–78 13. Danes C, Navia MM, Ruiz J et al: distribution of b-lactamases in Acinetobacter baumannii Clinical isolates and the effect of Syn 2190 (AmpC inhibitor) on the MICs of different b-lactam antibiotics. J Antimicrob Chemother, 2002; 50: 261–64 14. Navia MM, Capitano L, Ruiz J et al: Typing and characterization of the mechanisms of resistance in Shigella sp. isolated from faeces of children in Ifakara (Tanzania). J Clin Microbiol, 1999; 37: 3113–17 15. Gallardo F, Ruiz J, Marco F et al: Increase in incidence of resistance to ampicillin, chloramphenicol and trimethoprim in clinical isolates of Salmonella serotype Typhimurium with investigation of molecular epidemiology and mechanisms of resistance. J Med Microbiol, 1999; 48: 367–74 16. Vila J, Navia M, Ruiz J, Casals C: Cloning and nucleotide sequence analysis of a gene encoding an OXA-derived b-lactamase in Acinetobacter baumannii. Antimicrob Agents Chemother, 1997; 41: 2757–59 17. Ploy MC, Giamarellou H, Bourlioux P et al: Detection of aac(6’)-I genes in amikacin-resistant Acinetobacter spp. by PCR. Antimicrob Agent Chemother, 1994; 38: 2925–28 18. Vila J, Ruiz J, Navia M et al: Spread of amikacin resistance in Acinetobacter baumannii strains isolated in Spain due to an epidemic strain. J Clin Microbiol, 1999; 37: 758–61 19. Guardabassi L, Dijkshoorn L, Collard JM et al: Distribution and in-vitro transfer of tetracycline resistance determinants in clinical and aquatic acinetobacter strains. J Med Microbiol, 2000; 49: 929–36 20. Ribera A, Ruiz J, Vila J: Presence of the Tet M determinant in a clinical isolate of Acinetobacter baumannii. Antimicrob Agents Chemother, 2003; 47: 2310–12 21. Levesque C, Roy PH: PCR analysis of integrons. In: Persing DH, Smith TF, Tenover FC, White TJ, eds. Diagnostic molecular microbiology: principles and applications. Washington, D.C.: American Society for Microbiology 1993; 590–94 22. Oteo J, Alós I: ¿Qué hay de nuevo en la resistencia bacteriana a los antimicrobianos? Enferm Infecc Microbiol Clín, 2002; 20: 28–33 23. Vila J: Mechanism of antimicrobial resistance in Acinetobacter baumannii. Rev Med Microbiol, 1998; 9: 87–97 24. Poirel L, Marque S, Heritier C et al: OXA-58, a novel class D b-lactamase involved in resistance to carbapenems in Acinetobacter baumannii Antimicrob Agents Chemother, 2005; 49: 202–8 25. Heritier C, Dubouix A, Poirel L et al: A nosocomial outbreak of Acinetobacter baumannii isolates expressing the carbapenem-hydrolysing oxacillinase OXA-58. J Antimicrob Chemother, 2005; 55: 115–18 26. Marqué S, Poirel L, Héritier C et al: Regional Occurrence of PlasmidMediated Carbapenem-Hydrolyzing Oxacillinase OXA-58 in Acinetobacter spp. in Europe. J Clin Microbiol, 2005; 43(9): 4885–88
BR93
BR
Basic Research 27. Coelho J, Woodford N, Afzal-Shah M, Livermore D: Occurrence of OXA-58-Like carbapenemases in Acinetobacter spp. Collected over 10 Years in three Continents. Antimicrob. Agents Chemother, 2006; 50(2): 756–58 28. Peleg AY, Franklin C, Walter LJ et al: OXA-58 and IMP-4 CarbapenemHydrolyzing b-lactamases in an Acinetobacter junii Blood Culture Isolate from Australia. Antimicrob. Agents Chemother, 2006; 50: 399–400 29. Pournaras S, Markogiannakis A, Ikonomidis A et al: Outbreak of multiple clones of imipenem-resistant Acinetobacter baumannii isolates expressing OXA-58 carbapenemases in an intensive care unit. J. Antimicrob. Chemother, 2006; 57: 557–61 30. Vahaboglu H, Budak F, Kasap M: High prevalence of OXA-51-type class D b-lactamases among ceftazidime-resistant clinical isolates of Acinetobacter spp.: co-existence with OXA-58 in multiple centers. J. Antimicrob. Chemother, 2006; 58: 537–42 31. Navia MM, Ruiz J, Vila J: Dispersión intercontinental de una cepa de Shigella flexneri resistente a trimetoprim. Enferm Infecc Microbiol Clín, 2003; 21: 401–3 32. Magnet S, Courvalin P, Lambert T: Resistance-nodulation-cell divisiontype efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454. Antimicrob Agents Chemother, 2001; 45: 3375–80
BR94
Med Sci Monit, 2007; 13(4): BR89-94 33. Navia MM, Ruíz J, Vila J: Characterization of an integron carrying a new class D b-lactamase (OXA-37) in Acinetobacter baumannii. Microb Drug Resist, 2002; 8: 261–65 34. Ribera A, Vila J, Fernandez-Cuenca F et al: Type 1 integrons in epidemiologically unrelated Acinetobacter baumannii isolates collected at Spanish hospitals. Antimicrob Agents Chemother, 2004; 48: 364–65 35. Ruiz J, Navia MM, Casals C et al: Integron-mediated antibiotic multiresistance in Acinetobacter baumannii clinical isolates from Spain. Clin Microbiol Infect, 2003; 9: 907–11 36. Seward RJ, Towner KJ: Detection of integrons in worldwide nosocomial isolates of Acinetobacter spp. Clin Microbiol Infect, 1999; 5: 308–18 37. Towner KJ: Plasmid and transposon behaviour in Acinetobacter. In: Towner KJ, Bergogne-Bérézin E, Fewson CA, eds. The biology of Acinetobacter. New York: Plenum Publishing Corp., 1991; 149–67 38. Collis CM, Grammaticopoulos G, Briton J et al: Site-specific insertion of gene cassettes into integrons. Mol Microbiol, 1993; 9: 41–52 39. Huys G, Cnockaert M, Vaneechoutte M: Distribution of tetracycline resistance genes in genotypically related and unrelated multiresistant Acinetobacter baumannii strains from different European hospitals. Res Microbiol, 2004; 156: 348–55
Index Copernicus Global Scientific Information Systems for Scientists by Scientists
IndexCopernicus.com
www.
EVALUATION & BENCHMARKING PROFILED INFORMATION NETWORKING & COOPERATION VIRTUAL RESEARCH GROUPS GRANTS PATENTS CLINICAL TRIALS JOBS STRATEGIC & FINANCIAL DECISIONS
Index Copernicus integrates
IC Scientists
IC Virtual Research Groups [VRG]
Effective search tool for collaborators worldwide. Provides easy global networking for scientists. C.V.'s and dossiers on selected scientists available. Increase your professional visibility.
Web-based complete research environment which enables researchers to work on one project from distant locations. VRG provides:
IC Journal Master List
IC Patents
Scientific literature database, including abstracts, full text, and journal ranking. Instructions for authors available from selected journals.
Provides information on patent registration process, patent offices and other legal issues. Provides links to companies that may want to license or purchase a patent. IC Grant Awareness
IC Conferences Effective search tool for worldwide medical conferences and local meetings.
Need grant assistance? Step-by-step information on how to apply for a grant. Provides a list of grant institutions and their requirements.
customizable and individually self-tailored electronic research protocols and data capture tools, statistical analysis and report creation tools,
profiled information on literature, publications, grants and patents related to the research project, administration tools.
IC Lab & Clinical Trial Register Provides list of on-going laboratory or clinical trials, including research summaries and calls for co-investigators.
